The cytoprotective effects of Δ-17 fatty acid desaturase on injured HUVECs and its underlying mechanism.

Endothelium toxicity has been involved in early endothelial dysfunction to show the pathogenesis of multiple cardiovascular disease that shows atherosclerosis and its complications. Saturated free fatty acids are the main inducing factors of endothelial cell apoptosis and inflammatory cytokines. In humans, stearoyl-CoA desaturase 1 (SCD-1) is a restriction step to saturation to unsaturated fatty acid desaturation, which plays a beneficial role protecting endothelial cells against lipotoxicity. Δ-17 fatty acid desaturase (FAD) is a newly identified FAD which shares 55% identity at the amino acid level with SCD-1. Whether Δ-17 FAD has similar beneficial effect remains poorly understood. Oxidized low density lipoprotein (ox-LDL) was used to induce lipotoxicity in human umbilical vein endothelial cells (HUVECs) to establish a model of oxidative injury. Then HUVECs were transfected with FAD lentivirus to introduce cytoprotective effects. The alterations in cell proliferation and apoptosis, nitric oxide content, malonyldialdehyde (MDA) content, SOD enzyme content, LDH content, GSH-PX level, vascular growth factor (VEGF) expression were evaluated. Studies showed that ox-LDL-induced excess HUVEC apoptosis can be abrogated by upregulation of Δ-17 FAD. The nitric oxide content, GSH-PX content, and SOD enzyme content were increased and the activity of MDA was suppressed by upregulation of Δ-17 FAD. In addition, upregulation of Δ-17 FAD significantly increased VEGF expression. In vitro tube formation assay showed that Δ-17 FAD promoted angiogenesis to a significant degree. These results suggest that Δ-17 fatty acid desaturase may have beneficial action in the prevention of ox-LDL-induced cellular damage.

Introduction

Atherosclerosis is one of the most frequent and common cardiovascular diseases. Endothelial dysfunction participates in the initiation and development of atherosclerosis. Endothelial dysfunction identified by endothelium-dependent vasodilatation is considered to be an early functional stage of atherosclerosis, accompanied by vascular inflammation, changes in vascular wall morphology (Balletshofer et al., 2000), and predictable cardiovascular events (Gokce et al., 2002). The oxidized low density lipoprotein (ox-LDL) can cause significant endothelial dysfunction resulting in macrophages, fibroblasts, and monocytes adhere to the endothelium and migrate into the endothelium (Tao et al., 2016, Di Pietro et al., 2016, Trpkovic et al., 2015). The migrated cells formed a large number of lipid-laden foam cells, eventually resulting in atherosclerotic plaques (Liu et al., 2016, Rafieian-Kopaei et al., 2014).

Therefore, in order to prevent atherosclerosis, it is critical to protect endothelial cells against dysfunctions and damages induced by ox-LDL. Saturated free fatty acids are the main inducing factors of endothelial cell apoptosis and inflammatory cytokines (Katrin et al., 2006). In humans, stearoyl-CoA desaturase 1 (SCD-1) is a restriction step to saturation to monounsaturated fatty acid desaturation, which plays a beneficial role protecting endothelial cells against lipotoxicity (Andreas et al., 2008). Δ-17 fatty acid desaturase (FAD) is a newly identified FAD which shares 55% identity at the amino acid level with SCD-1 (Chen et al., 2016, Xue et al., 2013). Whether Δ-17 FAD has similar beneficial effect remains poorly understood. Therefore, we hypothesized that Δ-17 FAD abrogates ox-LDL induced HUVEC apoptosis, thereby promoting HUVEC proliferation and protecting endothelial cells against lipotoxicity.

Materials and methods

Reagents

HUVEC (ATCC, Manassas, VA, USA); △-17 FAD, arachidonic acid, and ox-LDL (Sigma-Aldrich, St. Louis, MO); VEGF antibody (R&D Systems, Minneapolis, MN).

Grouping

The experiment was divided into seven groups. A, B, C, D, E, F, and G groups were the blank control group, the negative control group, the overexpression group (lentivirus transfected), the ox-LDL group, the negative + ox-LDL group, the overexpression + arachidonic acid + ox-LDL group, and the overexpression + arachidonic acid group respectively. To assess the appropriate concentration of ox-LDL, we treated the cells for 24 h with different concentrations of ox-LDL (20, 40, 60, 80 and 100 μg/mL). Ox-LDL reduced cell viability in a dose-dependent manner. When ox-LDL was 80 μg/mL, the cell viability decreased to 53.32% ± 5.97% (data not shown). Thus, 80 μg/mL ox-LDL concentration was selected for subsequent experiments.

