Literature DB >> 28603528

CML20, an Arabidopsis Calmodulin-like Protein, Negatively Regulates Guard Cell ABA Signaling and Drought Stress Tolerance.

Xiaomeng Wu1, Zhu Qiao1, Huiping Liu1, Biswa R Acharya2, Chunlong Li3, Wei Zhang1.   

Abstract

Guard cells shrink in response to drought and abscisic acid (ABA), which is caused by efflux of ions that in turn reduces stomatal aperture and improves the plant's ability to retain moisture. Cytosolic free calcium is an essential secondary messenger in guard cell ABA signaling, but the details of this regulatory pathway remain sketchy. Here, the calmodulin-like protein CML20, which has four EF-hand domains and calcium-binding activity in vitro, was found to be a negative regulator of ABA-induced stomatal movement in Arabidopsis. The guard cells of cml20 loss-of-function mutant plants were hypersensitive to both ABA-activated S-type anion currents, and ABA inhibited inward K+ currents than those of wild type. Additional, due to smaller stomatal aperture, cml20 showed less water loss from the leaves than wild type. These phenotypes of CML20 overexpressing plants contrasted with wild type in the opposite direction. In the cml20 mutant, the transcripts of stress responsive genes, such as MYB2, RAB18, ERD10, COR47, and RD29A were up-regulated in response to drought and ABA, while down-regulated of APX2 transcription and higher reactive oxygen species (ROS) accumulation. These observations support the CML20, a functional Ca2+ sensor, is a negative regulator in guard cell ABA signaling.

Entities:  

Keywords:  CML20; abscisic acid; drought stress; guard cell; stomatal movement

Year:  2017        PMID: 28603528      PMCID: PMC5445667          DOI: 10.3389/fpls.2017.00824

Source DB:  PubMed          Journal:  Front Plant Sci        ISSN: 1664-462X            Impact factor:   5.753


Introduction

Drought stress represents one of the most important constraints on crop productivity. Stomatal closure is a key early plant response to drought stress (Verslues et al., 2006), a process which is controlled by the turgor of the pair of guard cells surrounding each stoma (Kwak et al., 2008). Osmotically driven influx of water is required to expand the guard cell. Drought stress promotes the tissue content of the phytohormone abscisic acid (ABA), which acts as a prominent regulator of stomatal movement through its effect on ion channel activity (Schroeder et al., 2001). ABA inhibits the inward K+ channel and activates the anion channel (Schroeder et al., 1987; Pandey et al., 2007; Vahisalu et al., 2008; Li et al., 2014). The major transducer of ABA signaling is free calcium ion (Ca2+) concentration alterations in the cytoplasm (McAinsh et al., 1990, 1997). The supply of exogenous Ca2+ not only can induce stomatal closure but also can oscillate the concentration of cytosolic Ca2+ (McAinsh et al., 1995; Pei et al., 2000; Siegel et al., 2009). Certain stimuli that induce stomatal opening may also act to enhance the concentration of cytosolic Ca2+ (Kenichiro et al., 1992; Cousson and Vavasseur, 1998). Drought stress (along with other abiotic stresses) alters the plant’s cellular redox balance, often promotes the accumulation of reactive oxygen species (ROS) (Rentel and Knight, 2004). The most prominent ROS is H2O2; its prolonged half-life and high permeability allow it to activate Ca2+ permeable channels (Rentel and Knight, 2004). As mentioned above, stomatal movements are also associated with guard cell calcium concentration changes (Pei et al., 2000; Thor and Peiter, 2014). Ca2+ is required for oxidative burst by activating NADPH oxidase (Xing et al., 1997) and for the activity of NAD kinase, which generates the NADP that subsequently used as a cofactor for NADPH oxidase (Karita et al., 2004; Turner et al., 2004). Many proteins involved in ROS signaling was regulated by Ca2+ signaling (Gong et al., 1997; Yang and Poovaiah, 2002; Takahashi et al., 2011; Ma et al., 2012; Wang et al., 2015). Both, Ca2+ and ROS serve as important signaling molecules in plants, are inter-regulated by feedback loops to keep their homeostasis in plant cells (Sierla et al., 2016). Ca2+ plays important signaling roles in response to abiotic stress and many Ca2+ sensors are targets of Ca2+ in the signaling pathways, and kinds of Ca2+ sensors have been classified into four distinct groups, namely the calmodulins (CaMs), the CaM-like proteins (CMLs), the Ca2+ dependent protein kinase (CDPKs), and the calcineurin B-like proteins (CBLs). All of these proteins contain EF-hand motifs, which allow the binding of Ca2+ (David and Anthony, 2000; Oliver and Jorg, 2012). Transcriptomic analyses have shown that some CMLs members are induced by stress (McCormack et al., 2005). Previously reports have shown that CML9 (Tzahi et al., 1999; Helen and Marc, 2002; Hongtao et al., 2003; Fabienne et al., 2008), CML18, CaM15, and CML24 (Delk et al., 2005; Yamaguchi et al., 2005) are involved in abiotic stress signaling. The function of other CMLs, which represent the largest of these four protein families, remains unclear. To understand more details about the roles of CMLs in abiotic stress signaling, we have screened and found that the mutant cml20 is more tolerant to drought stress. As CML20 an expected Ca2+ sensor, we also analyzed its molecular roles in drought stress and ABA signaling pathway, especially in stomatal movement. CML20 like-proteins have been (a.k.a. CEN1) found to be present in the animal centrosome, where its role implicated in microtubule organization (Juliette et al., 2008). Here, we study the molecular role of CML20 in Arabidopsis in response to drought stress, and its contribution to stomatal movement, ROS production, and ion channel activity in response to ABA.

