Microarray profiling of long non-coding RNAs associated with idiopathic pulmonary arterial hypertension.

Idiopathic pulmonary arterial hypertension (IPAH) is a fatal disease with a poor prognosis and the molecular pathways underlying the pathogenesis of IPAH are not fully understood. In the present study, the long non-coding RNA (lncRNA) and mRNA expression profiles of lymphocytes obtained from 12 IPAH patients and 12 healthy controls were analyzed using Arraystar Human lncRNA Microarray v2.0, and their roles in the pathogenesis of IPAH were characterized using comprehensive bioinformatic tools. A total of 2,511 lncRNAs (2,004 upregulated and 507 downregulated) and 1,169 mRNAs (609 upregulated and 560 downregulated) were aberrantly expressed in IPAH patients with a fold-change of >2.0. Gene ontology analysis indicated that the coexpressed lncRNAs and mRNAs were involved in the process of translation, while pathway analysis indicated that the coexpressed RNAs were enriched during the process of oxidative phosphorylation and in the ribosome. It was concluded that dysregulated lncRNAs are potentially associated with IPAH, and aberrant lncRNA expression in blood cells may serve as a diagnostic marker of IPAH.

Introduction

Pulmonary arterial hypertension (PAH) is a fatal disease that is difficult to diagnose. The pathogenesis of PAH involves the obstruction and constriction of pulmonary arteries, and increased pulmonary vascular resistance, ultimately leading to right ventricular hypertrophy and failure (1). Chronic obstructive pulmonary disease and prolonged exposure to hypoxic conditions are two major causes of PAH (2). It has been established that the hallmarks of PAH include pulmonary vascular endothelial dysfunction leading to vascular remodeling, pulmonary artery smooth muscle cell (PASMC) proliferation and migration, medial hypertrophy, inflammation and thrombosis in situ leading to the formation of plexiform lesions (3,4).

Idiopathic PAH (IPAH) patients are essentially patients with PAH; however they do not harbor the known risk factors, including drug exposure, genetic variants, related pathologies, of PAH. Patients with IPAH are characterized according to the following measures: Mean pulmonary artery pressure (mPAP) of ≥25 mmHg; pulmonary capillary wedge pressure (PCWP), left atrial pressure or left ventricular end-diastolic pressure of ≤15 mmHg; and pulmonary vascular resistance (PVR) ≥3 Wood Units (5).

To date, numerous studies have investigated the pathogenic mechanisms of IPAH, with implications that cytokines, including phosphodiesterase 2 (6), nitric oxide (7) and transforming growth factor-β (TGF-β) (8), are involved in development of the disease. However, the molecular pathways underlying the pathogenesis of IPAH remain largely unknown.

Long non-coding RNAs (lncRNAs) are loosely defined as endogenous cellular RNAs of >200 base pairs (bp) that lack protein-coding capacity (9). The Encyclopedia of DNA Elements project reported that there are 49,500 independent lncRNA genes in the human genome, which collectively produce 415,500 transcripts (10). Previous studies have demonstrated that lncRNAs are involved in a variety of biological processes, including cell-cycle control, chromatin remodeling, differentiation and epigenetic regulation (11,12). The dysregulation of lncRNAs is also implicated in the pathogenesis of various diseases, including colorectal cancer (13) and schizophrenia (14). However, the dysregulation of lncRNAs in IPAH has not been investigated.

Therefore, the present study aimed to determine the possible roles of lncRNAs in the pathogenesis of IPAH, via a microarray analysis of potentially dysregulated lncRNAs and mRNAs in the peripheral blood of IPAH patients.

