Literature DB >> 28582405

Laboratory evaluation of transgenic Populus davidiana×Populus bolleana expressing Cry1Ac + SCK, Cry1Ah3, and Cry9Aa3 genes against gypsy moth and fall webworm.

Liping Ding1, Yajuan Chen1, Xiaoli Wei2, Mi Ni2, Jiewei Zhang1, Hongzhi Wang1, Zhen Zhu2, Jianhua Wei1.   

Abstract

Transgenic poplar lines 'Shanxin' (Populus davidiana×Populus bolleana) were generated via Agrobacterium-mediated transformation. The transgenic lines carried the expression cassettes of Cry1Ac + SCK, Cry1Ah3, and Cry9Aa3, respectively. The expression levels of the exogenous insect resistance genes in the transgenic lines were determined by Q-PCR and Western blot. Leaves of the transgenic lines were used for insect feeding bioassays on first instar larvae of the gypsy moth (Lymantria dispar) and fall webworm (Hyphantria cunea). At 5 d of feeding, the mean mortalities of larvae feeding on Cry1Ac + SCK and Cry1Ah3 transgenic poplars leaves were 97% and 91%, while mortality on Cry9Aa3 transgenic lines was about 49%. All gypsy moth and fall webworm larvae were killed in 7-9 days after feeding on leaves from Cry1Ac + SCK or Cry1Ah3 transgenic poplars, while all the fall webworm larvae were killed in 11 days and about 80% of gypsy moth larvae were dead in 14 days after feeding on those from Cry9Aa3 transgenic lines. It was concluded that the transgenic lines of Cry1Ac + SCK and Cry1Ah3 were highly toxic to larvae of both insect species while lines with Cry9Aa3 had lower toxicity,and H. cunea larvae are more sensitive to the insecticidal proteins compared to L. dispar. Transgenic poplar lines toxic to L. dispar and H. cunea could be used to provide Lepidoptera pest resistance to selected strains of poplar trees.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28582405      PMCID: PMC5459438          DOI: 10.1371/journal.pone.0178754

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Poplars (Populus spp.) are economically important, rapidly growing trees. They are models in research on the genetic engineering of forest trees. Poplar is an important source of raw material for various wood-based products such as timber, pulp and fuel. Commercial plantations of poplars have expanded rapidly in recent years. In China, poplar plantations occupied 7.0 m ha in 2008 [1]. One of the major restrictive factors affecting poplar production is insect damage. Insects can severely reduce tree establishment and growth, and increase mortality. About 0.87 m ha of poplar were affected by defoliating insects and 0.71 m ha by stem borers in China during 2005 [2]. Pests of poplars are mainly lepidopterans and coleopterans [3]. Conventional breeding of Populus species has been very successful but it time consuming, labor intensive, and limited to innerspecies gene transmission. Modern genetic improvement methods, such as genetic modification can help overcome the limitations of conventional breeding techniques [4]. A variety of insect resistance genes, such as Bt (Bacillus thuringiensis) genes, proteinase inhibitor genes, and insect toxin genes, have been used in genetically modified poplar trees for pest control since McCown et al. (1991) first succeeded in stably transforming a Bt gene into poplar [5]. Stable expression of synthetic Bt toxin appears to be the most effective method for reducing damage and minimizing the tree mortality caused by insect pests. The proteins encoded by different Bt genes have specific toxicity to insect species in the orders Lepidoptera, Diptera, and Coleoptera. Two transgenic Lepidoptera-resistant poplar clones have been commercialized in China since 2002. One is Populus nigra containing Cry1AC and the other is transgenic hybrid poplar 741 (P. alba × (P. davidiana × P. simonii × P. tomentosa) containing both Cry1AC and the proteinase inhibitor gene (API) [6, 7]. The two commercialized transgenic poplars have shown significant efficacy in reducing the large-scale damage caused by some key target pests on poplar plantations [8]. The Cry1Ac gene is widely used for the control of Lepidoptera in poplar at present [9]. The experience has shown that the resistance conferred by a single Bt gene has the potential to break down as the target insect pest mutates and adapts to defeat the Bt trait [10]. To cope with the emergence of resistant insect population, there is great interest in finding novel insect-resistant gene with higher toxicity and/or wider spectrum [11]. In this study, we tried to develop new transgenic poplar with new insect genes other than Cry1Ac, in order to cope with the potential resistant insect in the future. There are over hundreds of new Bt genes which were cloned in recent years (see http://www.btnomenclature.info/). Taking into account the intellectual property rights of insect resistant genes, we had to use those genes that we obtain the permission to use, that are two new Bt genes (Cry1Ah3 and Cry9Aa3) and one combination of Cry1Ac and SCK. We acquired three lines of transgenic ‘Shanxin’ poplar (Populus davidiana×Populus bolleana), produced via Agrobacterium-mediated transformation, which contained Cry1Ac + SCK, Cry1Ah3 and Cry9Aa3, respectively. The leaves of transgenic lines with different insect-resistant genes were used for insect feeding trials performed on gypsy moth (Lymantria dispar) and fall webworm (Hyphantria cunea). The insecticidal effects of the foliage from the three transgenic poplars were compared.

