| Literature DB >> 28611803 |
Longmei Wu1,2,3, Wujun Zhang4, Yanfeng Ding1,2,3, Jianwei Zhang1,2,3, Elidio D Cambula1,2,3, Fei Weng1,2,3, Zhenghui Liu1,2,3, Chengqiang Ding1,2,3, She Tang1,2,3, Lin Chen1,2,3, Shaohua Wang1,2,3, Ganghua Li1,2,3.
Abstract
Low solar radiation caused by industrial development and solar dimming has become a limitation in crop production in China. It is widely accepted that low solar radiation influences many aspects of plant development, including slender, weak stems and susceptibility to lodging. However, the underlying mechanisms are not well understood. To clarify how low solar radiation affects stem mechanical strength formation and lodging resistance, the japonica rice cultivars Wuyunjing23 (lodging-resistant) and W3668 (lodging-susceptible) were grown under field conditions with normal light (Control) and shading (the incident light was reduced by 60%) with a black nylon net. The yield and yield components, plant morphological characteristics, the stem mechanical strength, cell wall components, culm microstructure, gene expression correlated with cellulose and lignin biosynthesis were measured. The results showed that shading significantly reduced grain yield attributed to reduction of spikelets per panicles and grain weight. The stem-breaking strength decreased significantly under shading treatment; consequently, resulting in higher lodging index in rice plant in both varieties, as revealed by decreased by culm diameter, culm wall thickness and increased plant height, gravity center height. Compared with control, cell wall components including non-structural carbohydrate, sucrose, cellulose, and lignin reduced quite higher. With histochemical straining, shading largely reduced lignin deposition in the sclerenchyma cells and vascular bundle cells compared with control, and decreased cellulose deposition in the parenchyma cells of culm tissue in both Wuyunjing23 and W3668. And under shading condition, gene expression involved in secondary cell wall synthesis, OsPAL, OsCOMT, OsCCoAOMT, OsCCR, and OsCAD2, and primary cell wall synthesis, OsCesA1, OsCesA3, and OsCesA8 were decreased significantly. These results suggest that gene expression involved in the reduction of lignin and cellulose in both sclerenchyma and parenchyma cells, which attribute to lignin and cellulose in culm tissue and weak mechanical tissue, consequently, result in poor stem strength and higher lodging risks. Highlights: (1) Shading decreases the stem mechanical strength of japonica rice by decreasing non-structural carbohydrate, sucrose, lignin, and cellulose accumulation in culms. (2) The decrease of carbon source under shading condition is the cause for the lower lignin and cellulose accumulation in culm. (3) The expression of genes involved in lignin and primarily cell wall cellulose biosynthesis (OsCesA1, OsCesA3, and OsCesA8) at the stem formation stage are down-regulated under shading condition, inducing defective cell wall development and poor lodging resistance.Entities:
Keywords: Japonica rice (Oryza sativa L.); cell wall synthesis; cellulose; lignin; lodging; shading; sucrose
Year: 2017 PMID: 28611803 PMCID: PMC5447739 DOI: 10.3389/fpls.2017.00881
Source DB: PubMed Journal: Front Plant Sci ISSN: 1664-462X Impact factor: 5.753
List of primer sets used for quantitative real-time quantitative PCR (RT-PCR).