Materials and Methods

Plant Materials and Growth Conditions

Arabidopsis thaliana ecotype Columbia-0 (Col-0) and the T-DNA insertion mutant cml20 (SALK_079974c) generated in a Col-0 background were obtained from the ABRC[1]. The zygosity of the mutant individuals was validated by PCR using the cml20-specific primer pair cml20-LP/-RP and the T-DNA left border primer LBb1.3[2]. The relevant primer sequences are given in Table . To grow plants, seeds were surface-sterilized by immersing in 75% v/v ethanol for 3 min, followed by 95% v/v ethanol for 1 min, then the ethanol was allowed to evaporate. The seeds were then plated on solidified (0.7% w/v agar) half strength Murashige and Skoog (1962) medium (1/2 MS) and held first for 2 days at 4°C and then kept in a growth chamber under long-day conditions (16 h light/8 h darkness, 22 ± 1/16 ± 4°C) with illumination by 100 μmol m-2s-1 light); the relative humidity was maintained at ∼70%. Primer sequences employed.

Heterologous Expression of CML20 and Ca2+-Binding Assay

The coding region of CML20 (At3g50360) was amplified from Col-0 cDNA by using the primer pair CML20-HisF/-HisR (Table ), while CaM7 (At3g43810) was amplified by using CaM7-HisF/-HisR (Table ) as positive control. The amplicons and the prokaryotic expression vector pET30a (+) were both digested with NdeI and XhoI, and then ligated using T4 DNA ligase (TransGen Biotech, China). For heterologous expression of CML20, E. coli BL21 (DE3) transformants harboring recombinant plasmid CML20 were induced with 0.4 mM isopropyl β-D-1-thiogalactopyranoside (IPTG); the recombinant protein was thereafter purified using the Ni-NTA Purification System (Invitrogen, Uinted States). Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) mobility shift assay for Ca2+ binding was performed by exposing denatured CML20 to either 15 mM CaCl2 or 15 mM ethylene glycol tetraacetic acid (EGTA), as described by Garrigos et al. (1991). The structure of CML20 was predicted using InterPro software[3].

Construction of Plant Expression Vector and Generation of Transgenic Arabidopsis thaliana

To engineer plant expression vector for CML20 over-expression, the gene’s open reading frame was amplified using the primer pair CML20-OEF/-OER (Table ), and the resulting amplicon was digested with XbaI and SacI, then ligated into the XbaI and SacI cloning sites of pSTART (+) which generated the p35S::CML20 construct. The CML20 open reading frame was amplified using the primer pair CML20-CF/-CR (Table ) cloned into pDonor 221 vector and then introduced into pB2GW7.0 vector through gateway reaction (Invitrogen, United States) to generate pB2GW7.0-CML20. cml20 mutant plants were transformed with pB2GW7.0-CML20 to generate complemented lines, C-1 and C-2. The CML20 promoter sequence was amplified using the primer pair CML20-PF/-PR (Table ), then ligated into the HindIII/BamHI cloning site of pCambia::UBI-GUS to generate the construct pCML20::GUS. All the constructs were transferred into Agrobacterium tumefaciens strain GV3101 and then introduced into Arabidopsis using the floral dip method (Clough and Bent, 1998). T1 transgenic seedlings were selected by growing on 1/2 MS containing 30 mg/L kanamycin (p35S::CML20 lines), or hygromycin (pCML20::GUS lines). The zygosity of T3 lines was deduced from the transgene’s segregation behavior, and the abundance of the transgene transcript was assessed by using PCR or quantitative real time PCR (qRT-PCR), and the selected seeds from T3 homozygous lines were used for further analysis.

Subcellular Localization of CML20

A p35S::CML20-GFP construct was generated by inserting the CML20 open reading frame (amplified using CML20-GFPF/-GFPR, see Table ) into the BamHI/SalI cloning sites of a modified GFP expression vector (Lin et al., 2009). Both the p35S::CML20-GFP and the empty p35S::GFP plasmids were purified using a NucleoBond® Xtra Midi Kit[4] (Macherey–Nagel) before introducing into Arabidopsis mesophyll protoplasts following Sheen (2001). After 16 h incubation at 23°C in the dark, protoplasts were examined for GFP signal using confocal laser scanning microscopy (performed at The Microscopy Characterization Facility, Shandong University).

GUS Staining

T3 homozygous transgenic plants harboring pCML20::GUS were assayed for GUS activity as described by Jefferson et al. (1987) with slight modification. Briefly, transgenic plant tissues were soaked in a GUS staining solution (2 mM X-Gluc, 2 mM K3Fe(CN)6, 2 mM K4Fe(CN)6, 0.1% Triton X-100, 10 mM EDTA in 50 mM sodium phosphate buffer, pH7.2) and incubated overnight at 37°C. After staining, the samples were washed in 50, 70, and 100% ethanol for 5 min consecutively, and then shook in 100% ethanol for about 5 h to remove chlorophyll. Subsequently, the samples were examined under an optical microscope.