Materials and methods

Patients

From July to December 2013, 12 consecutive, well-characterized IPAH patients (5 males and 7 females, aged 52.0±10.2 years) were admitted to Qilu Hospital, a tertiary teaching hospital affiliated with Shadong University (Shadong, China). Pulmonary hypertension was defined as a mPAP of ≥25 mmHg, a PCWP of ≤15 mmHg at rest, as assessed by right heart catheterization (RHC), and a PVR of >3 Wood Units, also measured by RHC. IPAH patients were diagnosed according to the 2009 diagnostic algorithm developed by the European Society of Cardiology and the European Respiratory Society (5). Therefore, no patients had a family history of PAH. PAH patients with other known causes were excluded from the current study on the basis of clinical characteristics, echocardiography, high-resolution computed tomography, RHC, computed tomographic pulmonary angiography, ventilation/perfusion lung scan, and/or pulmonary angiography. Patients with ≥1 of the following conditions were excluded: i) Other types of pulmonary hypertension, including familial pulmonary hypertension; ii) heart diseases, including known left ventricular diseases and acute heart failure; iii) chronic respiratory disorders, including chronic obstructive pulmonary disease; iv) diabetes mellitus; and v) prior targeted therapy. No patients had received medical treatment (bosentan, treprostinil, nifedipine or iloprost) prior to sample collection.

A total of 12 healthy controls (5 males and 7 females, aged 49.2±11.8 years) were recruited from local communities in Shandong, China in the current study. The inclusion criteria for healthy controls were that subjects must be age- and sex-matched with patients and absent of any diseases when enrolled. The patients' clinical features are summarized in Tables I and II. The experimental protocols in the present study were approved by the Ethics Committee of Qilu hospital (protocol no. 2014-B-046). The recruited subjects provided written informed consent prior to participation in the study.

Table I.

Clinical characteristics of IPAH patients.

ID	Gender	Age (years)	Onset of symptoms (mo)	WHO functional class	6MWT (min)	mPAP (mmHg)	CI (l/min/m2)	PVR (WU)	VR
IPAH 1	F	45	29	III	255	48	1.8	12.5	No
IPAH 2	M	52	36	II	554	38	2.8	13.6	No
IPAH 3	F	34	18	III	382	35	2.2	11.0	Yes
IPAH 4	F	58	22	III	460	48	1.7	12.4	Yes
IPAH 5	F	38	41	II	350	40	3.0	8.5	No
IPAH 6	M	63	33	IV	273	53	2.1	7.5	No
IPAH 7	M	64	29	I	334	50	1.8	8.6	No
IPAH 8	M	60	32	III	320	31	1.7	11.8	No
IPAH 9	F	48	16	II	534	49	2.5	13.1	No
IPAH 10	F	55	26	III	281	59	1.9	6.1	No
IPAH 11	M	44	27	III	449	49	2.2	9.3	No
IPAH 12	F	63	39	IV	391	51	2.7	10.8	No

n=12. WHO, World Health Organization; 6MWT, 6-minute walk test; mPAP, mean pulmonary arterial pressure; CI, cardiac index; PVR, pulmonary vascular resistance; WU, Wood units; VR, vascular reactivity; IPAH, idiopathic pulmonary arterial hypertension; mo, months; M, male; F, female.

Table II.

Demographics of IPAH patients and matched healthy controls.

Item	IPAH patients	Controls
Number (n)	12	12
Age (years, mean ± SD)	52.0±10.2	49.2±11.8
Males (n, %)	5 (41.7%)	5 (41.7%)
Onset of symptoms (mo, mean ± SD)	29.0±7.8	n/a
WHO functional class (I/II/III/IV)	1/3/6/2	n/a
6MWT (min, mean ± SD)	381.9±99.4	n/a
mPAP (mmHg, mean ± SD)	45.9±8.15	n/a
CI (l/min/m2, mean ± SD)	2.2±0.45	n/a
PVR (WU, mean ± SD)	10.4±2.40	n/a

SD, standard deviation; 6MWT, 6-minute walk test; PAP, pulmonary arterial pressure; CI, cardiac index; PVR, pulmonary vascular resistance; WU, Wood units; IPAH, idiopathic pulmonary arterial hypertension; WHO, world health organization.