Materials and methods

Plant material

The hybrid poplar ‘Shanxin’ (Populus davidiana×Populus bolleana) was used as the starting plant material. Prior to genetic transformation, microcuttings were micropropagated on a modified Murashige and Skoog medium, as described by Wang et al. (2011) [12].

Vectors and Agrobacterium strains

The binary vector pCRPBSCK35SBt, contains a Cry1Ac gene (1848 bp, see GenBank KF630361.1) driven by the cauliflower mosaic virus 35S promoter, and a SCK gene driven by RPB promoter. The binary vector pP1Ah3 contains a Cry1Ah3 gene (2004 bp) driven by the cauliflower mosaic virus 35S promoter. The binary vector pP9Aa3 contains a Cry9Aa3 gene (2043 bp) driven by the cauliflower mosaic virus 35S promoter. Each of the three vectors contains a neomycin phosphotransferase gene (npt II), as a selection marker gene. The vectors used in this paper were provided by the Zhen Zhu lab, at the Institute of Genetics and Development Biology, Chinese Academy of Sciences (CAS). The structures are illustrated in Fig 1.
Fig 1

Frame diagrams of plant transformation vectors.

(A) pCRPBSCK35SBt.(B) pP1Ah3. (C) pP9Aa3. LB: Left border; RB: right border; P35S: the cauliflower mosaic virus (CaMV) 35S promoter; NPT II or KanR: neomycin phosphotransferase II gene; Tnos or Poly A signal: poly-adenylation site of the nopalin synthase gene; MAR: matrix attachment region; Pnos: promoter of the nopalin synthase gene; PRPB: promoter of replication protein of CLCuV (Cotton leaf curl virus).

Frame diagrams of plant transformation vectors.

(A) pCRPBSCK35SBt.(B) pP1Ah3. (C) pP9Aa3. LB: Left border; RB: right border; P35S: the cauliflower mosaic virus (CaMV) 35S promoter; NPT II or KanR: neomycin phosphotransferase II gene; Tnos or Poly A signal: poly-adenylation site of the nopalin synthase gene; MAR: matrix attachment region; Pnos: promoter of the nopalin synthase gene; PRPB: promoter of replication protein of CLCuV (Cotton leaf curl virus).

Agrobacterium-mediated transformation of poplar clones

The transformation of poplar clones was performed using the protocol reported by Wang et al. (2011) [12]. After regeneration and multiplication, the plantlets were acclimatized in a growth chamber before being transferred to a greenhouse.

Plant genomic DNA isolation and PCR analysis

Genomic DNA was isolated from leaves (0.5 g) of transgenic and control plants using Plant DNA Isolation Reagent (TaKaRa). PCR analysis for the detection of the Cry1Ac, SCK, Cry1Ah3 and Cry9Aa3 was carried out using specific primer pairs as shown in Table 1. The PCR reactions were carried out in a total volume of 25 μl comprising 50 ng genomic DNA, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 200 μM dNTPs, 1.25 units of Taq DNA polymerase, and 25 pmol of each primer. For PCR analysis, DNA was denatured at 94°C for 5 min followed by 30 cycles of amplification (94°C for 30 s. 56°C for 30 s, 72°C for 1 min) with final extension at 72°C for 10 min.
Table 1

Primers for PCR and Q-PCR.

