Literature DB >> 28583081

Addition of plant-growth-promoting Bacillus subtilis PTS-394 on tomato rhizosphere has no durable impact on composition of root microbiome.

Junqing Qiao1, Xiang Yu2, Xuejie Liang1, Yongfeng Liu1, Rainer Borriss3,4, Youzhou Liu5.   

Abstract

BACKGROUND: Representatives of the genus Bacillus are increasingly used in agriculture to promote plant growth and to protect against plant pathogens. Unfortunately, hitherto the impact of Bacillus inoculants on the indigenous plant microbiota has been investigated exclusively for the species Bacillus amyloliquefaciens and was limited to prokaryotes, whilst eukaryotic member of this community, e.g. fungi, were not considered.
RESULTS: The root-colonizing Bacillus subtilis PTS-394 supported growth of tomato plants and suppressed soil-borne diseases. Roche 454 pyrosequencing revealed that PTS-394 has only a transient impact on the microbiota community of the tomato rhizosphere. The impact on eukaryota could last up to 14 days, while that on bacterial communities lasted for 3 days only.
CONCLUSIONS: Ecological adaptation and microbial community-preserving capacity are important criteria when assessing suitability of bio-inoculants for commercial development. As shown here, B. subtilis PTS-394 is acting as an environmentally compatible plant protective agent without permanent effects on rhizosphere microbial community.

Entities:  

Keywords:  Bacillus subtilis PTS-394; Phylogenomics analysis; Rhizosphere Microbiota community; Roche 454 Pyrosequencing; Root colonization

Mesh:

Year:  2017        PMID: 28583081      PMCID: PMC5460418          DOI: 10.1186/s12866-017-1039-x

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Plant growth-promoting rhizobacteria (PGPR) have potential as biocontrol agents that could replace chemical pesticides thereby reducing undesired chemical remnants in agriculture. Plant growth promotion, suppression of plant diseases and rhizosphere competence (colonization and survival on plant roots) by PGPR, especially bacilli, have been considered as critical requisites for the development of commercial products [1, 2]. To be effective, PGPRs must establish and maintain a sufficient population in the rhizosphere [3]. It is reported that the robust colonization of plant roots by beneficial microbes directly contributes to the effective biocontrol of soil-borne pathogens [4]. Root colonization and rhizosphere competence is thus a critical prerequisite for the successful use of PGPRs as biocontrol and plant growth-promoting agents [5, 6]. The rhizosphere is rich in nutrients due to the accumulation of plant exudates containing amino acids and sugars that provides a rich source of energy and nutrients for colonizing bacteria [7]. This forces the bacterial community to colonize the rhizoplane and rhizosphere [8]. The colonizing capability of PGPR strains has been investigated using GFP labeling and transposon-mediated random mutagenesis approaches, in Pseudomonas and Bacillus strains, in particular [9, 10]. Bacterial traits such as chemotaxis, motility, attachment, growth, and stress resistance all appear to contribute to the colonization competence of PGPRs [8]. Rhizosphere competence is essentially a process of niche competition between PGPRs and other microbes present in the vicinity of plant roots, in which resource partitioning, competitive exclusion, and co-existence can all play a part. It is reported that PGPRs colonize more efficient in poorer microbial communities than in richer soils [11]. The indigenous rhizosphere microbial community can be influenced by large-scale application of PGPRs in field trials [12]. Pseudomonas sp. DSMZ 13134 affects the dominant bacterial community of barley roots in the tested soil system [13], for example. By contrast, as revealed by T-RFLP community fingerprinting, application of Bacillus amyloliquefaciens FZB42 did not change the composition of rhizosphere bacterial community in a measurable extent [2]. Similar results were also found for B. amyloliquefaciens BNM122 in soybean [14]. Recently, persistence and the effect of FZB42 on the microbial community of lettuce were more deeply analyzed by 454-amplicon sequencing corroborating that inoculation with B. amyloliquefaciens has no or only transient minor effects on the microbiota in vicinity of plant roots [15]. A slow decrease in the number of inoculated bacteria was also registered. After five weeks only 55% of the initial number of FZB42 DNA was still traceable within the rhizosphere of lettuce in the field [16]. Unfortunately, till now, the effect of Bacillus PGPR on the non-bacterial members of indigenous plant microbiota has not been analyzed. Moreover, no other representatives of the B. subtilis species complex than B. amyloliquefaciens, the main source for commercial biofertilizer and biocontrol agents, have been proven for their impact on plant rhizosphere. Bacillus subtilis PTS-394, isolated from the rhizosphere of tomato and fully sequenced in 2014 [17], has been shown to suppress tomato soil-borne diseases caused by Fusarium oxysporum and Ralstonia solanacearum which is the main obstacle to continuous cropping of tomato in greenhouse cultivation [18]. In the present study, the colonization behavior and plant growth-promoting capability of PTS-394 were investigated in laboratory and greenhouse experiments. Additionally, the effect of PTS-394 on the rhizosphere microbial community was studied using Roche 454 pyrosequencing of 16S rRNA and ITS partial sequences. The aim was to improve our understanding of the ecological consequences of microbial inoculants and of rhizosphere microbiota ecology.

Methods

Strains and growth conditions

Bacillus subtilis PTS-394 and the GFP-tagged strain of B. subtilis PTS-394G containing the plasmid pGFP22 were isolated and constructed by our laboratory [19]. The Bacillus strains were grown in YPG medium containing 0.5% yeast extract, 0.5% peptone and 0.5% glucose. 5 μg/ml of chloramphenicol was added when necessary for B. subtilis PTS-394G.

The software of Phylogenomic analysis

Phylogenomic analysis of strain PTS-394 was performed taking advantage of availability of the whole genome sequence [17]. JSpeciesWS (http://jspecies.ribohost.com/jspeciesws/) was used to determine ANIb (average nucleotide identity based on BLAST+) and ANIm (average nucleotide identity based on MUMmer) values by pairwise genome comparisons. Correlation indexes of their Tetra-nucleotide signatures (TETRA) were determined by using the JSpeciesWS software (Richter et al., 2015). Electronic DNA-DNA hybridization (dDDH) is useful to mimic the wet-lab DDH and can be used for genome-based species delineation and genome-based subspecies delineation [20, 21] and was applied to finally defined PTS-394 whether belong to B. subtilis subsp. subtilis. Three formulas are applicable for the calculation: Formula: 1 (HSP length / total length), formula: 2 (identities / HSP length) and formula 3 (identities / total length). Formula 2, which is especially appropriate to analyze draft genomes, was used.