RNA extraction

A total of 5 ml peripheral blood from each subject was collected in PAXgene RNA stabilization tubes (PreAnalytiX GmbH, Hombrechtikon, Switzerland). Following the removal of red blood cells according to the manufacturer's protocol (Qiagen, Inc., Valencia, CA, USA), which involved the addition of sufficient buffer BG1 and BG2 in order, vortexing for 5 sec, centrifugation for 3 min and subsequent discarding of the supernatant, total RNA was extracted from peripheral blood leukocytes using PAXgene RNA collection tubes (Qiagen, Inc.) according to the manufacturer's guidelines. The kit included all reagents and protocols for extraction and purification. The whole leukocyte fraction consisted of T and B lymphocytes, natural killer cells, monocytes, neutrophils, basophils and eosinophils. The quality and concentration of the RNA samples were assessed at absorbance ratios of A260/A280 and A260/230 using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Inc., Wilmington, DE, USA) and denaturing agarose gel electrophoresis (2% gel; 3 µl RNA samples and 1.5 µl loading buffer (3X) per lane).

RNA labeling and array hybridization

The expression levels of lncRNAs and mRNAs in each sample were determined using Arraystar Human lncRNA Microarray v2.0 (CapitalBio Corporation, Beijing, China). Sample labeling and array hybridization were performed according to the Agilent One-Color Microarray-Based Gene Expression Analysis protocol (Agilent Technologies, Inc., Santa Clara, USA). mRNA was purified from total RNA following removal of rRNA using an mRNA-ONLY™ Eukaryotic mRNA Isolation kit (Epicentre Biotechnologies, Madison, WI, USA). Each sample was then transcribed into fluorescent cRNA along the entire length of the transcripts without 3′ bias using the QuantScript RT kit (TIANGEN, China) on a Bio-Rad CF-96X platform (Bio-Rad Laboratories, Inc., Hercules, CA, USA) using the following procedure: 42°C for 2 h, 16°C for 1 h and 40°C for >2 h. Following purification with an RNeasy Mini kit (Qiagen GmbH, Hilden, Germany), the labeled cRNAs were hybridized with the specific probes on the Human lncRNA Array v2.0. According to the manufacturer's instructions, the hybridized arrays were washed with washing buffer, fixed and scanned at 5 mm/pixel resolution with an Agilent DNA Microarray Scanner G2505C (Agilent Technologies, Inc.) equipped with GenePix Pro 6.0 software (Molecular Devices, LLC- Sunnyvale, CA, USA).

Microarray data analysis

Scanned images (TIFF format) were imported into Agilent Feature Extraction software (version 11.0.1.1; Agilent Technologies, Inc.) for grid alignment and expression data analysis. Expression data were normalized by a quantile normalization and a Robust Multichip Average algorithm included in the Agilent software. Probe-level files, including lncRNAs and mRNAs, were generated following normalization. Final results were generated after combining the probe-level files and gene-level files using Agilent GeneSpring GX software (version 11.5.1; Agilent Technologies, Inc.). Following fold-change (FC) analysis (FC>2.0 or FC<0.5) and false discovery rate (FDR) analysis (FDR<0.05), differentially expressed lncRNAs and mRNAs were identified through FC filtering according to the predetermined P-value threshold (P<0.05).

Functional group analysis

The Database for Annotation, Visualization and Integrated Discovery (http://david.abcc.ncifcrf.gov/), which utilizes Gene Ontology (GO) to identify the molecular functions of gene profiles (15,16), was applied in the present study to determine the functions of the differentially expressed coding genes identified by microarray analysis. Pathway analysis was used to place differentially expressed coding genes according to the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway from the Biocarta and Reactome database (http://www.genome.jp/kegg/). The FDR-corrected P-value threshold was set at 0.05.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted as stated previously and reverse transcribed using a PrimeScript RT reagent kit with gDNA Eraser (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's protocol. RT-qPCR was performed using a SYBR-Green PCR kit (Takara Biotechnology Co., Ltd.) on a CFX96 Real-Time PCR Detection System. The PCR conditions included an initial step at 95°C for 5 min, followed by 40 cycles of amplification and quantification (95°C for 15 s, 60°C for 30 s). Each cDNA sample was obtained in triplicate in a final volume of 25 µl containing 1 µl cDNA and 400 nM of forward and reverse gene-specific primers. The primer sequences are provided in Table III.