NamePrimer (5’- 3’)Fragment lengthAnnealing temperature
Cry1Ac-FGCATTCCATACAACTGCTTG1146bp56°C
Cry1Ac-RTTCCATAGGCGAACTCTGTT
Cry1Ac-qPCR-FCGCCTATGGAACCTCTTCTAAC102bp56°C
Cry1Ac-qPCR-RGGTGGCACATTGTTGTTCTG
SCK-FGCACCATCTTCTTTGCTCTC384bp57°C
SCK-RCATCTTCATCCCTGGACTTG
SCK-qPCR-F:AGCACCATCTTCTTTGCTCTC100bp54°C
SCK-qPCR-RGTACCAGCACACACACCTTTA
Cry1Ah3-FTGGCTAAGAACAGCATCAAGC1432bp54°C
Cry1Ah3-RGTGAATCCAGGAGAACATCGG
Cry1Ah3-qPCR-FATCAGCACCTACACCGACTA102bp56°C
Cry1Ah3-qPCR-RCCTGAACTGGTTGTACCTCAC
Cry9Aa3-FGGCTAAGTATCCTCTCGCTAACAA1025bp54°C
Cry9Aa3-RGATGGTGAAACAGGCAAAGTCA
Cry9Aa3-qPCR-FCTATCCCAAATCCTAGGCCATC108bp56°C
Cry9Aa3-qPCR-RCATACCAAACCCTAGCCCTATC

RT-qPCR assay

Three plants of each transgenic line and controls from 3-month-old seedlings in the greenhouse were selected randomly, and the fully expanded upper leaves of the seedling were collected, immediately put into liquid nitrogen, and transported to the laboratory. Total RNA was extracted from 100 mg of leaves using the RNeasy extraction kit (Qiagen, Germany). cDNA was synthesized using 5 μl of total RNA (500 ng) according to the Omniscript RT kit protocol (Qiagen) as described by the manufacturer and it was subsequently used as target for the qPCR reaction. According to the full sequence data of the targeted genes, fluorescence quantitative PCR primers were designed as shown in Table 1. With the previous reverse transcript cDNA as the template, 2 × Sybr Green qPCR Mix was used for fluorescence quantitative PCR. According to the cycle amounts that the fluorescent signal of each PCR reaction tube reaches in the designed threshold (CT value) and the standard curve developed with the use of standards that have a known expression amount, the abundance of the each Bt gene in the synthesized cDNA, with mRNA as transcription, was calculated from the standard curve [13].

Western blot assay

Soluble proteins were extracted from fresh mature green leaves of 3-month-old transgenics and wild type plants in 200 mM Tris-HCl pH8.0 with 0.2% insoluble polyvinylpyrrolidone at 4°C. Approximately 40 ug of total protein from individual lines was separated on SDS-PAGE and blotted. Electrotransfer on a polyvinylidene difluoride (PVDF) membrane (Immobilon, Millipore) was performed using the mini protean-II apparatus (Bio Rad, USA). A purified anti-beta actin antibody (ab129348) was used as standard. Polyclonal rabbit anti-Cry1Ac antiserum (ABCAM, ab51586) was used as the primary antibodies for Cry1Ac expression, monoclonal rabbit anti-Cry1Ah3 antiserum (provided by the Institute of Genetics and Development Biology, CAS) was used for Cry1Ah3, and polyclonal rabbit anti-Cry9Aa3 antiserum (provided by the Institute of Genetics and Development Biology, CAS) was used for Cry9Aa3. Detection was performed with a chemiluminescent western blotting kit (Roche, USA), using secondary antibodies conjugated to a phosphatase. Due to lack of availability anti-SCK antibody, Western blot assay of SCK was not conducted.