The colonization and plant growth promotion of PTS-394 on agar plates

B. subtilis PTS-394 was shaken at 180 rpm at 28 °C for 36 h, centrifuged at 5000 rpm for 10 min, then the cell pellets were suspended in sterile distilled water and adjusted to an OD600 of 0.01, 0.1, 1.0, 1.5, and 3.0 (OD600 = 1.0, ~5 × 107 CFU/mL). Tomato (tomato cultivar ‘Moneymaker’) seeds were surface-sterilized using sodium hypochlorite (3%, v/v) for 5 min, washed three times with sterile water and soaked in the above cell suspensions at 25 °C for 24 h. Seeds were sown into individual 9 cm diameter MS agar plates [22] at a density of five seeds per plate. Each treatment was performed on 10 plants and was replicated three times. Plates were incubated in a growth chamber with a daytime temperature of 25 °C and a night temperature of 18 °C, 75% humidity and a 12:12 h light: dark cycle with a light intensity of 8000 lux. At 14 days after sowing, plant fresh weight and the amount of PTS-394 on the root surface were measured as previously described [23].

The colonization and plant growth promotion of PTS-394 in pots

The dynamic colonization of PTS-394 on the tomato rhizoplane and its plant growth-promoting ability were investigated by pot experiments, and the GFP-labeled strain (PTS-394G) was used for colonization analysis. Suspensions of B. subtilis PTS-394 and PTS-394G with an OD600 = 1.0 were used. In both experiments, tomato seeds were surface-disinfected and sown into nursery soil containing a mixture of vermiculite and organic manure (1:1, w/w) for germination. Tomato seedlings at the 4-leaf stage were transplanted into pots filled with a mixture of vermiculite, rice field soil and organic manure (1:2:1, w/w). 20 mL of bacterial cell suspension was added to each plant and cultivation was continued in a greenhouse under natural conditions with temperatures ranging from 18 to 30 °C. Each treatment was performed on 30 plants and replicated three times in a completely randomized block design. In the colonization experiment, tomato root samples were collected from three PTS-394G plants at 0, 1, 2, 3, 5, 7, 9, 11, 14, and 21 days after transplantation and the amount of PTS-394 on the root surface was determined, as described previously. Meanwhile, tomato roots were examined at 1, 3, 7 and 14 days using fluorescent microscopy in order to detect colonization with PTS-394G. At 30 days after treatment with PTS-394, the fresh weight of the root and the plant height were measured in order to evaluate the growth-promoting effect of PTS-394.

Rhizosphere soil collection and DNA extraction

During the pot experiment described above, rhizosphere soil from untreated and PTS-394-treated pot-grown tomato plants was collected from three plants at 1, 3, 7, 9 and 14 days after treatment. Rhizosphere soil total DNA was extracted using the PowerSoil DNA Isolation Kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) and the quality was estimated using a NanoDrop spectrophotometer (ND-1000, NanoDrop Technologies, Wilmington, USA).

PCR amplification and Roche 454 pyrosequencing

For analysis of bacteria diversity, partial 16S rRNA genes were amplified using primers 27F (AGAGTTTGATCMTGGCTCAG) and 533R (TTACCGCGGCTGCTGGCAC). Primer pair ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were was used to amplify partial ITS sequences of eukaryotes. Amplifications were performed using the following program: initial denaturation at 95 °C for 2 min, 25 (for 16S rRNA) or 33 (for ITS) cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 5 min. Emulsion PCR was performed with the emPCRAmp-Lib L Kit (Roche) and PCR amplicons were pyrosequenced by Shanghai Majorbio Bio-pharm Technology Co. Ltd. (Shanghai, China) using a Roche 454 GS FLX instrument and Titanium reagents. Pyrosequencing generated 84,579 and 157,116 raw ITS and 16S rDNA reads, respectively.

Processing of 454 sequencing data

Sequences were assigned to different samples according to sample-specific barcodes and processed using QIIME (version 1.17). Data were selected based on the following criteria: (i) an almost perfect match with barcode and primers; (ii) a length of at least 200 nucleotides (barcodes and primers excluded); (iii) an average quality score of >25, with no ambiguous bases or homopolymers longer than six bp, and without any primer mismatches. After this procedure, 67,520 and 140,099 high-quality sequences were obtained for ITS and 16S rDNA reads, respectively. The number of clean reads per samples are listed in Additional file 1: Table S1 and Additional file 2: Table S2. Operational Taxonomic Units (OTUs) were clustered using a 97% similarity cutoff by UPARSE (version 7.1 http://drive5.com/uparse/) and chimeric sequences were identified and removed using UCHIME. The phylogenetic affiliation of each 16S rRNA gene and ITS sequence were analyzed by RDP Classifier (http://rdp.cme.msu.edu/) against the SILVA (SSU111) 16S/18S rRNA database. Taxonomic assignment from phylum level to strain level based on hits, and these were used to plot abundance graphs.

Statistical analysis

Plant fresh weight, height and number of colonizing bacteria were analyzed using Microsoft Excel. Calculation of variance (ANOVA) and mean comparison between treatments was carried out based on the Tukey’s test at the 0.05 probability level using SPSS version 19 (IBM Corporation, New York, USA). Principal component analysis (PCA) was performed to analyze the effect of PTS-394 and sampling time on the microbiota community at the OTU level using the R-forge community ecology package (vegan 2.0 was used to generate the PCA Figures).