Table III.

Reverse transcription-quantitative polymerase chain reaction primers for randomly selected lncRNAs and mRNAs.

Transcript ID	Forward primer (5′-3′)	Reverse primer (5′-3′)
TCONS_00023744	TGAGGAAGGTGCTGTCAAGA	GACACAATCCCACTCAACAAGA
TCONS_00004224	GTTCTTGTTGAGTGGGATTGTG	AAGTCTTCTTTATTATGGTCAGGG
ENST00000552663.1	GCTTCCTCCTGGCTGCT	CTTTTTGTGTTTATTTTCCCTTG
ENST00000417305.1	TTCTCTTGTCCCTGTTTTTGG	TGTTTTCTCCCTTTAGCCTCA
TCONS_00018111	ACTCTGATTGCGGATGCTC	TAGGATACCCCTGAAATAGAGC
ENST00000532124.1	ATGGAGGGAGCGTGTGAG	TTGGGAGGCTGAGGCA
ENST00000419223.1	CACAGAAGTGGAAGAAGCAAA	TGGAAGGCAGACCTCGGC
ENST00000507856.1	AACGGAGATGTAACGGTAGAAG	AGAGAGGGTGGGAGGGCAG
TCONS_00012819	TTCCAACCCGCAGCAG	CAACTGTAACGCTTGGCATC
ENST00000506645.1	GGAGAAAAGTGGCAGACAGAA	TGCTACATTCCTTCCATTTGAC
LOC100287651	GAAAGAATCCCAGGTGGTATC	CTATCCAGGAATCAACAGGTAAA
TSL	AAAGTTACCTGGTTGAAAATGG	TCTTTCTGGAGAGGGTGGC
TRIM9	CGCCGATGGATACATTCTG	CGGGCTGACTCCTGTTTTG
RRH	ACGCAGGCTGTCAGGTTT	CCGATGTAAGTGTTGGTGGTC
BAG1	CGTTGTCAGCACTTGGAATAC	AATCCTTGGGCAGAAAACC
PDGFD	GTATGATTTTGTGGAAGTTGAAGA	CTGCTGCGGGTTGGAA
LY96	ATCTGATGACGATTACTCTTTTTG	CAACACATTTGTATTTTCCCTTAG
HOPX	ACGCTGTGCCTCATCGC	CGCCGCCACTTTGCCA
ATP5I	GCAGGTCTCTCCGCTCAT	TCTCTGGCAATCCGTTTCA
RAP2A	AGCCTCGTCAACCAGCAG	CTCTCACTTTCCAGGTCCACT

lncRNA, long non-coding RNA.

Relative gene expression level was quantified using the ΔΔCq method (17), in which GAPDH was used as an internal control. For quantitative results, expression of each gene was represented as a FC using the following mathematical model: FC = (Etarget)ΔCqtarget (Control-Sample)/(Eref)ΔCqref (Control-Sample). In this model, Etarget and Eref were the PCR efficiency of target gene transcription and reference gene transcription, respectively, ΔCqtarget was the Cq deviation of control-sample of the target gene transcript and ΔCqref was the Cq deviation of control-sample of the reference gene transcript.

Statistical analysis

The statistical significance of microarray data was analyzed in terms of FC using the Student's t-test and FDR was calculated to correct the P-value. The Mann Whitney test was also applied to compare the patient and control groups using GraphPad Prism 5.0 software (GraphPad software, Inc., La Jolla, CA, USA) and Microsoft Office Excel 2010 software (Microsoft Corporation, Redmond, WA, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

lncRNA profile changes in IPAH patients

A total of 7,249 lncRNAs were detected by Arraystar Human LncRNA Microarray v2.0 (data not shown). Hierarchical clustering was applied in order to group lncRNAs based on their expression levels among samples. As depicted in Fig. 1A, differentially expressed lncRNAs were observed between the IPAH patient and control groups.