| Gene | Gene location | Forward primer 5′-3′ | Reverse primer 5′-3′ |
|---|---|---|---|
| Os02g0626100 | ACCGCTTCGTGTATCTTCAG | AAGGATGGAATCGAGTAGCA | |
| Os08g0157500 | GAAGGTGGTGGTGGTGGAGT | GCGTTGGCGTAGATGTAGGTG | |
| Os08g0498100 | CACCAACAAGACGCTGCTCAAG | CTCATCCGCCGACGACTGC | |
| Os08g0277200 | CGACCGCCACGACCTCTC | GCCCTGCCTCCGTCATCC | |
| Os02g0187800 | CGACCAGAAGTTTGTGGTGAA | GAAGTGCTTCAGTGGGCTGTA | |
| Os05g0176100 | TTGACTTGCACGATCGATACG | TCCCACATAAACTGGACCCTG | |
| Os07g0424400 | GCATTTTTGCTACTGGCATCC | TCCCTGGAACAAAGCAAAGAG | |
| Os01g54620 | GTTCGATGGCATTGATCGCA | CCACATAAACCGGACCTTGGA | |
| Os10g32980 | CCGGATGGATGATTCTTGTTG | CCCCCAAAACACTTTTATCCC | |
| Os07g0208500 | TGTTGAAGGTGCTGGATTCGA | TGAGAGTGGAGGCAACAAACG | |
| Os09g25490 | AGGCCATCCATGTCATCAGCT | TTGAACCCCGTTAGGATGTCC | |
| Os03g0718100 | CAATCGTGAGAAGATGACCC | GTCCATCAGGAAGCTCGTAGC |
Effects of shading on grain yield and yield components of two japonica rice in 2015 and 2016.
| Treatment | Panicles (m2) | Spikelets per panicles | Spikelets (103/m2) | Spikelets fertility (%) | grain weight (mg) | Yield (t/ha) |
|---|---|---|---|---|---|---|
| Control | 306.9 | 138.8** | 42.6* | 84.10 | 32.0* | 11.5 |
| Shading | 386.4** | 92.0 | 35.6 | 96.9* | 30.6 | 10.6 |
| W3668 | ||||||
| Control | 393.3 | 104.2** | 40.9 | 96.7 | 25.8** | 10.2** |
| Shading | 471.7** | 71.1 | 33.6 | 95.2 | 24.0 | 7.7 |
| Control | 333.3 | 125.6** | 41.9** | 92.9 | 31.0** | 12.0* |
| Shading | 420.8** | 80.1 | 33.7 | 96.1 | 30.3 | 9.8 |
| W3668 | ||||||
| Control | 478.3 | 88.3* | 42.3 | 93.3 | 23.5** | 9.3 |
| Shading | 528.6** | 71.2 | 37.7 | 95.9 | 22.4 | 8.5 |
Effect of shading on culm diameter and culm wall thickness of the fourth internode from the top, gravity center height and plant height in two japonica rice.
| Treatments | Clum diameter (mm) | Culm wall thickness (mm) | Gravity center height (cm) | Plant height (cm) |
|---|---|---|---|---|
| Control | 4.36 | 0.90** | 43.51 | 94.79 |
| Shading | 4.32 | 0.75 | 45.57** | 100.60** |
| W3668 | ||||
| Control | 3.79** | 0.70** | 45.34 | 97.01 |
| Shading | 3.42 | 0.52 | 46.08 | 99.82** |
| Control | 4.67** | 0.86** | 34.90 | 82.15 |
| Shading | 4.41 | 0.74 | 38.43** | 85.50* |
| W3668 | ||||
| Control | 3.89* | 0.69** | 38.41 | 86.87 |
| Shading | 3.74 | 0.57 | 40.86** | 89.87 |
Effects of shading on breaking strength (M), bending stress (BS), bending moment by whole plant (WP) and lodging index (LI) of the fourth internode from the top in two japonica rice at 20 days after the heading stage.
| Treatments | M (g cm) | BS (g cm) | WP (g cm) | LI (%) |
|---|---|---|---|---|
| Control | 2780.7** | 4171.5** | 1741.2 | 62.8 |
| Shading | 2041.0 | 3411.8 | 1765.5 | 86.6** |
| W3668 | ||||
| Control | 1557.3** | 3688.9 | 1298.7** | 83.5 |
| Shading | 1049.0 | 3601.2 | 1077.0 | 102.7** |
| Control | 2679.9** | 3389.2** | 1179.7** | 44.0 |
| Shading | 2111.4 | 3328.1 | 972.0 | 46.1 |
| W3668 | ||||
| Control | 1289.0** | 2920.9 | 783.9 | 60.8 |
| Shading | 936.0 | 2558.3 | 775.1 | 82.8** |