Results

Phylogenomics of B. subtilis PTS-394

Phylogenomic analysis of strain PTS-394 was performed taking advantage of availability of the whole draft genome sequence. ANIb and ANIm values in comparison to the B. subtilis type strain 168 were determined by using the JSpecies program package. In order to finally decide, whether PTS-394 belong to B. subtilis subsp. subtilis, electronic DNA-DNA hybridization (dDDH) was applied. For calculating dDDH three different formulas can be applied (see Methods), but only results obtained with the recommended formula 2 were used in our analysis. The nearest neighbors of PTS-394 found by using different phylogenomic analyses were representatives of B. subtilis subsp. subtilis including the type strain B. subtilis 168 (Table 1). Tetra results (tetranucleotide signature correlation index) determined for PTS-394 when compared with B. subtilis subsp. subtilis 168(T) were in subspecies range (>0,999). The same comparison revealed ANI values far above the recommended species threshold of 0.96% [24] and dDDH values clearly exceeding subspecies delineation (>79%, [21]). By contrast, phylogenomic comparison with other members of the B. subtilis species complex including other subspecies of B. subtilis, B. tequilensis, B. vallismortis, B. atrophaeus, B.amyloliquefaciens, B. velezensis, B. methylotrophicus, and B. siamensis did yield values sufficient for species delineation (Table 1). We conclude that strain PTS-394 is a representative of the plant-associated taxon B. subtilis subsp. subtilis.
Table 1

Taxonomic relationship of B. subtilis PTS-394 based on whole genome analysis

queryaccessionZ-scoreANIbANImdDDH (formula 2)ProbabilityG + C
>70%>79%
Bacillus subtilis PTS-394AWXG00000000
reference
Bacillus subtilis subtilis ASM74047v1JPVW01000000 0.99976 98.56 98.85 90.10% [87.8–92.1%] 95.85% 65.49% 0.00%
Bacillus subtilis QH-1AZQS00000000 0.99976 98.59 98.95 91.10% [88.9–92.9%] 96.15% 66.94% 0.02%
Bacillus subtilis subtilis 168(T)NC_000964.3 0.99929 98.46 98.85 90.10% [87.8–92%] 95.84% 65.47% 0.18%
Bacillus subtilis subtilis MP9APMW00000000.1 0.99969 98.41 98.62 87.20% [84.7–89.4%] 94.76% 60.77% 0.09%
Bacillus subtilis B4143JXLQ00000000 0.99969 98.38 98.65 88.00% [85.5–90.1%] 95.06% 61.99% 0.03%
Bacillus subtilis subtilis RO-NN-1CP002906.1 0.99953 97.84 98.07 82.90% [80–85.4%] 92.55% 53.1% 0.17%
Bacillus subtilis spizizenii W23NC_014479.10.9989592.5992.8749.30% [46.7–52%]17.32%3.61%0.19%
Bacillus subtilis spizizenii ATCC 6633ADGS000000000.9990192.4992.8749.20% [46.6–51.8%]17%3.54%0.13%
B.subtilis inaquosorum KCTC13429(T)AMXN000000000.9983292.3793.0549.90% [47.3–52.6%]18.92%3.93%0.01%
Bacillus tequilensis KCTC 13622(T)AYTO000000000.9974191.2991.8344.90% [42.3–47.4%]8%1.76%0.16%
Bacillus vallismortis DV1-F-3AFSH000000000.9972990.4791.1042.50% [40–45%]4.85%1.14%0.06%
Bacillus mojavensis KCTC 3706(T)AYTL000000000.9974886.8187.5832.40% [30–34.9%]0.27%0.1%0.03%
Bacillus mojavensis RRC 101ASJT000000000.9973186.7487.6432.40% [30–34.9%]0.27%0.1%0.03%
Bacillus atrophaeus 1942CP002207.10.9858279.1983.8822.00% [19.8–24.5%]0%0%0.48%
Bacillus amyloliquefaciens DSM 7(T)FN597644.10.9530376.3983.8820.40% [18.2–22.8%]0%0%2.39%
Bacillus amyloliquefaciens UCMB-5036NC_020410.10.9488976.3384.1920.50% [18.3–22.9%]0%0%2.9%
Bacillus amyloliquefaciens UCMB-5113NC_022081.10.9491976.3284.1220.50% [18.2–22.9%]0%0%3.01%
Bacillus amyloliquefaciens FZB42(T)NC_009725.10.950876.2984.1520.50% [18.3–22.9%]0%0%2.78%
Bacillus amyloliquefaciens UCMB-5033NC_022075.10.9504976.2684.0920.40% [18.2–22.8%]0%0%2.49%
Bacillus methylotrophicus SK19.001AOFO000000000.9515776.2184.2520.40% [18.1–22.8%]0%0%2.47%
Bacillus methylotrophicus JS25RCP009679.10.952376.1684.2120.40% [18.2–22.8%]0%0%2.71%
Bacillus siamensis KCTC 13613(T)AJVF000000000.9529676.1684.3920.60% [18.3–23%]0%0%2.64%

Thresholds supporting subspecies delineation (intraspecific Tetra-nucleotide signature correlation index (Z-score): > 0.999, ANIb and ANIm: >98%, and dDDH: >79%) are indicated in bold letters

Taxonomic relationship of B. subtilis PTS-394 based on whole genome analysis Thresholds supporting subspecies delineation (intraspecific Tetra-nucleotide signature correlation index (Z-score): > 0.999, ANIb and ANIm: >98%, and dDDH: >79%) are indicated in bold letters

PTS-394 is able to colonize roots and to promote growth of tomato plants

The effect of B. subtilis PTS-394 on tomato growth and root colonization was evaluated using MS agar plates. After 7 and 14 days growth, PTS-394 cells became clearly visible around the tomato primary root (Fig. 1a). Density of PTS-394 on the tomato rhizoplane ranged from 106 to 107 CFU per gram of fresh root, and was found enhanced with increasing cell density of the soaking suspension (Fig. 1a). These results indicated successful root colonization by PTS-394, which is a key requirement for biocontrol action and plant growth-promoting activity. Seedling fresh weight data showed that PTS-394 exhibited impressive growth-promoting activity at a cell density (OD600) of 0.5 and 1.0 in the soaking suspension, yielding 1.08 × 107 and 1.4 × 107 CFU/g of fresh root on the tomato rhizoplane, respectively (Fig. 1b). These treatments increased plant growth by 9.46% and 18.36%, respectively, compared to controls. However, tomato growth was slightly inhibited when the PTS-394 cell number exceeded 7 × 107 CFU/g of fresh root, suggesting that too high cell numbers at rhizoplane might negatively affect plant growth by that bacterium.
Fig. 1