Figure 1.

lncRNA microarray analysis of IPAH patients. (A) The unsupervised hierarchical clustering of partially differentially expressed lncRNAs in 12 IPAH patients relative to 5 matched control patients. High relative expression levels (red) and low relative expression levels (green) were observed. (B) Class distribution of dysregulated lncRNAs. (C) length distribution of lncRNAs on chromosomal DNA. (D) Chromosomal distribution of dysregulated lncRNAs.

When a threshold of FC>2.0, P<0.05 and FDR<0.05 was set, it was found that 2,511 lncRNAs were differentially expressed, including 2,004 upregulated and 507 downregulated lncRNAs. When the P-value was set at P<0.01, a total of 1,722 lncRNAs were dysregulated, including 1409 upregulated and 313 downregulated lncRNAs. Table IV provides details of the 10 most upregulated (ENST00000424119.1, ENST00000530600.1, ENST00000587759.1, ENST00000602495.1, ENST00000414407.1, ENST00000452477.1, TCONS_00003801, TCONS_00005167, TCONS_00017343 and ENST00000602863.1) and 10 most downregulated (uc001nxj.1, ENST00000376482.3, TCONS_0,0008036, ENST00000445107.1, NR_024412.1, ENST00000421013.1, ENST00000569048.1, XR_159116.1, TCONS_00017669 and TCONS_00017647) lncRNAs in the patient group compared with the control group.

Table IV.

The 10 most upregulated and 10 most downregulated lncRNAs in IPAH patients relative to matched controls.

lncRNA ID	FC (abs)	Regulation	FDR	Chromosome	Strand	Start[a]	End[a]	Class	Database
ENST00000424119.1	13.41	Up	1.50E-12	2	–	64565200	64568781	Intergenic	ENSEMBL
ENST00000530600.1	15.33	Up	9.15E-08	8	–	144624142	144631899	Divergent	ENSEMBL
ENST00000587759.1	15.56	Up	1.84E-11	19	+	6067963	6077130	Intronic	ENSEMBL
ENST00000602495.1	15.83	Up	4.58E-06	X	–	73048972	73053596	Intergenic	ENSEMBL
ENST00000414407.1	18.52	Up	1.28E-03	13	+	31377342	31384782	Intergenic	ENSEMBL
ENST00000452477.1	21.75	Up	3.27E-11	9	–	46359241	46380257	Intergenic	ENSEMBL
TCONS_00003801	26.25	Up	2.02E-06	2	+	102661124	102674449	Intergenic	Human LincRNA Catalog
TCONS_00005167	35.20	Up	1.22E-08	2	–	64530720	64565467	Intergenic	Human LincRNA Catalog
TCONS_00017343	80.27	Up	4.20E-06	3	–	73040858	73061243	Intergenic	Human LincRNA Catalog
ENST00000602863.1	313.67	Up	2.27E-06	10	–	73048922	73061505	Intergenic	ENSEMBL
uc001nxj.1	12.23	Down	1.07E-03	11	–	63391555	63395325	Intergenic	UCSC
ENST00000376482.3	13.17	Down	1.77E-10	7	+	99728586	99738062	Intergenic	ENSEMBL
TCONS_00008036	14.36	Down	0.00159	4	+	33517098	33522181	Intergenic	Human LincRNA Catalog
ENST00000445107.1	14.40	Down	7.32E-09	X	–	2770780	2771801	Intronic	ENSEMBL
NR_024412.1	14.59	Down	0.0191	7	–	112756772	112758637	Intergenic	RefSeq
ENST00000421013.1	16.37	Down	4.56E-16	1	+	101491408	101552819	Divergent	ENSEMBL
ENST00000569048.1	16.63	Down	4.01E-05	16	–	18027045	18066399	Intergenic	ENSEMBL
XR_159116.1	20.31	Down	5.33E-05	1	+	224219240	224221571	Intergenic	RefSeq
TCONS_00017669	33.01	Down	5.66E-03	10	+	6622386	6627323	Divergent	Human LincRNA Catalog
TCONS_00017647	49.40	Down	9.31E-13	Y	–	14774285	14775639	Intergenic	Human LincRNA Catalog

Chromosomal positions based on the human reference genome GRCh38. FC, fold-change; FDR, false discover rate; +, sense strand; -, antisense strand; up, upregulated; down, downregulated.