Drought Stress and Water Loss Experiments

To apply drought stress, the protocol described by Sakamoto et al. (2004) was followed with minor modifications. Seedlings were grown under well-watered conditions for four weeks, and then deprived of water for 2–3 weeks. Then, the plants were re-watered for over three days and photographed. For water-loss assays, rosette leaves were collected from 4-week-old plants as test samples. The samples were weighed immediately on a piece of paper, and then placed on the laboratory bench (relative humidity: 40%–50%; 22°C–23°C). The weight lost by each sample at a set of pre-assigned time points was recorded.

Stomatal Movement

Arabidopsis thaliana plants were grown under a 10 h photoperiod (100 μmol m-2s-1 light), where the light and dark period temperatures were 22 and 20°C, respectively. The stomatal aperture assay was performed using fully expanded young leaves of 4-week-old plants. To characterize stomatal opening, detached rosette leaves were first floated adaxial side up for 2.5 h in the dark in 10 mM KCl, 7.5 mM iminodiacetic acid, 10 mM Mes-KOH (pH 6.15). Subsequently, either 50 μM ABA or solvent control (ethanol) was added, then the treated leaves were illuminated for 2.5 h. For the stomatal closure assay, initially leaves were floated in the solution containing 20 mM KCl, 1 mM CaCl2, 5 mM Mes-KOH (pH 6.15) for 2.5 h in the light, then either ABA (1, 10, or 50 μM) or solvent control (ethanol) was added. In both cases, abaxial epidermal strips were peeled off after 2.5 h incubation (with ABA/solvent control ethanol) and photographed immediately. Stomatal aperture widths were estimated from the captured digital images using ImageJ v1.47[5] software.

Electrophysiology

Arabidopsis thaliana guard cell protoplasts were isolated following the Zhang et al. (2008) method. K+ currents were recorded following Li et al. (2016) with slight modifications. The bath solution contained 4 mM MgCl2, 10 mM MES-Tris (pH 5.6), 1 mM CaCl2, 10 mM K-Glu, and the osmolarity was adjusted to 500 mOSM with sorbitol for measuring whole-cell channel K+ currents. The pipette solution contained 20 mM KCl, 10 mM HEPES-Tris (pH 7.8), and 80 mM K-Glu, and the osmolarity was adjusted to 550 mOSM, and also fresh ATP (5 mM Mg-ATP) was added before use. Axopatch-200B amplifier (Axon Instruments, United States) connected to a computer via an interface (TL-1 DMA Interface; Axon Instruments) was used to achieve whole-cell configuration, and the holding potential was set as –60 mV. The whole-cell currents were recorded 5 min later. The test voltage steps were from –200 mV to –40 mV with +20 mV increments, and each test voltage has 4.9-s duration. For the ABA treatment, 50 μM ABA was added to the bath solution after the whole-cell configuration was achieved. The whole-cell currents were recorded 10 min later. Guard cell anion currents were recorded as described by (Acharya et al., 2013). Briefly, the bath solutions contained 2 mM MgCl2, 30 mM CsCl, 10 mM MES-Tris (pH 5.6), and 1 mM CaCl2. The pipette solutions contained 150 mM CsCl, 2 mM MgCl2, 6.7 mM EDTA, 3.35 mM CaCl2, and 10 mM HEPES-Tris (pH 7.5). Osmolarity of the solutions was adjusted to 480 and 500 mOSM for bath and pipette solutions, respectively, with sorbitol. ATP (10 mM Mg-ATP) and GTP (10 mM) were added to the pipette solution before use. The holding potential was +30 mV. The voltage steps were applied from -145 to +35 mV with +30 mV increments, and each test voltage has a 60-s duration. For the ABA treatment, guard cell protoplasts were treated with 50 μM ABA for at least 1 h before recording.

RT-PCR and qRT-PCR

Total RNA was isolated using the TRIzol reagent (Roche, Switzerland), treated with RNase-free DNase I (Invitrogen, United States) and reverse transcribed using oligo-dT primers and SuperScriptTM III Reverse Transcriptase (Invitrogen, United States). The resulting cDNA was used as template in both RT- and qRT-PCRs. The former employed the CML20-specific primer pair CML20-RTF/-RTR (Table ) and reference reactions were primed by ACTIN2-RTF/-RTR (Table ), to amplify the gene ACTIN2 (At3g18780). For the qRT-PCRs, leaves and epidermal strips derived from four-week old plants were exposed to 50 μM ABA for 6 h. All reactions were performed in triplicates using FastStart Universal SYBR Green master mix (Roche, Switzerland), and ACTIN2 was used as the reference. The CML20-specific primer pair CML20-QF/-QR and the ACTIN2 pair ACTIN2-QF/-QR (Table ) were used for the qRT-PCR assays. The abundance of transcript of a set of known stress-responsive genes was also assayed by qRT-PCR using cDNA synthesized from seedlings (two-week old) that were harvested 6 h after exposure to 50 μM ABA. The gene/primer pair combinations were RAB18 (At5g66400)/RAB18F/R, COR47 (At1g20440)/ COR47F/R, MYB2 (At2g47190)/MYB2F/R, ERD10 (At1g20450)/ERD10F/R, KIN1 (At5g15960)/KIN1F/R, RD29A (At5g52310)/RD29AF/R, KIN2 (At5g15970)/ KIN2F/R, and APX2 (At3g09640)/APX2F/R. All primer sequences are given in Table .