Effect of B. subtilis PTS-394 on root colonization and tomato growth on MS agar. a, PTS-394 cell number (CFU) detected on the tomato rhizoplane after treatment with suspensions of different cell densities (histogram), and pattern of colonization by PTS-394 (arrows indicate the PTS-394 cells around the tomato root). b, Growth promotion effect of PTS-394: Fresh weight of tomato seedlings after soaking with suspensions of different cell densities (histogram). Different letters indicate significant difference at the 0.05 level by Duncan’s new multiple range test

Effect of B. subtilis PTS-394 on root colonization and tomato growth on MS agar. a, PTS-394 cell number (CFU) detected on the tomato rhizoplane after treatment with suspensions of different cell densities (histogram), and pattern of colonization by PTS-394 (arrows indicate the PTS-394 cells around the tomato root). b, Growth promotion effect of PTS-394: Fresh weight of tomato seedlings after soaking with suspensions of different cell densities (histogram). Different letters indicate significant difference at the 0.05 level by Duncan’s new multiple range test

Evaluation of root colonization and tomato growth promotion by PTS-394 in pot experiments

Pot experiments were performed to investigate the colonization capability of PTS-394G at different time intervals. Initially, rate of root colonization decreased sharply before steadily increasing over time (Fig. 2a). Almost 2 × 106 CFU per gram of root were detected immediately after inoculation; 48 h after inoculation this number dropped to 3.7 × 105 CFU/g root. During next days PTS-394G cell number increased steadily and reached 1.7 × 106 CFU/g root nine days after inoculation. Between days 9–21, the PTS-394G cell number ranged between 1 × 106 to 2 × 106 CFU/g root, and fluorescent microscopy revealed that colonization occurred on the root surface, where PTS-394 cells formed micro-colonies or biofilms 7 days after treatment (Fig. 2b). The average plant height and root weight were 51.25 cm and 2.94 g, respectively, after treatment with PTS-394, which represented an increase of 8.90% and 18.30% compared with untreated control plants (Fig. 2c).
Fig. 2

Colonization dynamics and growth promotion of Bacillus subtilis PTS-394 in tomato pot experiments. a, Bacterial cell counts on tomato plant root surfaces over time following inoculation with B. subtilis PTS-394G. b, Fluorescent microscopy of tomato roots colonized by PTS-394G. Root samples were collected at 1 (a), 3 (b), 7 (c) and 14 (d) days post-treatment. c, Effect of PTS-394 on growth promotion as measured by root fresh weight and plant height. Error bars indicate the standard deviation calculated from three independent samples. The asterisk indicates a significant difference at the 0.05 level by Duncan’s new multiple range test

Colonization dynamics and growth promotion of Bacillus subtilis PTS-394 in tomato pot experiments. a, Bacterial cell counts on tomato plant root surfaces over time following inoculation with B. subtilis PTS-394G. b, Fluorescent microscopy of tomato roots colonized by PTS-394G. Root samples were collected at 1 (a), 3 (b), 7 (c) and 14 (d) days post-treatment. c, Effect of PTS-394 on growth promotion as measured by root fresh weight and plant height. Error bars indicate the standard deviation calculated from three independent samples. The asterisk indicates a significant difference at the 0.05 level by Duncan’s new multiple range test

Impact of PTS-394 on bacterial members of the rhizosphere microbiota

Determination of the composition of the bacterial community in vicinity of plant roots was performed by metagenome sequencing (see Methods). A total of 157,116 raw 16S rRNA sequences were obtained from 10 soil samples collected at five different time intervals from PTS-394-treated and untreated plants. The number of clean sequences per sample ranged from 11,773 to 15,879, with an average of 14,010. At 97% sequence similarity, these clean sequences represented a total of 19,231 OTUs by a two-stage clustering (TSC) algorithm and ranged from 4054 to 5343. The Shannon index of diversity was determined for all samples, and ranged from 7.41 to 7.94. The Good’s Coverage per sample ranged from 0.77 to 0.83. The statistical indexes and richness estimates per sample are summarized in Additional file 1: Table S1. Global Alignment for Sequence Taxonomy (GAST) was used for taxonomic assignment of 16S rRNA sequences, and 31 phyla were identified by pooling sequences from all samples, with nineteen core phyla present in all ten samples (Table 2). The three most abundant core phyla were Proteobacteria, Bacteroidetes and Actinobacteria, which were present in all samples, except the one collected on the first day after treatment with PTS-394.
Table 2

Relative abundance of nineteen bacterial core phyla present in rhizosphere bacterial community determined by 16S sequencing

Core phylumRelative abundance (%) in Control treatmentRelative abundance (%) in PTS-394 treatment
1 d3 d7 d9 d14 d1 d3 d7 d9 d14 d
Proteobacteria 37.9438.4340.1137.1341.5836.5639.1838.2941.3739.22
Bacteroidetes 13.8513.3612.2414.2611.1911.4812.2711.3011.5612.45
Actinobacteria 9.709.439.7311.9610.677.927.8411.208.858.52
Chloroflexi 8.088.368.427.726.015.966.467.826.547.97
Acidobacteria 5.707.176.776.795.775.897.656.197.106.27
Gemmatimonadetes 6.125.285.384.375.365.836.016.126.596.29
Firmicutes 2.522.782.492.813.9213.786.683.853.583.29
Planctomycetes 5.805.215.184.913.933.584.254.664.223.05
Cyanobacteria 0.580.500.440.870.860.450.470.550.641.18
Verrucomicrobia 0.390.490.491.060.840.460.400.500.590.56
Nitrospirae 0.500.830.510.720.470.430.580.420.610.48
Chlorobia 0.480.400.410.280.320.360.400.550.511.09
Deinococcus-Thermus 0.350.550.320.300.290.300.350.360.420.33
Fusobacteria 0.420.530.390.470.210.330.280.240.260.21
Armatimonadetes 0.280.290.280.240.430.220.300.370.350.21
Fibrobacteres 0.070.080.090.090.180.050.070.090.090.31
Elusimicrobia 0.040.050.040.090.150.030.080.060.060.05
Thermotogae 0.050.040.050.040.020.040.010.040.010.03
Spirochaetes 0.030.030.050.010.020.040.030.030.010.02