In addition, the classification and length distribution of dysregulated lncRNAs was summarized. Among the dysregulated lncRNAs, there were 1,362 intergenic, 572 antisense, 357 intronic and 220 divergent lncRNAs (Fig. 1B). These differentially expressed lncRNAs ranged from 61 bp to 598 kilobases (kb) of DNA, with 1,370 lncRNAs (54.6%) being between 200–5000 bp in length (Fig. 1C). The lncRNAs were distributed across the chromosomes (Fig. 1D).

mRNA profile changes in IPAH patients

In the present study, a total of 8,110 mRNAs were detected, of which 1,169 mRNAs presented significantly different expression between the IPAH patient and control groups (FC>2.0, P-value <0.05 and FDR<0.05) (data not shown). Among these, 609 mRNAs were downregulated and 560 mRNAs were upregulated in IPAH patients. Similarly, when the P-value was set at P<0.01, a total of 453 mRNAs were upregulated and 509 mRNAs were downregulated. Their distinct expression patterns were determined by hierarchical clustering analysis (Fig. 2).

Figure 2.

Unsupervised hierarchical clustering of partially differentially expressed mRNAs in IPAH relative to matched controls. High relative expression levels (red), and low relative expression levels (green) were observed.

RT-qPCR validation of differentially expressed lncRNAs and mRNAs

To verify the expression of the dysregulated lncRNAs in each sample, RT-qPCR was performed on 10 randomly selected lncRNAs, including 5 upregulated (TCONS_00023744, TCONS_00004224, ENST00000552663.1, ENST00000417305.1 and TCONS_00018111) and 5 downregulated (ENST00000532124.1, ENST00000419223.1, ENST00000507856.1, TCONS_00012819 and ENST00000506645.1) lncRNAs. The results from RT-qPCR and microarray analysis exhibited general consistency in terms of regulation direction (upregulation and downregulation) and significance (P<0.05), with the exception of the lncRNA TCONS_00004224, which did not show a significant change in expression (Fig. 3A).

Figure 3.

RT-qPCR validation of dysregulated lncRNAs and mRNA identified by microarray analysis. (A) A total of 10 lncRNAs were randomly selected for RT-qPCR validation. (B) A total of 10 mRNAs were chosen randomly for RT-qPCR validation. Fold changes were calculated by the ΔΔCq method. Data shown are representative of 12 IPAH patients and 12 matched controls. Error bars indicate the mean ± standard error of the mean. *P<0.05 vs. microarray. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; lncRNA, long non-coding RNA.

RT-qPCR was also performed to verify the expression of 10 dysregulated mRNAs randomly selected from the expression profiles, consisting of 5 upregulated (LOC100287651, TSL, TRIM9, RRH and BAG1) and 5 downregulated (PDGFD, LY96, HOPX, ATP5I and RAP2A) mRNAs. Our RT-qPCR results validated that the 10 mRNAs were also significantly changed between the case and control groups, the regulation direction and significance of which were the same as observed in the microarray analysis (Fig. 3B).

GO and pathway analysis for differentially expressed mRNAs

GO categories for each gene were derived from the GO website (www.geneontology.org). The categories comprised of three structured networks; biological processes, cellular components and molecular function. Through analysis of the GO items, it was found that the differentially expressed mRNAs were principally enriched in the following components (P<0.05, with -log10(P)>1.30): i) Oxygen transport, gas transport, translational elongation and cell cycle phases (biological processes; Fig. 4A); ii) the cytosolic compartment, the organelle compartment, intracellular organelle compartment and macromolecular complexes (cellular component; Fig. 4B); and iii) oxygen transporter activity, tubulin binding, identical protein binding and gamma-tubulin binding (molecular function; Fig. 4C). KEGG pathway analysis was also performed based on the KEGG database (http://www.genome.jp/kegg/). The dysregulated mRNAs were associated with 13 biological pathways, particularly with oxidative phosphorylation, ribosomal pathways and Parkinson's disease (P<0.01; Fig. 4D).