Insect bioassay testing

We conducted insect bioassays to observe the responses of L. dispar and H. cunea larvae to leaves of transgenic and control poplars. The first instar larvae of L. dispar and H. cunea were provided by Research Institute of Forest Ecology, Environmental and Protection, Chinese Academy of Forestry (CAF). The spawns were collected in the nursery in Chinese Academy of Forestry. The newly hatched instar larvae of L. dispar and H. cunea were directly provided for us to conduct the feeding experiment. The fresh leaves of the about 3-month-old seedlings of the transgenic lines and controls were collected from the greenhouse. They were handpicked, washed with distilled water, and kept on moist filter paper in Petri dishes. A total of 30 first instar larvae were transferred to each Petri dish. The plates were held at 25±2°C under a 14-h light 10-hr dark photoperiod. The fresh leaves were added into each plate every 2 days. The insect mortality was checked at several times after feeding. The test for each transgenic line was repeated three times.

Statistical analysis

Excel was used to store and process the experimental data. SPSS version 13.0 was used for multiple comparisons.

Results

PCR detection of transgenic plants

The Agrobacterium-mediated transformation method produced some kanamycin resistant lines from independent transformation events of all the three plasmids. The specific primers were adopted to PCR amplification of the target gene in each of transgenic lines. Plasmid was used as positive controls, while DNA extracted from untransformed plants was used as a negative control. The PCR amplification results (Fig 2) showed that 12 lines of plasmid pCRPBSCK35SBt were obtained and named as the A series; 5 transgenic lines of pP1Ah3 were obtained and named the B series (B1 to B5); 5 transgenic lines of plasmid pP9Aa3 were obtained and named the C series (C1 to C5). The PCR assay verified that the target genes were integrated into the poplar genome.
Fig 2

PCR detection of transgenic poplar.

(A) and (B) PCR analysis for the presence of the Cry1Ac and SCK gene in transgenic plants. (C) PCR analysis for the presence of the Cry1Ah3 gene in transgenic plants. (D) PCR analysis for the presence of the Cry9Aa3 gene in transgenic plants. M: DNA fragments size marker (Trans5K); P: plasmid (positive control); N: wild type plants (negative control). The arrows indicate the expected PCR products.

PCR detection of transgenic poplar.

(A) and (B) PCR analysis for the presence of the Cry1Ac and SCK gene in transgenic plants. (C) PCR analysis for the presence of the Cry1Ah3 gene in transgenic plants. (D) PCR analysis for the presence of the Cry9Aa3 gene in transgenic plants. M: DNA fragments size marker (Trans5K); P: plasmid (positive control); N: wild type plants (negative control). The arrows indicate the expected PCR products.

Qualitative PCR detections of transgenic lines

The expression of Cry1Ac, Cry1Ah3 and Cry9Aa3 were verified at the RNA level by RT-qPCR. RNA samples were isolated from the green leaves of transgenic lines. No amplification signal was observed in the controls (untransformed plants). According to the detected CT value, the computed starting transcription abundance of the Bt gene in the samples (every 100 mg of fresh leaves) is listed in Table 2. It shows that the transcription abundance of Cry1Ac ranged from 6.02×104 in line A15 to 8.27×106 in A4; abundance of Cry1Ah3 ranged from 5.95×105 in line B5 to 3.66×106 in B3; and abundance of Cry9Aa3 ranged from 7.17×105 in C4 to 2.18×106 in C1. Statistical analysis shows that significant differences existed in the transcription abundances of the Bt genes among the different transgenic lines with the same vector.
Table 2

Transcript abundance of the Cry1Ac, SCK, Cry1Ah3 and Cry9Aa3 genes detected by qRT-PCR.

LineTranscript abundance of the Cry1Ac geneTranscript abundance of the SCK geneLineTranscript abundance of the Cry1Ah3 geneLineTranscript abundance of the Cry9Aa3 gene
CK0.000.00CK0.00aCK0.00a
A17.94×1054.65×105B11.73×106C12.18×106
A21.80×1061.22×105B22.38×106C21.34×106
A32.40×1061.91×105B33.66×106C31.66×106
A48.27×1063.41×104B47.67×105C47.17×105
A61.85×1066.99×104B55.95×105C57.24×105
A71.73×1064.01×104
A98.91×1051.45×104
A106.99×1054.04×104
A121.70×1063.29×104
A156.02×1046.02×104
A235.77×1051.17×104
A243.58×1067.67×104

CK means control, which is wild type of poplar.