△-17 FAD codon optimization

Δ-17 FAD gene sequences has been retrieved from NCBI (FW362214.1) as follows.

5-ATGGCGACTAAGCAGCCGTACCAGTTCCCGACCCTGACGGAGATCAAGCGGTCGCTGCCCAGCGAGTGCTTTGAGGCCTCGGTGCCGCTGTCGCTCTACTACACGGTGCGCATCGTGGCCATCGCCGTGGCGCTGGCGTTCGGCCTCAACTACGCGCGCGCGCTGCCCGTGGTCGAGAGCTTGTGGGCGCTGGACGCTGCGCTCTGCTGCGGTTACGTGCTGCTGCAGGGCATCGTGTTCTGGGGCTTCTTCACGGTGGGCCATGACGCCGGCCACGGCGCCTTCTCGCGTTACCACCTGCTCAACTTCGTGGTGGGCACCTTCATCCACTCGCTCATCCTCACGCCCTTCGAGTCGTGGAAGCTCACGCACCGCCACCACCACAAGAACACGGGCAACATTGACCGCGACGAGATCTTCTACCCGCAGCGCAAGGCCGACGACCACCCGCTGTCGCGCAACCTCGTGCTGGCGCTCGGCGCCGCGTGGTTCGCCTACCTGGTCGAGGGCTTCCCGCCCCGCAAGGTCAACCACTTCAACCCATTCGAGCCGCTGTTTGTGCGCCAGGTGGCCGCCGTCGTCATCTCGCTCTCCGCGCACTTCGCCGTGTTGGCGCTGTCCGTGTATCTGAGCTTCCAGTTCGGTCTCAAGACCATGGCGCTCTACTACTACGGCCCCGTCTTCGTGTTCGGCAGCATGCTTGTGATCACCACCTTCCTGCATCACAATGACGAGGAGACCCCATGGTACGGAGACTCCGACTGGACCTACGTCAAGGGCAACCTGTCGTCCGTGGACCGGTCCTACGGCGCGTTCATCGACAACCTGAGCCACAACATCGGCACGCACCAGATCCACCACCTCTTCCCCATCATCCCGCACTACAAGCTCAACCGCGCTACGGCGGCATTCCACCAGGCCTTCCCCGAGCTCGTGCGCAAGAGCGACGAGCCGATCCTCAAGGCCTTCTGGCGCGTCGGCCGACTGTACGCCAACTACGGCGTCGTGGACCCGGACGCCAAGCTCTTCACGCTCAAGGAGGCCAAGGCGGCGTCCGAGGCGGCGACCAAGACCAAGGCCACCTAA-3′.

Gene sequence optimization based on mammalian codon.

5-ATGGCCACCAAGCAGCCTTACCAGTTCCCCACCCTGACCGAGATCAAGAGGAGCCTGCCAAGCGAGTGCTTTGAGGCTAGCGTGCCTCTGAGCCTGTACTACACCGTGCGGATCGTGGCTATCGCAGTGGCCCTGGCCTTTGGCCTGAATTACGCCAGAGCCCTGCCAGTGGTGGAAAGTCTGTGGGCTCTGGATGCCGCTCTGTGTTGTGGCTACGTGCTCCTGCAGGGCATCGTGTTTTGGGGCTTCTTTACAGTGGGCCACGACGCAGGACACGGAGCCTTCAGCAGATACCACCTGCTCAACTTCGTCGTGGGCACCTTCATCCACAGCCTGATCCTGACCCCCTTCGAGTCTTGGAAGCTGACCCACAGGCACCACCACAAGAACACCGGCAACATCGACCGGGACGAGATCTTCTACCCCCAGAGAAAGGCCGACGATCACCCTCTGAGCAGGAATCTGGTGCTGGCTCTGGGAGCCGCTTGGTTTGCCTATCTGGTGGAGGGATTCCCCCCCAGGAAGGTCAACCACTTCAACCCCTTCGAGCCTCTGTTCGTGAGACAGGTGGCCGCAGTCGTGATCTCTCTGAGCGCTCATTTCGCAGTGCTGGCTCTGAGCGTGTACCTGAGCTTCCAGTTCGGCCTGAAGACCATGGCCCTGTACTACTACGGCCCCGTGTTCGTGTTCGGCAGCATGCTGGTCATCACCACCTTCCTGCACCACAACGACGAGGAGACCCCTTGGTACGGAGACAGCGATTGGACCTACGTGAAGGGCAACCTGAGCAGCGTGGACAGAAGCTACGGCGCCTTCATCGACAACCTGAGCCACAACATCGGCACCCACCAGATCCACCACCTGTTTCCTATCATCCCCCACTACAAGCTGAACCGGGCCACAGCCGCTTTTCACCAGGCCTTTCCCGAGCTCGTGAGAAAGAGCGACGAGCCCATCCTGAAGGCCTTTTGGCGAGTGGGACGGCTGTACGCTAACTACGGAGTGGTGGATCCAGACGCCAAGCTGTTCACCCTGAAGGAGGCTAAGGCCGCCAGCGAAGCCGCCACAAAAACAAAGGCCACATAA-3′.