Figure 4.

GO enrichment and KEGG pathway analyses for differentially expressed mRNAs in IPAH. A GO analysis indicated enrichment of the differentially expressed mRNAs in (A) biological processes, (B) cellular components and (C) molecular functions. (D) Enrichment of the differentially expressed mRNAs based on a KEGG pathway analysis. *P<0.05 vs. matched healthy controls. GO, gene ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes pathway.

GO and pathway analysis for differentially expressed lncRNAs

Existing evidence implies that the majority of lncRNAs are cis-acting and regulate the expression of adjacent genes (18). The present study identified protein-coding genes within 100 kb of dysregulated lncRNA on chromosomal DNA. GO and KEGG pathway analyses subsequently indicated the functions of the potential target genes of lncRNAs. These coding genes were found to be predominantly involved in the following processes and functions (P<0.05, with -log10 (P)>1.30): i) Regulation of DNA replication, translational elongation, cell division and organelle fission (biological processes; Fig. 5A); ii) the hemoglobin complex, intracellular organelle compartment, cytoplasmic compartment and intraorganelle lumen compartment (cellular component, Fig. 5B); and iii) protein homodimerization activity, rRNA binding, gamma-tubulin binding (molecular function; Fig. 5C). KEGG pathway analysis also found the neighbouring genes of the dysregulated lncRNAs to be principally involved in the following (P<0.05): i) Splicesomal pathways; ii) the cell cycle; iii) apoptosis; iv) the p53 signaling pathway; v) oocyte meiosis; vi) Huntington's disease; and vii) prostate cancer (Fig. 5D).

Figure 5.

GO enrichment and KEGG pathway analyses for dysregulated lncRNAs in IPAH. A GO analysis indicated enrichment of the dysregulated lncRNAs in (A) biological processes, (B) cellular components and (C) molecular functions. (D) Enrichment of the dysregulated lncRNAs in various pathways based on a KEGG pathway analysis. *P<0.05 vs. matched healthy controls. GO, gene ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes pathway.

Discussion

In the present study, dysregulated lncRNAs in IPAH were analyzed, via comparison of the peripheral blood transcriptome profiles of IPAH patients and healthy volunteers. A total of 7,429 lncRNAs and 8,110 mRNAs were measured. In terms of dyregulated RNAs, it was found that in IPAH, 2,004 lncRNAs were upregulated and 507 were downregulated, while 609 mRNAs were upregulated and 560 were downregulated. These RNAs were subsequently evaluated by microarray, GO and KEGG pathways analyses to determine their general characteristics and functional annotations. Collectively, the data suggests a potentially novel association of RNA profiles, particularly for lncRNA, with IPAH. The description of dysregulated mRNAs and lncRNAs obtained may provide insight into the pathogenesis and development of IPAH. Furthermore, the results of the present study may enable the development of novel therapeutic targets, along with diagnostic and prognostic markers for IPAH.

The RNA profiling analysis between IPAH and healthy subjects utilized lymphocytes as the RNA source. This was due to the difficulty in obtaining the involved tissues, namely the human pulmonary vasculature, from live individuals. Though pulmonary vasculature can be taken from healthy individuals at autopsy, RNAs may be degraded at varying rates, resulting in a discrepancy in the expression profiling relative to other studies (19). An additional objective of the present study was to identify a non-invasive diagnostic biomarker of IPAH, and thus, lymphocytes were more advantageous (for example, easy access) than other source tissues, such as alveolus tissue and vascular tissue (20). Furthermore, peripheral lymphocytes have been implicated in IPAH pathogenesis. Austin et al (21) found that, relative to controls, circulating T cell subsets, particularly cluster of differentiation 8 (CD8)+T and CD4+ T (regulatory) lymphocytes, were markedly increased in IPAH. In addition, the number of circulating monocyte-derived dendritic cells was lower in IPAH patients than in controls (22). Hautefort et al (23) also identified T helper 17 cell immune polarization in PAH patients that was absent in controls. Collectively these alternations in peripheral lymphocytes may contribute to alterations in RNA expression profiles.