CK means control, which is wild type of poplar.

Western blot assay of Bt proteins in the transgenic lines

A total of 12 transgenic lines containing Cry1Ac + SCK, 5 lines containing Cry1Ah3, and 5 lines containing Cry9Aa3 were analyzed by Western blot assay to examine the protein expression level of Cry1Ac, Cry1Ah3 and Cry9Aa3 in the different lines. One well-defined band was detected at about 70 kDa in all test lines, which was consistent with the predicted molecular weight values from the DNA sequences of the corresponding Cry1Ac, Cry1Ah3 and Cry9Aa3 genes, respectively. Different transgenic lines had variable levels of target protein expression (Fig 3). Within the same transgenic line series, the target Bt protein expression levels is approximately consistent with the transcription abundance detected by qualitative PCR in exact lines. For example, in line series A, the line A4 had the strongest signal in the Western blot assay (Fig 3A) and the highest transcription abundance in the Q-PCR assay (Table 2). Line A15 had a relatively weaker signal in the Western blot assay (Fig 3A) and low transcription abundance (Table 2). The signals of Cry9Aa3 were all much weaker than those of Cry1Ac or Cry1Ah3, which may have resulted from the weak sensitivity of anti-Cry9Aa3 antibody.
Fig 3

Western blot assay of Bt proteins in the transgenic lines.

(A) Western blot assay for the expression of Cry1Ac. (B) Western blot assays for the expression of Cry1Ah3. (C) Western blot assays for the expression of Cry9Aa3,. The arrows indicate the expected protein products (70kD). CK means control, which is wild type of poplar.

Western blot assay of Bt proteins in the transgenic lines.

(A) Western blot assay for the expression of Cry1Ac. (B) Western blot assays for the expression of Cry1Ah3. (C) Western blot assays for the expression of Cry9Aa3,. The arrows indicate the expected protein products (70kD). CK means control, which is wild type of poplar.

Insect feeding experiment of transgenic lines

Three transgenic lines transformed with different protein, which showed relatively high expression levels of target genes, were selected for the insect feeding experiment. A total of 30 first instar larvae of L. dispar or H. cunea were fed on the leaves of twelve independently derived transgenic lines (A3, A4, A24, B1, B2, B3, C1, C2 and C3) with leaves from non-transgenic poplar plants as controls. In the L. dispar feeding experiment, mortality after 3 d, 4 d, 5 d, 7 d, 9 d, 11 d, 13 d and 15 d of feeding is shown in Table 3. There was a significant difference in the larval mortalities among the three transgenic lines and the control. At 5 d of feeding the mean mortalities of larvae feeding on series A and B leaves were 97% and 91%, respectively, while mortality on series C was about 49%. At 7 d of feeding, all the larvae feeding on the leaves of series A and B were dead except those on B2 leaves (the mortality is about 95%), while 54% of larvae on leaves of series C were dead. The effects of different insecticidal proteins on gypsy moth larvae were showed in Fig 4 at 7 d. The mean mortalities on series A at 5 d and 7 d were somewhat higher than those on series B, the difference was not significant. Series A and B, representing Cry1Ac + SCK and Cry1Ah3, have similar high toxicity against L. dispar larvae. There was 80% mortality of L. dispar larvae on the series C leaves at 15 d while the control mortality was 45%. Series C (Cry9Aa3) lines were relatively less toxic to L. dispar larvae.
Table 3

Mortalities (%) of gypsy moth larvae fed with leaves of three different transgenic lines.