The assay was performed 1, 3, 7, 9, and 14 days after inoculation with PTS-394. Control experiments without PTS-394 were performed at same time points

Relative abundance of nineteen bacterial core phyla present in rhizosphere bacterial community determined by 16S sequencing The assay was performed 1, 3, 7, 9, and 14 days after inoculation with PTS-394. Control experiments without PTS-394 were performed at same time points Principal component analysis (PCA) was used to analyze the effect of PTS-394 and sampling time on the structure of the bacterial community in the rhizosphere based on OTUs. PC1 and PC2 together accounted for more than 75% of the variation (Fig. 3a). There was a clear shift in bacterial community between 1 and 14 days after inoculation with PTS-394. Treated or untreated samples collected on day 1 were distinct from each other and from the other time points, however control and treated samples could not be distinguished at later stages. These results indicated that (i) changes in the bacterial community profile becomes visible soon after inoculation with B. subtilis, and (ii) application of PTS-394 affected only transiently the root bacteriome. As expected, a sudden rise of Firmicutes was registered due to the large quantity of B. subtilis PTS-394 cells applied. However, in course of the experiment the number of Firmicutes was steadily decreasing and became similar with the control 14 days after inoculation (Table 2).
Fig. 3

Effect of Bacillus subtilis PTS-394 on the rhizosphere bacterial community. a, Principal component analysis was performed based on OTUs from16S rRNA partial sequence. The same shape and color represent the same sampling time. △, □, ○, ◇, ☆ represent 1, 3, 7, 9 and 14 days after transplantation. Filled data points represent plants treated with PTS-394 and open data points represent control plants. b, relative abundance of 40 core groups (genera) present in the rhizosphere bacterial community

Effect of Bacillus subtilis PTS-394 on the rhizosphere bacterial community. a, Principal component analysis was performed based on OTUs from16S rRNA partial sequence. The same shape and color represent the same sampling time. △, □, ○, ◇, ☆ represent 1, 3, 7, 9 and 14 days after transplantation. Filled data points represent plants treated with PTS-394 and open data points represent control plants. b, relative abundance of 40 core groups (genera) present in the rhizosphere bacterial community BLAST analysis revealed that the relative abundance of 40 different groups (based on genus level under inclusion of some uncertain groups) was temporarily affected after inoculation (Fig.3b). A total of 19 groups were altered by PTS-394 treatment, occurrence of 10 groups was enhanced, including Thermomonas, Pseudomonas, Lactococcus and Rhodanobacter, while nine groups were suppressed, including Flexibacter, Planctomyces and Sneathiella. However, as in Firmicutes (see above), these groups were only temporarily affected and 14 days after inoculation no significant differences to the control were registered. The relative abundance and variation in the composition of these 19 groups is presented in Additional file 3: Figure S1.

Impact of PTS-394 on eukaryotic members of the rhizosphere microbiota

Presence of eukaryotic groups in vicinity of plant roots was determined by using 18S rRNA sequences in a similar way as described for bacteria. In total, 84,579 raw ITS sequences were obtained and the number of clean sequences per sample varied ranged from3, 897 to 8402, with an average of 6752. A total of 1491 Operational Taxonomic Units (OTUs) were obtained at a distance of 0.03 using the TSC algorithm. The Shannon index of diversity was determined for 10 samples, and ranged from 0.28 to 4.15. The Good’s coverage per sample ranged from 0.96 to 0.99. Although there was some fluctuation of reads over time, analysis of these data corroborated their credibility. The statistical indexes and richness estimates of per sample are summarized in Additional file 2: Table S2. The eukaryotic OTUs could be arranged into three kingdoms (Fungi, Metazoa and Viridiplantae) along with the no rank Eukaryota group, a group of unclassified Eukaryota and a group of unclassified organisms. Altogether, thirteen phyla were identified. Seven core phyla were detected in every sample. The most abundant phyla were Streptophyta, Chlorophyta Ascomycota and Basidiomycota (Table 3). After the application of PTS-394, the composition of Fungi, Viridiplantae, the no rank Eukaryota group and the unclassified group were altered, compared to the untreated control. The relative abundance of Fungi, of the no rank Eukaryota group, and of the group of unclassified organisms was lower than that of the control at the same sample time. However, the relative abundance of Viridiplantae (Solanoideae) was found higher than in the control.
Table 3

Relative abundance of core kingdoms/phylum present in rhizosphere eukaryota community determined by ITS sequencing

Core KingdomRelative abundance (%) in Control treatmentRelative abundance (%) in PTS-394 treatment
1 d3 d7 d9 d14 d1 d3 d7 d9 d14 d
Fungi 16.2420.545.6436.521.1117.2212.105.919.331.53
Viridiplantae 29.7924.9381.8139.5997.7658.2279.2392.2981.4097.37
Metazoa 0.390.620.050.980.170.630.150.431.090.14
no_rank_Eukaryota group 20.3721.836.2120.690.2022.277.931.087.040.94
unclassified_Eukaryota group 0.180.200.080.160.000.060.040.030.010.01
Unclassified group 33.0331.876.212.050.761.590.550.271.120.00
Core phylum
Streptophyta 19.8717.2974.1530.0697.4318.1764.0290.4670.6097.32
Chlorophyta 9.917.597.649.390.3340.0415.201.8310.800.05
Ascomycota 2.173.981.308.420.132.261.440.590.670.63
Basidiomycota 1.941.830.832.100.171.604.360.941.130.16
Porifera 0.370.490.050.790.060.190.120.420.780.01
Chytridiomycota 0.180.420.200.580.030.400.190.110.230.07
Nematoda 0.030.090.000.150.120.410.030.010.110.10
no_rank_Eukaryota group 20.3721.826.1920.680.2022.267.931.057.040.94
no_rank_Fungi group 11.1912.943.1318.860.6712.445.754.186.990.66
unclassified_Eukaryota group 0.180.200.080.160.000.060.040.030.010.01
unclassified_Fungi group 0.711.300.186.480.100.440.280.080.140.01