Fluorescent Imaging of ROS Production

Reactive oxygen species production in guard cells was detected by loading abaxial epidermal strips with H2DCF-DA (Zhang et al., 2011). Epidermal strips were peeled from detached leaves from plants, and floated in 10 mM KCl, 7.5 mM iminodiacetic acid, 10 mM Mes-KOH (pH 6.15) for 2 h to induce stomatal opening. Then, the epidermal strips were transferred to 10 mM Tris HCl, 50 mM KCl (pH 7.2) containing 50 mM H2DCF-DA, and held in the dark for 10 min. Unincorporated H2DCF-DA was removed by rinsing three times in double distilled water. The guard cells were then subjected to laser scanning confocal microscopy, and treated with either 50 μM ABA or solvent control before data collection. The fluorescence of H2DCF was captured by imaging at 2.5 min intervals over 25 min. ZEN software[6] (2012, blue edition) was used to quantify the data. The change in fluorescence intensity at each time point was calculated in the form of a percentage of its initial intensity.

Results

CML20 Encodes a CAM-Like Protein with the Ability to Bind Ca2+

The predicted CML20 product was a CAM-like protein consisting of 169 aa residues. The structure of CML20, according to InterPro[7], contains four EF-hand domains (Figure ), as seen in numerous Ca2+ binding proteins (Figure ) such as CAM2, CAM7 and CML9 (Fabienne et al., 2008; Garrigos et al., 1991; McCormack et al., 2005). The SDS-PAGE mobility shift assay revealed that CML20 migrated faster in the presence of free Ca2+ than in the presence of Ca2+ chelator EGTA (Figure ). Like CML20, we also observed similar result for CAM7 (Garrigos et al., 1991). Our findings suggested that CML20 could bind Ca2+ in vitro and thus potentially acts as a Ca2+ sensor in plant. CML20, a calmodulin-like protein, is able to bind Ca Amino acid sequence alignment between CML20 and its homologs CAM2, CAM7, and CML9. (B) The amino acid sequence of CML20. The Ca2+-binding EF-hand motifs are highlighted in yellow. (C) The SDS-PAGE mobility shift assay showing that CML20 and CaM7 bind to Ca2+. GST was used as a negative control. The left-hand lane contains a protein size marker.

Expression Profiling of CML20

As deduced from the sites of GUS production in transgenic plants harboring pCML20::GUS, expression of CML20 was observed in the root, leaf, inflorescence and silique (Figures ). CML20 expression was also induced in the guard cells of plants that were exposed to ABA (Figures ). qRT-PCR result also supported that CML20 was induced in response to ABA treatment in the leaf and epidermis, which contains a large number of guard cells (Figure ). All of these findings suggested the possible involvement of CML20 in the ABA-mediated regulation of stomatal movement. When mesophyll protoplasts were transformed with p35S::CML20-GFP, GFP signal was detected exclusively in the cytoplasm (Figure ), but mesophyll protoplasts transformed with p35S::GFP empty vector control showed GFP signal dispersed throughout the protoplast (Figure ). These findings indicate that CML20 is a cytosol-localized protein. The site of expression of GUS staining of various tissues in A. thaliana plants harboring pCML20::GUS. (A) The whole seedling. Bar: 2 mm, (B) the root. Bar: 0.5 mm, (C) the silique. Bar: 3 mm, (D) the leaf. Bar: 1.5 mm, (E) the Inflorescence. Bar: 1.5 mm, all without abscisic acid (ABA) treatment, (F) a guard cell in plants not exposed to ABA treatment. Bar: 10 μm, (G) a guard cell in plants 6 h after exposure to 50 μM ABA treatment. Bar: 10 μm. (H) Transcript levels of CML20 in leaves and epidermis exposed to 50 μM ABA treatment for 6 h or solvent control. Error bars show the SE (n = 3). (I,J) Transient expression of GFP and CML20-GFP in mesophyll protoplasts showing their sub-cellular localization (I) p35S::CML20-GFP and (J) p35S::GFP. Bar: 10 μm.

cml20 Mutant Plants Were Hypersensitive to ABA-Regulated Stomatal Movement and Show a Greater Tolerance to Drought Stress

Transcriptional analysis of the cml20 mutant (Figure ) was carried out using both RT- PCR and qRT-PCR which confirmed the absence of CML20 transcript (Figures ). Given that CML20 was clearly up-regulated by ABA in the guard cells, the response of cml20 guard cells was of interest to study its role in ABA signaling. Stomatal aperture was indistinguishable between the mutant and WT when plants were not treated with ABA, but in the presence of ABA (1, 10, or 50 μM), the mutant stomata showed smaller aperture than the WT (Figures ). The results indicated that cml20 stomata were hypersensitive to both ABA-promoted stomatal closure as well as the ABA-inhibited stomatal opening, and thus to minimize the water loss to increase the plant drought tolerance. This hypothesis was supported by the observed results of both the detached leaf assay and the whole plant response to drought stress as well (Figures ). Stomatal movement of the The T-DNA insertion site in the third intron of CML20. (B,C) CML20 is not transcribed in the cml20 mutant, as shown by (B) RT-PCR analysis and (C) qRT-PCR analysis. Error bars represent the SE (n = 3). The ACTIN2 was used as an internal control. (D,E) The stomatal movement assay: (D) ABA induction of stomatal closure, (E) ABA inhibition of stomatal opening. At least 60 stomata were measured for each genotype per replication. ∗means differ significantly (P < 0.05). Error bars represent the SE (n = 3) from three independent experiments. (F) The rate of water loss from detached leaves of WT and the cml20 mutant. Error bars represent the SE (n = 3). (G) The cml20 mutant was more tolerant to drought stress than WT. The experiment was repeated three times with similar results.