LinesTotal mortality (%) on days after feeding
3rd day4th day5th day7th day9th day11th day13th day15th day
Line meanTreatment meanLine meanTreatment meanLine meanTreatment meanLine meanTreatment meanLine meanTreatment meanLine meanTreatment meanLine meanTreatment meanLine meanTreatment mean
CK0.0±0.0a0.0±0.05.6±1.9a5.6±1.96.7±0.0a6.7±0.07.8±1.9a7.8±1.914.4±1.9a14.4±1.926.7±5.1a26.7±5.138.9±6.7a38.9±6.744.5±6.9a44.5±6.9
A324.4±5.1d23.7±4.755.6±6.9de58.2±4.697.8±1.9e97.4±1.3100.0±0.0e100.0±0.0100.0±0.0d100.0±0.0100.0±0.0d100.0±0.0100.0±0.0c100.0±0.0100.0±0.0c100.0±0.0
A425.6±3.9d57.8±5.1def94.4±1.9e100.0±0.0e100.0±0.0d100.0±0.0d100.0±0.0c100.0±0.0c
A2421.1±5.1d61.1±1.9ef100.0±0.0e100.0±0.0e100.0±0.0d100.0±0.0d100.0±0.0c100.0±0.0c
B13.3±0.0ab7.0±1.767.8±5.8f64.8±6.296.7±3.3e91.1±5.1100.0±0.0e96.3±2.3100.0±0.0d98.1±1.7100.0±0.0d100.0±0.0100.0±0.0c100.0±0.0100.0±0.0c100.0±0.0
B24.4±1.9ab57.8±5.1def80.0±8.8d88.9±6.9d94.4±5.1d100.0±0.0d100.0±0.0c100.0±0.0c
B313.3±3.3c68.9±7.7f96.7±3.3e100.0±0.0e100.0±0.0d100.0±0.0d100.0±0.0c100.0±0.0c
C18.9±1.9bc3.7±0.647.8±1.9cd41.1±3.053.3±0.0c48.9±3.064.4±9.2c54.4±7.071.1±3.9c60.8±7.072.2±1.9c66.7±2.477.8±1.9b74.5±3.681.1±1.9b80.0±4.1
C22.2±0.0a36.7±3.3b43.3±3.3b46.7±6.7b55.6±10.1b67.8±1.9c76.7±5.1b80.0±1.9b
C30.0±0.0a38.9±3.9bc50.0±5.8bc52.2±5.1b55.6±6.9b60.0±3.3b68.9±3.9b78.9±8.4b

The statistical analysis was conducted following the ANOVA. Fisher’s least square difference (LSD) test was used to compare the means. Within each column, means with the same lowercase letter are not significantly different (P = 0.05). CK means control, which is wild type of poplar.

Fig 4

Poplar leaf bioassay against gypsy moth larvae after 7 d of feeding.

(A) A3 (Cry1Ac and SCK). (B) B1 (Cry1Ah3). (C) C1 (Cry9Aa3). (D) wild type as control.

Poplar leaf bioassay against gypsy moth larvae after 7 d of feeding.

(A) A3 (Cry1Ac and SCK). (B) B1 (Cry1Ah3). (C) C1 (Cry9Aa3). (D) wild type as control. The statistical analysis was conducted following the ANOVA. Fisher’s least square difference (LSD) test was used to compare the means. Within each column, means with the same lowercase letter are not significantly different (P = 0.05). CK means control, which is wild type of poplar. In the H. cunea larvae feeding experiment, mortality at 3 d, 4 d, 5 d, 7 d, 9 d and 11 d of the feeding trial is shown in Table 4. Similar to the L. dispar results, the transgenic lines with Cry1Ac + SCK and Cry1Ah3 were highly toxic to H. cunea, while the Cry9Aa3 lines showed relatively lower toxicity.
Table 4

Mortalities (%) of fall webworm larvae fed with leaves of three different transgenic lines.