The assay was performed 1, 3, 7, 9, and 14 days after inoculation with PTS-394, Control experiments without PTS-394 were performed at same time points

Relative abundance of core kingdoms/phylum present in rhizosphere eukaryota community determined by ITS sequencing The assay was performed 1, 3, 7, 9, and 14 days after inoculation with PTS-394, Control experiments without PTS-394 were performed at same time points All OTUs were subjected to PCA analysis and PC1 and PC2 together accounted for more than 90% of the variation (Fig. 4a). A significant temporal change in the community profile of Eukaryota is visible in the biplot. Profiles of control and PTS-394-treated samples collected at identical time points revealed slight differences from day 1 until day 9 after treatment with PTS-394, but could not be distinguished 14 days after inoculation. These results are in accordance to those found for the rhizosphere bacteriome, and indicate that (i) PTS-394 had a transient influence on composition of the eukaryotic members of the rhizosphere microbiome, but (ii) the community recovered to its original state 14 days after treatment. BLAST analysis revealed that the relative abundance of 29 groups (based on the eukaryota genus level and including some uncertain groups) was transiently affected after inoculation with PTS-394 (Fig. 4b). A total of 19 groups were altered by PTS-394 treatment; five groups were enhanced, including Solanoideae, Chlamydomonas and Chloromonas, and 14 groups were decreased. The variation in these 19 groups is presented in Additional file 4: Figure S2.
Fig. 4

Effect of B. subtilis PTS-394 on the rhizosphere Eukaryota community. a, Principal component analysis was performed based on OTUs from ITS partial sequences. The same shape and color indicate the same sampling time. △, □, ○, ◇, ☆ represent 1, 3, 7, 9 and 14 days after transplantation. Filled data circles represent plants treated with PTS-394 and open circles represent control plants. b, relative abundance of 29 core groups (genera) present in the rhizosphere Eukaryota community

Effect of B. subtilis PTS-394 on the rhizosphere Eukaryota community. a, Principal component analysis was performed based on OTUs from ITS partial sequences. The same shape and color indicate the same sampling time. △, □, ○, ◇, ☆ represent 1, 3, 7, 9 and 14 days after transplantation. Filled data circles represent plants treated with PTS-394 and open circles represent control plants. b, relative abundance of 29 core groups (genera) present in the rhizosphere Eukaryota community PCA on OTUs classified as fungi revealed a temporal variation in the fungal community in dependence of PTS-394 inoculation (Fig. 5). The Control and the PTS-394-treated samples were found different during the first four time points, suggesting that PTS-394 inoculation affects the fungal community transiently, similar to its effect on the bacterial community. Sequence homology and analysis of the relative abundance of OTUs showed that abundance of fungi was generally suppressed during plant development, however by PTS-394 this process was slightly enhanced (Table 3). As expected, the relative abundance of Fusarium oxysporum was inhibited after treatment with PTS-394 indicating antagonistic activity of PTS-394 against F. oxysporum (Additional file 5: Figure S3).
Fig. 5

Effect of B. subtilis PTS-394 on the rhizosphere fungi community. Principal component analysis was performed based on OTUs from fungi ITS partial sequences. The same shape and color represent the same sampling time. △, □, ○, ◇, ☆ represent 1, 3, 7, 9 and 14 days after transplantation. Filled circles represent plants treated with PTS-394 and open circles represent control plants

Effect of B. subtilis PTS-394 on the rhizosphere fungi community. Principal component analysis was performed based on OTUs from fungi ITS partial sequences. The same shape and color represent the same sampling time. △, □, ○, ◇, ☆ represent 1, 3, 7, 9 and 14 days after transplantation. Filled circles represent plants treated with PTS-394 and open circles represent control plants