CML20 Over-Expression Reduces the Sensitivity of Stomatal Movement to ABA and Has a Negative Effect on Drought Stress Tolerance

qRT-PCR result revealed that CML20 over-expressing lines, OE-1 and -2 both produced more CML20 transcript than WT (Figure ). Stomatal movement in these lines was less affected by ABA than in the WT (Figures ). As predicted, the rate of water loss from detached leaves of the two OE lines was higher than WT leaves (Figure ), and the OE-1 and OE-2 plants were more sensitive to drought stress (Figure ). In addition, cml20/CML20 complementation lines (C-1 and C-2) showed similar phenotype for both ABA regulation of stomatal movement and drought stress resistance compared to WT (Supplementary Figure S1). These findings provided additional support that CML20 functions as a negative regulatory signaling component in response to both ABA and drought stress. The CML20 transcript abundance in WT and the two over-expression lines (qRT-PCR assay). ACTIN2 was used as the internal control. Error bars represent the SE (n = 3). (B,C) Stomatal movement in WT, OE-1 and OE-2 under control (without ABA) and 50 μM ABA conditions. At least 60 stomata were measured for each genotype per replication ∗: means differ significantly (P < 0.05), Error bars represent the SE (n = 3) from three independent experiments. (D) The rate of water loss from detached leaves of WT and the CML20 over-expression lines. Each data point represents the mean Error bars represent the SE (n = 3). (E) The appearance of WT and the CML20 over-expression lines grown under drought stress. The experiment was repeated three times with similar results.

CML20 Is Involved in the ABA Regulation of Guard Cell Ion Channels

Stomatal closure relies on anion efflux via channels that are activated by ABA, which also simultaneously inhibits the influx of K+. The patch clamp assay was conducted to test whether ABA-modulated currents depended on CML20. Without ABA treatment, we did not observe any difference in either the K+ or the anion currents between WT, cml20 and the two OE lines. In contrast, in response to ABA treatment, the mutant’s guard cells showed hypersensitivity to ABA inhibition of K+ currents and ABA activation of anion currents, while the over-expression of CML20 impaired them both (Figures ). These results coincided with the performance of stomatal movement in response to ABA treatment. The conclusion was that CML20 functioned as a negative regulatory signaling component for ABA regulation of stomatal movement, partly via its regulatory effect on ion channels activity in guard cells. CML20 is involved in the ABA regulation of inward K Patch-clamp whole cell recordings of the inward K+ current in guard cell protoplasts isolated from WT, cml20 and the CML20 over-expression lines OE-1 and -2, either in the presence or absence of 50 μM ABA. (B) Current/voltage relationships of whole cell K+ currents. The number of guard cells measured were: WT (8), WT+ABA (9), cml20 (7), cml20+ABA (8), OE-1 (7), OE-1+ABA (11), OE-2 (11), OE-2+ABA (12). Error bars represent the SE. (C) ABA (50 μM) activation of slow anion currents in guard cell protoplasts of WT, cml20, OE-1, and OE-2. (D) Current/voltage relationships of whole cell slow anion currents. The number of guard cells measured were: WT (9), WT+ABA (7), cml20 (9), cml20+ABA (11), OE-1 (6), OE-1+ABA (7), OE-2 (11), OE-2+ABA (10). Error bars represent the SE.

Loss of Function of CML20 Affects the Transcription of Stress-Responsive Genes

Transcriptional (qRT-PCR) profiling showed that in cml20, certain ABA-inducible genes (ERD10, RAB18, COR47, and MYB2) were up-regulated by exposure to ABA for 6 h (Figure ). The imposition of drought stress also induced the transcription of an ABA-independent gene RD29A in the cml20 mutant (Figure ). The aforementioned genes are up-regulated in response to abiotic stresses also their transcript level could be correlated with sensitivity to a specific stress. These findings not only implicate that CML20 negatively regulates transcription of these above indicated genes but also suggest that CML20 is also a regulator of the ABA and drought stress signaling pathways. The transcription of the indicated stress-responsive genes was altered in the RAB18, COR47, MYB2 and ERD10 were up-regulated by exposure to 50 μM ABA for 6 h. RD29A and KIN2 were up-regulated by exposure to drought stress for 6 h. ACTIN2 was used as the internal control. Error bars represent the SE (n = 3).

ROS Production in cml20 Guard Cells Is Enhanced by Exposure to ABA

The ABA treatment resulted in a greater increase of ROS production in the guard cells of cml20 than in those of WT (Figures ). A qRT-PCR based assay of the transcription of a gene known to be involved in ROS elimination showed that APX2 (encoding an H2O2 scavenger) was down-regulated in cml20 whether or not the plants were exposed to ABA (Figure ). These above findings suggest that CML20 may play a positive role in guard cell ROS removal; in its absence, the down-regulation of APX2 could have compromised the plant’s ability to control the accumulation of ROS. Reactive oxygen species (ROS) production is elevated in the guard cells of H2DCF fluorescence in WT, cml20 and OE-2 imaged at 5 min intervals over 25 min. At least ten guard cells were measured. (B) H2DCF-DA staining revealed a higher level of ROS production in cml20 than in WT, and a lower level in OE-2. Error bars represent the SE. (C) The transcription of APX2 was down-regulated in cml20. Error bars represent the SE (n = 3).