LinesTotal mortality (%) on days after feeding
3rd day4th day5th day7th day9th day11th day
Line meanTreatment meanLine meanTreatment meanLine meanTreatment meanLine meanTreatment meanLine meanTreatment meanLine meanTreatment mean
CK0.0±0.0a0.0±0.014.4±3.9a14.4±3.920.0±0.0a20.0±0.020.0±0.0a20.0±0.022.2±3.9a22.2±3.936.7±3.3a36.7±3.3
A343.3±3.3efg47.8±3.491.1±5.8e91.1±7.0100.0±0.0d100.0±0.0100.0±0.0d100.0±0.0100.0±0.0b100.0±0.0100.0±0.0b100.0±0.0
A453.3±5.1g93.3±8.4e100.0±0.0d100.0±0.0d100.0±0.0b100.0±0.0b
A2446.7±1.9fg88.9±6.9de100.0±0.0d100.0±0.0d100.0±0.0b100.0±0.0b
B134.4±7.7cde35.9±5.482.2±6.9de71.9±7.096.7±5.8d97.0±3.6100.0±0.0d100.0±0.0100.0±0.0b100.0±0.0100.0±0.0b100.0±0.0
B235.6±5.1def76.7±8.4d100.0±0.0d100.0±0.0d100.0±0.0b100.0±0.0b
B337.8±3.3def56.7±5.8c94.4±5.1d100.0±0.0d100.0±0.0b100.0±0.0b
C126.7±3.8bcd21.9±2.536.7±1.9b27.8±3.256.7±3.3c45.2±4.592.2±8.4d82.9±6.396.7±5.8b96.7±5.3100.0±0.0b100.0±0.0
C215.6±1.9b23.3±5.8a35.6±1.9b72.2±3.9b100.0±0.0b100.0±0.0b
C323.3±1.9bc23.3±1.9a43.3±8.4b84.4±6.7c93.3±10.2b100.0±0.0b

The statistical analysis was conducted following the ANOVA, Fisher’s least square difference (LSD) test was used to compare the means. Within each column, means with the same lowercase letter are not significantly different (P = 0.05). CK means control, which is wild type of poplar.

The statistical analysis was conducted following the ANOVA, Fisher’s least square difference (LSD) test was used to compare the means. Within each column, means with the same lowercase letter are not significantly different (P = 0.05). CK means control, which is wild type of poplar. Comparison of Table 3 and Table 4 data shows that H. cunea larvae are more sensitive to all of the insecticidal proteins compared to L. dispar. Mortalities of H. cunea larvae reached 100% sooner than those of L. dispar on both series A and B. About 20% of the L. dispar larvae survived 15 d on series C, while all H. cunea larvae on series C were dead at 11 d.

Discussion

In order to provide new insect resistant genes forLepidoptera control, the toxicity of two new Bt proteins, Cry9Aa3 and Cry1Ah3, and combination of Cry1Ac and SCK to Lepidoptera was determined in transgenic poplars. Both Cry9Aa3 and Cry1Ah3 were cloned in 2010 (see http://www.btnomenclature.info/). It was reported that Cry9Aa3 had high insecticidal activity against Plutella xylostella and Ostrinia furnacalis [14]. There are no published reports on the insecticidal activities of the Cry1Ah3 protein. CpTI (Cowpea Trypsin Inhibitor) is one alternative to Bt genes and was reported to be toxic to the forest tent caterpillar (Malacosoma disstria), gypsy moth (L. dispar) and willow moth (Stilpnotia candida) [15]. SCK is derived from CpTI, which was fused with the signal peptide sequences and endoplasmic reticulum location sequences at 5' end and 3' end of CpTI[16]. SCK combined with Cry1Ac conferred high insect resistance in transgenic rice and cotton[16]. There are no reports on application of Cry9Aa3, Cry1Ah3 and Cry1Ac +SCK to provide insect resistance to transgenic poplar. To cope with possible emergence of resistant Lepidoptera resulted from application of single Cry1Ac gene, new insect-resistant genes or stacking of different genes are considered to be one of solutions. We compared the toxicity of Cry9Aa3, Cry1Ah3 and Cry1Ac + SCK in transgenic poplar against L. dispar and H. cunea using feeding assays. The results showed that transgenic poplars with Cry1Ac + SCK or Cry1Ah3 have similar high resistance to larvae, while those with Cry9Aa3 have weaker resistance. All L. dispar and H.cunea larvae were killed in 7–9 d after feeding on leaves from Cry1Ac + SCK or Cry1Ah3 transgenic poplars. Our results indicate that Cry1Ah3 and Cry1Ac + SCK could be used as new insect-resistant genes to provide poplar with high resistance against major lepidopteran pests. H. cunea larvae were more sensitive, in this study, to insect-resistant proteins than larvae of L. dispar. Similar results were reported by Gao et al. (2004), who found H. cunea larvae were more sensitive than L. dispar to transgenic poplar ‘741’ carrying Cry1Ac and API (arrowhead proteinase inhibitor) [17]. L. dispar is a key lepidopteran pest damaging forests in many countries [18]. H. cunea is a worldwide quarantine pest. These two species cause serious economic losses and environmental harm. Poplar ‘Shanxin’ (Populus davidiana×Populus bolleana) is a major plantation species of poplar in Northeast China. The transgenic poplars ‘Shanxin’ with high resistance against both L. dispar and H. cunea could be used in future for protection against Lepidoptera feeding damage.
  7 in total