Discussion

Plant growth promotion and biocontrol activities are important features of commercial agents used in sustainable agriculture. To date members of the genus Bacillus are preferred for preparing bioformulations with beneficial impact on plant growth and health [1]. Especially, representatives of the B. subtilis species complex are known for their beneficial action on plants, especially B. amyloliquefaciens and B. subtilis [25]. These Bacilli stimulate plant growth: (1) directly, by increasing nutrients through the production of phytohormones, siderophores, organic acids involved in P-solubilisation and/or fixation of nitrogen [26]; and (2) indirectly, by producing antagonistic substances or by inducing the plant resistance against pathogens [7]. Here, we found that plant root-colonizing B. subtilis subsp. subtilis PTS-394G is able to persist on roots and to promote growth of tomato plants. Moreover, the plant pathogen Fusarium oxysporum was suppressed in presence of PTS-394. Laboratory MS plate experiments showed that the amount of PTS-394G on the tomato rhizoplane was approximately 107 CFU per gram of fresh root, while the cell number was 106 CFU in pot experiments. This suggests that sterile environment favors root colonization of PTS-394, which is consistent with previous reports [11, 27]. It is interesting to note that the plant growth promoting effect exerted by PTS-394 was dependent on the amount of B. subtilis cells used for inoculating tomato plants. Whilst cell numbers of 1.08 × 107 and 1.4 × 107 CFU/g fresh root supported plant growth, higher cell numbers such as 7 × 107 CFU/g fresh root, led to a slight growth inhibition. Without genetic experiments it remains questionable whether this different pattern of growth stimulation could be explained by a concentration dependent effect of the phytohormone indole-3-acetic acid (IAA). The PGPR B. amyloliquefaciens FZB42 is able to produce IAA and it is possible that higher concentrations of IAA exerts an inhibitory effect on plant growth [1]. In fact, ysnE, a gene encoding a putative IAA acetyltransferase, which is involved in IAA synthesis pathway, was detected in the genome of PTS-394. Our results demonstrate that, besides B. amyloliquefaciens and B. pumilus, plant-associated representatives of the B. subtilis subsp. subtilis taxon are promising candidates for developing of efficient biocontrol and biofertilizer agents. In this context it is important to know, whether addition of PTS-394 has an effect on composition of rhizosphere microbial community. Here, the effects of PTS-394 on the entire rhizosphere microbiota community was investigated by taxonomic profiling of metagenome sequences. In accordance with the results obtained for B. amyloliquefaciens FZB42 [2, 15, 16], only a transient effect on composition of the root microbiome was detected after adding the PGPR bacterium. Similarly, independent of its mode of application, applying B. amyloliquefaciens BNM122 to soy bean plants did not shift the composition of rhizosphere bacterial community in a measurable extent [14], suggesting that inoculation of crops with different representatives of the genus Bacillus has no durable impact on the bacteria living in vicinity of plant roots. By contrast, external addition of Gram-negative PGPR, such as Pseudomonas spp. [15, 28], Enterobacter cowanii [29], and Sinorhizobium meliloti [30] alter composition of root bacterial community in a similar extent as reported for fungal plant pathogens, e.g. Ralstonia solani [2]. Whilst the impact of PGPRs on the rhizosphere bacterial community is fairly investigated, relatively little is known about the effect of PGPRs on the overall eukaryotic community [8]. Analysis of 18S ribosomal ITS sequences showed that PTS-394 influences Eukaryota in the rhizosphere microbial community. However, similar to the effects exerted by rhizosphere bacteria, the impact of PTS-394 on Eukaryota was only transient, although longer-lasting than its effect on bacterial community. The rhizosphere contains amino acids and sugars nutrients due to the accumulation of root exudates that provides a rich source of energy and nutrients for rhizosphere microbiome. This determines composition of the microbiome community [7, 8]. After application of PTS-394, relative abundance of Fungi, Viridiplantae, the no rank Eukaryota group and the unclassified group was similar as in the control, but changes in their relative abundance compared to control were registered. Here, a significant increase of Viridiplantae relative abundance was observed which might be due to enhanced root development caused by PTS-394 as seen by enhanced number of streptophyta counts largely corresponding to tomato cells. Chlorophyte, another group of the Viridiplantae, the relative abundance was decreased significantly in the PTS-394 treatment, which correspond to the variation trend of main genus Chlamydomonas. In addition, PGPR have the ability to secrete several antagonistic compounds, such as antifungal acting lipopeptide antibiotics. Nihorimbere et al. reported that surfactin, iturin and fengycin were detected when Bacillus amyloliquefaciens S499 colonized tomato rhizosphere [31]. We found that suspensions of B. subtilis PTS-394 contained lipopeptides and polyketides. Whilst PTS-394 colonizes plant root, lipopeptides and polyketides might be secreted by the strain into the environment. These secondary compounds will either directly inhibit members of the microbiome community or stimulate the ISR response in plants. The suppressing effect of PTS-394 on plant pathogen Fusarium oxysporum in the rhizosphere is a typical example (Additional file 5: Figure S3). We assume that the transient effect of Bacillus subtilis PTS-394 on composition of the rhizosphere microbiome is caused by a sudden rise of Bacillus cells after inoculation, which is soon compensated by the indigenous microbial community. In case of eukaryota this restoration process is somewhat delayed due to their longer generation time compared to bacteria.

Conclusions

The impact of PGPRs on the overall rhizosphere community should be considered as important criteria when assessing their suitability for commercial development. Here we found that plant-growth-promoting and biocontrol Bacillus subtilis subsp. subtilis PTS-394 is not aggressive towards the indigenous tomato rhizosphere microbiota including their eukaryotic representatives, and has only a transient impact on the composition of the community. This, together with its beneficial effect on plant growth and health, makes PTS-394 to a promising candidate for developing a successful PGPR-based bioagent. Statistical indexes and richness estimates of the rhizosphere bacterial sequence data. (DOCX 29 kb) Statistical indexes and richness estimates of the rhizosphere eukaryote sequence data. (DOCX 29 kb) Variation trends in the abundance of 19 bacterial genera or groups following treatment with Bacillus subtilis PTS-394 (part 1 includes 10 groups stimulated by PTS-394, part 2 includes nine groups suppressed by PTS-394). (DOC 7802 kb) Variation trends in the abundance of 19 Eukaryota genera or groups following treatment with Bacillus subtilis PTS-394 (part 1 includes five groups stimulated by PTS-394, part 2 includes 14 groups suppressed by PTS-394). (DOC 6196 kb) The variation trends of Relative abundance of Fusarium oxsysporum following treatment with Bacillus subtilis PTS-394 (DOC 84 kb)
  22 in total

Review 1.  Use of plant growth-promoting bacteria for biocontrol of plant diseases: principles, mechanisms of action, and future prospects.

Authors:  Stéphane Compant; Brion Duffy; Jerzy Nowak; Christophe Clément; Essaïd Ait Barka
Journal:  Appl Environ Microbiol       Date:  2005-09       Impact factor: 4.792

2.  Survival of gfp-tagged antagonistic bacteria in the rhizosphere of tomato plants and their effects on the indigenous bacterial community.

Authors:  Monika Götz; Newton C M Gomes; Albert Dratwinski; Rodrigo Costa; Gabriele Berg; Raquel Peixoto; Leda Mendonça-Hagler; Kornelia Smalla
Journal:  FEMS Microbiol Ecol       Date:  2006-05       Impact factor: 4.194

Review 3.  Bacillus lipopeptides: versatile weapons for plant disease biocontrol.

Authors:  Marc Ongena; Philippe Jacques
Journal:  Trends Microbiol       Date:  2008-03       Impact factor: 17.079

4.  Gram-positive rhizobacterium Bacillus amyloliquefaciens FZB42 colonizes three types of plants in different patterns.

Authors:  Ben Fan; Rainer Borriss; Wilfrid Bleiss; Xiaoqin Wu
Journal:  J Microbiol       Date:  2012-02-27       Impact factor: 3.422

5.  The impact of the pathogen Rhizoctonia solani and its beneficial counterpart Bacillus amyloliquefaciens on the indigenous lettuce microbiome.

Authors:  Armin Erlacher; Massimiliano Cardinale; Rita Grosch; Martin Grube; Gabriele Berg
Journal:  Front Microbiol       Date:  2014-04-21       Impact factor: 5.640

6.  Effect of the strain Bacillus amyloliquefaciens FZB42 on the microbial community in the rhizosphere of lettuce under field conditions analyzed by whole metagenome sequencing.