Discussion

As shown by the SDS-PAGE mobility shift assay (Figure ), CML20 demonstrated an ability to bind Ca2+ in vitro. Many Ca2+ sensors have been implicated as signaling components in the abiotic stress response. An example is the rice gene OsCaM1-1, which is induced by exposure to high temperature; its product enhances thermo tolerance when the gene is constitutively expressed in A. thaliana (Wu et al., 2012). Transcription factors such as AtCAMTA1, -A2 and -A3 are known to participate in response to low temperature stress (Kim et al., 2013). The product of AtCAMTA1 is also involved in the drought stress response (Pandey et al., 2013). Despite being one of the largest Ca2+ sensor families, few CMLs have been identified yet that participate in the abiotic stress response: these comprise the A. thaliana proteins CML9, 10, 18, 24, and 42, as well as the rice protein OsMSR and ShCML44 from Solanum habrochaites (Delk et al., 2005; Yamaguchi et al., 2005; Fabienne et al., 2008; Xu et al., 2011; Vadassery et al., 2012; Cho et al., 2015; Munir et al., 2016). Here, the current work demonstrated that AtCML20 is negatively involved in guard cell ABA signaling during plant drought response. A consistent implication emerged from the present set of experiments was that CML20 acted as a negative regulator of ABA and drought stress responses in plants. Stomatal movement was more sensitive to the ABA treatment in the cml20 mutant than in the WT (Figure ). In addition, OE lines with higher expression of CML20 showed less sensitivity to ABA-mediated stomatal movement, which might have caused OE plants to be lower ability of drought tolerant. In plants, stomatal closure represents an early response to drought stress, and aids for the maintenance of the plant’s internal osmotic environment (Verslues et al., 2006). Thus, the action of CML20 to inhibit stomatal movement has a negative effect on the plant’s tolerance to drought stress. Nevertheless, WT plants treated with ABA showed 100% increase of CML20 transcript (Figure ). A possibility is that the function of CML20 during an episode of drought stress is to enforce stomata to remain in a partial open state, a physiological condition that would allow the plant to exchange gas. Interestingly, we further found that CML20 had roles in ABA regulating ion channels. The results from patch clamp assay indicated that both K+in channels and anion channels were influenced in loss-of-function mutant and OE lines in response to ABA (Figure ). Some CDPKs, as Ca2+ sensors like CMLs, have been reported to regulate guard cell SLAC1 channel’s activity (Geiger et al., 2010). We also explored the molecular mechanism to define the function of CML20 in ABA signaling. ABA is a critical regulator of the abiotic stress response, which acts via complex signaling networks. From the qRT-PCR analysis, it was obvious that the loss-of-function of CML20 affected the transcription of a number of ABA-inducible genes in mutant plants treated with ABA (Figure ), which in turn may have been responsible for the mutant’s enhanced level of drought stress tolerance. By acting as a negative regulator, CML20 likely limits the extent of the responsiveness of these genes to ABA; it also negatively regulates the transcription of RD29A, a gene which responds to drought stress, in an ABA- independent manner (Yamaguchi-shinozaki and Shinozaki, 2006). Fluorescent probes demonstrated that the cml20 mutant generated more ROS than WT under ABA treatment (Figures ), consistent with the negative role of CML20 in stomatal movements and drought response. ROS is generated by NADPH oxidases (Respiratory Burst Oxidase Homologs, RBOHs), and the enzyme AtRBOHD and AtRBOHF are mainly expressed in guard cells and could be up-regulated by ABA. In the ABA signal pathway, OST1 is released by ABA from PP2C to activate AtRBOHF through directly phosphorylation (Kwak et al., 2003; Sirichandra et al., 2009; Shang et al., 2016). In another way, the elimination of ROS is achieved by a range of antioxidants and enzymes. The gene APX2, which encodes a cytosolic ascorbate peroxidase (a ROS scavenger), had a lower expression level in cml20 than WT whether or not the plants were exposed to ABA (Figure ). A reduced presence of the ROS scavenging enzyme APX2 in ABA-treated cml20 mutant plants was predicted from the lowered abundance of APX transcript in cml20 compared to that in WT, may have allowed for a greater accumulation of ROS, which in turn could have enhanced the transduction of the ABA signal. Meanwhile the prominent ROS species H2O2, which is induced by ABA in the guard cells, can activate Ca2+ channels and regulate stomatal movement (Pei et al., 2000; Mustilli et al., 2002), inversely, Ca2+ could also bind and activate RBOH for ROS generation (Ogasawara et al., 2008; Kimura et al., 2012). Both Ca2+ and ROS are important signal integrators in plants (Murata et al., 2015). Given its proven Ca2+ binding ability, CML20 may play roles both in Ca2+ and ROS signal pathways to regulate stomatal aperture in plants either exposed to exogenous ABA or subjected to drought stress. The CML20 may serve as a fine regulator for cytosol ROS homeostasis in guard cell ABA signaling. Previous studies have demonstrated that the guard cell anion channels (SLAC1) and K+in channels are regulated by ROS (Köhler et al., 2003; Joo et al., 2005; Sierla et al., 2016), and the APX2 serves as a ROS scavenger to reduce ROS concentration in cytosol (Fryer et al., 2003). Here we show that, the cml20 mutants were with lower APX2 transcripts and higher ROS (Figure ), so the CML20 may serve as opposite factor with ABA to avoid too much ROS accumulation, and to keep appropriate stomatal aperture under finely balanced control. In addition, CML20 could also be the negative regulator of ABA and drought via other plant abiotic stress responsive gene mediated pathways (Figure ). Besides ROS, Ca2+ and ion channels, there may be other factors along with CML20 are involved in the signaling cascades that play critical roles in response to drought stress and ABA treatment. Follow-up research will attempt to identify the targets of CML20, so as to further elucidate the signaling pathways used by plants that are exposed to abiotic stress. A proposed model for the signaling role of CML20 in the guard cell in response to ABA.