Review 1.  Application of pyramided traits against Lepidoptera in insect resistance management for Bt crops.

Authors:  Nicholas P Storer; Gary D Thompson; Graham P Head
Journal:  GM Crops Food       Date:  2012-07-01       Impact factor: 3.074

2.  Cloning, characterization and diversity of insecticidal crystal protein genes of bacillus thuringiensis native isolates from soils of Andaman and Nicobar Islands.

Authors:  H M Mahadeva Swamy; R Asokan; S N Nagesha; D K Arora; Ajantha Birah; Riaz Mahmood
Journal:  Curr Microbiol       Date:  2011-08-21       Impact factor: 2.188

3.  Laboratory and field evaluation of the transgenic Populus alba × Populus glandulosa expressing double coleopteran-resistance genes.

Authors:  Bingyu Zhang; Min Chen; Xiaofen Zhang; Hehui Luan; Shu Diao; Yingchuan Tian; Xiaohua Su
Journal:  Tree Physiol       Date:  2011-05-10       Impact factor: 4.196

4.  An efficient Agrobacterium-mediated transformation and regeneration system for leaf explants of two elite aspen hybrid clones Populus alba × P. berolinensis and Populus davidiana × P. bolleana.

Authors:  Haihai Wang; Cuiting Wang; Hua Liu; Renjie Tang; Hongxia Zhang
Journal:  Plant Cell Rep       Date:  2011-06-30       Impact factor: 4.570

5.  Genetic transformation and expression of transgenic lines of Populus x euramericana with insect-resistance and salt-tolerance genes.

Authors:  R L Yang; A X Wang; J Zhang; Y Dong; M S Yang; J M Wang
Journal:  Genet Mol Res       Date:  2016-04-29

6.  Stable transformation of Populus and incorporation of pest resistance by electric discharge particle acceleration.

Authors:  B H McCown; D E McCabe; D R Russell; D J Robison; K A Barton; K F Raffa
Journal:  Plant Cell Rep       Date:  1991-02       Impact factor: 4.570

7.  Response of the gypsy moth, Lymantria dispar to transgenic poplar, Populus simonii x P. nigra, expressing fusion protein gene of the spider insecticidal peptide and Bt-toxin C-peptide.

Authors:  Chuan-Wang Cao; Gui-Feng Liu; Zhi-Ying Wang; Shan-Chun Yan; Ling Ma; Chuan-Ping Yang
Journal:  J Insect Sci       Date:  2010       Impact factor: 1.857

  7 in total
  2 in total

1.  Analyzing the phylogeny of poplars based on molecular data.

Authors:  An-Pei Zhou; Dan Zong; Pei-Hua Gan; Xin-Lian Zou; Yao Zhang; Li Dan; Cheng-Zhong He
Journal:  PLoS One       Date:  2018-11-09       Impact factor: 3.240

Review 2.  Advances and Perspectives of Transgenic Technology and Biotechnological Application in Forest Trees.

Authors:  Yiyi Yin; Chun Wang; Dandan Xiao; Yanting Liang; Yanwei Wang
Journal:  Front Plant Sci       Date:  2021-11-30       Impact factor: 5.753

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.