Authors:  Magdalena Kröber; Daniel Wibberg; Rita Grosch; Felix Eikmeyer; Bart Verwaaijen; Soumitra P Chowdhury; Anton Hartmann; Alfred Pühler; Andreas Schlüter
Journal:  Front Microbiol       Date:  2014-05-27       Impact factor: 5.640

7.  Bioinformatic genome comparisons for taxonomic and phylogenetic assignments using Aeromonas as a test case.

Authors:  Sophie M Colston; Matthew S Fullmer; Lidia Beka; Brigitte Lamy; J Peter Gogarten; Joerg Graf
Journal:  mBio       Date:  2014-11-18       Impact factor: 7.867

8.  Complete genome sequence of DSM 30083(T), the type strain (U5/41(T)) of Escherichia coli, and a proposal for delineating subspecies in microbial taxonomy.

Authors:  Jan P Meier-Kolthoff; Richard L Hahnke; Jörn Petersen; Carmen Scheuner; Victoria Michael; Anne Fiebig; Christine Rohde; Manfred Rohde; Berthold Fartmann; Lynne A Goodwin; Olga Chertkov; Tbk Reddy; Amrita Pati; Natalia N Ivanova; Victor Markowitz; Nikos C Kyrpides; Tanja Woyke; Markus Göker; Hans-Peter Klenk
Journal:  Stand Genomic Sci       Date:  2014-12-08

9.  Effects of Bacillus amyloliquefaciens FZB42 on lettuce growth and health under pathogen pressure and its impact on the rhizosphere bacterial community.

Authors:  Soumitra Paul Chowdhury; Kristin Dietel; Manuela Rändler; Michael Schmid; Helmut Junge; Rainer Borriss; Anton Hartmann; Rita Grosch
Journal:  PLoS One       Date:  2013-07-23       Impact factor: 3.240

10.  Draft Genome Sequence of Root-Colonizing Bacterium Bacillus sp. Strain PTS-394.

Authors:  Junqing Qiao; Youzhou Liu; Xuejie Liang; Yonghong Hu; Yan Du
Journal:  Genome Announc       Date:  2014-02-13
View more
  26 in total

1.  Role of biochar, compost and plant growth promoting rhizobacteria in the management of tomato early blight disease.

Authors:  Mujahid Rasool; Adnan Akhter; Gerhard Soja; Muhammad Saleem Haider
Journal:  Sci Rep       Date:  2021-03-17       Impact factor: 4.379

2.  Succession of the wheat seed-associated microbiome as affected by soil fertility level and introduction of Penicillium and Bacillus inoculants in the field.

Authors:  Inês Nunes; Veronika Hansen; Frederik Bak; Lise Bonnichsen; Jianqiang Su; Xiuli Hao; Nelly Sophie Raymond; Mette Haubjerg Nicolaisen; Lars Stoumann Jensen; Ole Nybroe
Journal:  FEMS Microbiol Ecol       Date:  2022-03-24       Impact factor: 4.194

3.  Genomic insights into biocontrol potential of Bacillus stercoris LJBS06.

Authors:  Bo Wang; Hang Peng; Wei Wu; Bohan Yang; Yuchen Chen; Fei Xu; Yachun Peng; Yuxuan Qin; Peining Fu; Jiang Lu
Journal:  3 Biotech       Date:  2021-10-09       Impact factor: 2.406

4.  Application of Bacterial Endophytes to Control Bacterial Leaf Blight Disease and Promote Rice Growth.

Authors:  Ying Shing Ooi; Nik M I Mohamed Nor; Go Furusawa; Munirah Tharek; Amir H Ghazali
Journal:  Plant Pathol J       Date:  2022-10-01       Impact factor: 2.321

5.  Soil Inoculation with Bacillus spp. Modifies Root Endophytic Bacterial Diversity, Evenness, and Community Composition in a Context-Specific Manner.

Authors:  Kiran R Gadhave; Paul F Devlin; Andreas Ebertz; Arabella Ross; Alan C Gange
Journal:  Microb Ecol       Date:  2018-03-06       Impact factor: 4.552

6.  Deciphering microbial diversity associated with Fusarium wilt-diseased and disease-free banana rhizosphere soil.

Authors:  Dengbo Zhou; Tao Jing; Yufeng Chen; Fei Wang; Dengfeng Qi; Renjun Feng; Jianghui Xie; Huaping Li
Journal:  BMC Microbiol       Date:  2019-07-12       Impact factor: 3.605

7.  Revealing the Variation and Stability of Bacterial Communities in Tomato Rhizosphere Microbiota.

Authors:  Zhiqiang Cheng; Shaonan Lei; Ye Li; Wei Huang; Rongqin Ma; Juan Xiong; Ting Zhang; Lingyue Jin; Hafeez Ul Haq; Xiaohong Xu; Baoyu Tian
Journal:  Microorganisms       Date:  2020-01-25

8.  Compositional shifts in root-associated bacterial and archaeal microbiota track the plant life cycle in field-grown rice.

Authors:  Joseph A Edwards; Christian M Santos-Medellín; Zachary S Liechty; Bao Nguyen; Eugene Lurie; Shane Eason; Gregory Phillips; Venkatesan Sundaresan
Journal:  PLoS Biol       Date:  2018-02-23       Impact factor: 8.029

9.  Partial rpoB Gene Sequencing Identification and Probiotic Potential of Floricoccus penangensis ML061-4 Isolated from Assam Tea (Camellia sinensis var. assamica).

Authors:  Patthanasak Rungsirivanich; Angkhana Inta; Yingmanee Tragoolpua; Narumol Thongwai
Journal:  Sci Rep       Date:  2019-11-12       Impact factor: 4.379

10.  Streptomyces sp. strain TOR3209: a rhizosphere bacterium promoting growth of tomato by affecting the rhizosphere microbial community.

Authors:  Dong Hu; Shuhong Li; Ying Li; Jieli Peng; Xiaoyan Wei; Jia Ma; Cuimian Zhang; Nan Jia; Entao Wang; Zhanwu Wang
Journal:  Sci Rep       Date:  2020-11-18       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.