Author Contributions

WZ designed the experiments; XW, CL, and ZQ performed the experiments with assistance from HL; WZ, XW, CL, ZQ, and BA analyzed and discussed the results; WZ, XW, CL, and ZQ wrote the manuscript.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer GM and handling Editor declared their shared affiliation, and the handling Editor states that the process nevertheless met the standards of a fair and objective review.
Table 1

Primer sequences employed.

NameForward (5′–3′)
cml20-LPTAGATGATGATGTGCGCAGAG
cml20-RPAGGGTTCCATGATTGAAGAAG
LBb1.3ATTTTGCCGATTTCGGAAC
CML20-HisFGCCATATGATGTCGAGTATATACAGAAC
CML20-HisRCCGCTCGAGTCACTTTGCCATCATGACTTTGAC
CaM7-HisFGGAATTCCATATGATGGCGGATCAGCTAACCGAT
CaM7-HisRCCGCTCGAGTCACTTTGCCATCATGACTTTGAC
CML20-OEFGCTCTAGAATGTCGAGTATATACAGAAC
CML20-OERGTGAGCTCCTAGTTACCACCATAAGC
CML20-PFGTAAGCTTTCCGGAACAGGGTATGTA
CML20-PRGAGGATCCATCTTCTACGAGTCCTCC
CML20-GFPFGCGGATCCATGTCGAGTATATACAGAAC
CML20-GFPRGAGTCGACGTTACCACCATAAGCAG
CML20-RTFATGTCGAGTATATACAGAA
CML20-RTRCGTTACCACCATAAGCAG
ACTIN2-RTFTCTTCTTCCGCTCTTTCTTTCC
ACTIN2-RTRTCTTACAATTTCCCGCTCTGC
ACTIN2-QFGGTAACATTGTGCTCAGTGGTGG
ACTIN2-QRAACGACCTTAATCTTCATGCTGC
CML20-QFCGCATGGCAAAGGACTTGGGT
CML20-QRCCATCACGGTCTCGGTCTGCT
RAB18FCGAATGGCATCCTTTCTCAATC
RAB18RGTCACCGAGAGTGCGGATATG
COR47FCTTGGCATTGGTGCAACTCC
COR47RTCTTTCGTCTTGGCGTGTCA
MYB2FTGCTCGTTGGAACCACATCG
MYB2RACCACCTATTGCCCCAAAGAGA
ERD10FTCTCTGAACCAGAGTCGTTT
ERD10RCTTCTTCTCACCGTCTTCAC
KIN1FACCAACAAGAATGCCTTCCA
KIN1RCCGCATCCGATACACTCTTT
RD29FTAATCGGAAGACACGACAGG
RD29RGATGTTTAGGAAAGTAAAGGCTAG
KIN2FACCAACAAGAATGCCTTCCA
KIN2RACTGCCGCATCCGATATACT
APX2FTGATGTGAAGACGAAGACAGGAGGAC
APX2RCCCATCCGACCAAACACATCTCTTA
CML20-CFGGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTCGAGTATATACAG
CML20-CRGGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGTTACCACCATAAGC
  59 in total

1.  Calmodulin as a potential negative regulator of Arabidopsis COR gene expression.

Authors:  Helen E Townley; Marc R Knight
Journal:  Plant Physiol       Date:  2002-04       Impact factor: 8.340

Review 2.  Handling calcium signaling: Arabidopsis CaMs and CMLs.

Authors:  Elizabeth McCormack; Yu-Chang Tsai; Janet Braam
Journal:  Trends Plant Sci       Date:  2005-08       Impact factor: 18.313

Review 3.  Roles of ion channels and transporters in guard cell signal transduction.

Authors:  Sona Pandey; Wei Zhang; Sarah M Assmann
Journal:  FEBS Lett       Date:  2007-04-17       Impact factor: 4.124

4.  Calmodulin-dependent activation of MAP kinase for ROS homeostasis in Arabidopsis.

Authors:  Fuminori Takahashi; Tsuyoshi Mizoguchi; Riichiro Yoshida; Kazuya Ichimura; Kazuo Shinozaki
Journal:  Mol Cell       Date:  2011-03-18       Impact factor: 17.970

5.  Race-specific elicitors of Cladosporium fulvum promote translocation of cytosolic components of NADPH oxidase to the plasma membrane of tomato cells.