The dysregulation of lncRNA expression in IPAH is not well established. However, a number of proteomic and transcriptome profiling studies for IPAH have been performed, in which several dysregulated genes have been identified (24–26). In particular, four previous profiling studies of IPAH have used peripheral blood from IPAH patients and controls (27–30). Among these, two groups performed comparative proteomic analysis of serum from IPAH patients and healthy controls, identifying 13 (27) and 9 (30) dysregulated proteins in the IPAH patients. For the profiling analysis conducted by Ulrich et al (29), purified B-cells were utilized, with the observation that 225 genes were upregulated by a minimum of 1.3-fold in IPAH, relative to controls. Similar to the current study, mRNA expression profiling using mononuclear cells from IPAH patients has also been reported, and it was observed that 2,896 genes were dysregulated in IPAH patients with mild PAH (FC>1.5, P<0.05) (28). When comparing these IPAH-related genes to results of the current study, it was found that >100 genes were shared, including ABCG4, ACADM, ADAM10, ARF6, C14orf45, CEBPG, DMBT1, FTO, FUT2, MYL4, TCF4 and TRIM58.

Discrepancies between the mRNA expression profiles of the current study and previous studies are likely due to a number of limitations. For example, the IPAH RNA and protein profiles fluctuate markedly during disease progression (31,32), leading to variable RNA profiles. In addition, different detection platforms may have substantial impact on the profiling results and thus, subsequent experimental verification is necessary. The majority of previous studies have used an Affymetrix platform for mRNA profiling analysis, while the present study used Arraystar Human LncRNA Microarray v2.0 for the specific analysis of lncRNAs.

The gene signature identified in IPAH patients was characterized by an increased expression of genes, gene sets, functions and networks related to fibroblast and PASMC proliferation. Therefore, the cause of IPAH may be aberrant proliferation of fibroblasts and PASMCs. In the present study, numerous genes with potential effects on cell proliferation were identified, including erythroblast transformation-specific-related gene, JUN proto-oncogene and mouse double minute 2 homolog. Furthermore, several members of the matrix metallo proteinase (MMP) family, including MMP1, MMP11 and MMP15, showed dysregulated expression in the IPAH group. It has been reported that MMP1 upregulation is involved in fibroblast proliferation and migration, along with extracellular matrix accumulation (33), while MMP11 may cause basal membrane disruption and stimulate the adventitial thickening of pulmonary vessels (34). Collectively, myofibroblast proliferation and basal membrane disruption results in progressive parenchymal fibrosis, alveolar damage and incorporation of connective tissue around the pulmonary vessels, which may also lead to the development of IPAH.

Previous pathway analysis has suggested that numerous genes are involved in IPAH. In particular, genes involved in cellular growth/proliferation and cell cycle regulation, and signaling pathway genes including mitotic activators, polo-like kinases and ataxia telangiectasia mutated, are activated in IPAH (26). Similarly, the present study found that genes dysregulated in IPAH were involved in translational elongation, cell cycle phases and ribosomal pathways, suggesting that transcriptional and translational processes are disrupted in IPAH. This would result in disruption to protein expression, with potentially far-reaching effects on normal physiological processes, including impairment of mitochondrial translation and energy generation (35,36). Analogous to these results, PASMC proliferation is established to be a driving factor in PAH (3).

To conclude, the lncRNA profile of IPAH patients was previously unknown. The present study has identified a number of dysregulated lncRNAs that are potentially implicated in IPAH, which may provide insight into the pathogenesis and mechanisms of the disease. Therefore, further study is warranted into the functions of these lncRNAs, as potential therapeutic targets for the treatment of IPAH.