Authors:  T Xing; V J Higgins; E Blumwald
Journal:  Plant Cell       Date:  1997-02       Impact factor: 11.277

6.  Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.

Authors:  S J Clough; A F Bent
Journal:  Plant J       Date:  1998-12       Impact factor: 6.417

7.  Cloning and characterization of two NAD kinases from Arabidopsis. identification of a calmodulin binding isoform.

Authors:  William L Turner; Jeffrey C Waller; Barb Vanderbeld; Wayne A Snedden
Journal:  Plant Physiol       Date:  2004-07-09       Impact factor: 8.340

8.  Phosphorylation of the Arabidopsis AtrbohF NADPH oxidase by OST1 protein kinase.

Authors:  Caroline Sirichandra; Dan Gu; Heng-Cheng Hu; Marlène Davanture; Sangmee Lee; Michaël Djaoui; Benoît Valot; Michel Zivy; Jeffrey Leung; Sylvain Merlot; June M Kwak
Journal:  FEBS Lett       Date:  2009-08-29       Impact factor: 4.124

Review 9.  Reactive Oxygen Species in the Regulation of Stomatal Movements.

Authors:  Maija Sierla; Cezary Waszczak; Triin Vahisalu; Jaakko Kangasjärvi
Journal:  Plant Physiol       Date:  2016-04-21       Impact factor: 8.340

10.  CML42-mediated calcium signaling coordinates responses to Spodoptera herbivory and abiotic stresses in Arabidopsis.

Authors:  Jyothilakshmi Vadassery; Michael Reichelt; Bettina Hause; Jonathan Gershenzon; Wilhelm Boland; Axel Mithöfer
Journal:  Plant Physiol       Date:  2012-05-08       Impact factor: 8.340

View more
  24 in total

1.  SOS5 gene-abscisic acid crosstalk and their interaction with antioxidant system in Arabidopsis thaliana under salt stress.

Authors:  Tuba Acet; Asım Kadıoğlu
Journal:  Physiol Mol Biol Plants       Date:  2020-08-29

2.  A calmodulin-like protein (CML10) interacts with cytosolic enzymes GSTU8 and FBA6 to regulate cold tolerance.

Authors:  Shuhan Yu; Jiaxuan Wu; Yanmei Sun; Haifeng Zhu; Qiguo Sun; Pengcheng Zhao; Risheng Huang; Zhenfei Guo
Journal:  Plant Physiol       Date:  2022-09-28       Impact factor: 8.005

3.  Genome-Wide Identification and Expression Analysis of CsCaM/CML Gene Family in Response to Low-Temperature and Salt Stresses in Chrysanthemum seticuspe.

Authors:  Manman Fu; Chao Wu; Xia Li; Xiaoyu Ding; Fangqi Guo
Journal:  Plants (Basel)       Date:  2022-07-01

4.  Abscisic Acid-Induced Reactive Oxygen Species Are Modulated by Flavonols to Control Stomata Aperture.

Authors:  Justin M Watkins; Jordan M Chapman; Gloria K Muday
Journal:  Plant Physiol       Date:  2017-10-19       Impact factor: 8.340

5.  Comparative Morphology, Transcription, and Proteomics Study Revealing the Key Molecular Mechanism of Camphor on the Potato Tuber Sprouting Effect.

Authors:  Li-Qin Li; Xue Zou; Meng-Sheng Deng; Jie Peng; Xue-Li Huang; Xue Lu; Chen-Cheng Fang; Xi-Yao Wang
Journal:  Int J Mol Sci       Date:  2017-10-30       Impact factor: 5.923

6.  The transcription factor WRKY22 is required during cryo-stress acclimation in Arabidopsis shoot tips.

Authors:  Johanna Stock; Andrea Bräutigam; Michael Melzer; Gerd Patrick Bienert; Boyke Bunk; Manuela Nagel; Jörg Overmann; E R Joachim Keller; Hans-Peter Mock
Journal:  J Exp Bot       Date:  2020-08-06       Impact factor: 6.992

Review 7.  Plant Calcium Signaling in Response to Potassium Deficiency.

Authors:  Xiaoping Wang; Ling Hao; Biping Zhu; Zhonghao Jiang
Journal:  Int J Mol Sci       Date:  2018-11-03       Impact factor: 5.923

8.  The Mildew Resistance Locus O 4 Interacts with CaM/CML and Is Involved in Root Gravity Response.

Authors:  Lei Zhu; Xue-Qin Zhang; Li-Qun Chen
Journal:  Int J Mol Sci       Date:  2021-05-31       Impact factor: 5.923

9.  Transcriptome Analysis of Calcium- and Hormone-Related Gene Expressions during Different Stages of Peanut Pod Development.

Authors:  Yan Li; Jingjing Meng; Sha Yang; Feng Guo; Jialei Zhang; Yun Geng; Li Cui; Shubo Wan; Xinguo Li
Journal:  Front Plant Sci       Date:  2017-07-14       Impact factor: 5.753

Review 10.  Towards Understanding Plant Calcium Signaling through Calmodulin-Like Proteins: A Biochemical and Structural Perspective.

Authors:  Valentina La Verde; Paola Dominici; Alessandra Astegno
Journal:  Int J Mol Sci       Date:  2018-04-30       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.