Lentiviral packaging

Lentiviral vector constructs are shown in Table 1.

Table 1

Lentiviral vector construction.

Vector name	pLV[Exp]-EGFP/Neo-EF1A>ORF_1086bp
Size	10,592 bp
Vector type	Lentivirus gene expression vector(3rd generation
Inserted promoter	EF1A
Inserted ORF	ORF_1086bp(Alias:DELTA-17 FAD)
Inserted marker	EGFP/Neo
Copy number	High
Bacterial resistance	Ampicillin
Cloning host	Stbl3

Lentiviral vector map are as follows.

HUVEC cell line culture

HUVEC cells were retrieved from the liquid nitrogen tank and were quickly put into 37 °C water bath to thaw. After 1–2 min, the liquids in the vials were completely dissolved. The vials were transferred to the clean bench. After being centrifuged at 1200 rpm/min for 5 min, aspirating the supernatant was aspirated and removed. 10 ml RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) was added to the centrifuge tube to make cell suspension. The cell suspension was put into the cell culture flasks in the 37 °C and 5% CO2 incubator. Subcultures from passages 2–5 were selected for experimental use.

HUVEC cells infected with lentivirus

HUVEC was inoculated at a concentration of 1 × 105 cells in a 6-well plate overnight after incubation and then infected with 20% of the infection multiple (MOI) in the presence of polybrene (5 μg/ml) for 10 h. Infected cells were incubated with 10% FBS medium for 48 h. After 48 h of incubation, the cells were treated for further analysis.

Real-time PCR detection of lentivirus infection efficiency

Total RNA was extracted from HUVEC using guanidine regimen. The extracted RNA was treated with DNase (without RNase) to remove DNA contaminants. The RNA was quantified by measuring the absorbance at 260 nm and the mass was checked by agarose gel electrophoresis. Reverse transcription of 4 μg of RNA was carried out using oligo dT primer using a volume of 20 ml using M-MLV reverse transcriptase (MBI Fermentas). Primers were designed to amplify the FAD gene and the GAPDH gene was used as an internal standard (Table 2). Three samples were repeated for real-time RT-PCR. The PCR reaction system (20 μL) consisted of 10.5 μL of ddH 2, 0.5 μL of Taq, 2 μL of buffer, 2 μL of 2.5 mmol/L dNTP and 2 μL of forward and reverse primer (10 μmol) and 1 μL of template, respectively. The cycle parameters were 94 °C for 5 min and then 30 cycles, 94 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, and 72 °C for 10 min for 30 cycles. The expression of RACK1 and GAPDH is quantified according to the value of the standard curve (Ct).

Table 2

Primers used in Real-time PCR.

Primer	Name	Sequence
P1	FAD (forward primer)	5′-ACCAGTTCCCGACCCTGAC-3′
P2	FAD (reverse primer)	5′-TGCCCACCACGAAGTTGA-3′
P3	GAPDH (forward primer)	5′-GCACCGTCAAGGCTGAGAAC-3′
P4	GAPDH (reverse primer)	5′-TGGTGAAGACGCCAGTGGA-3′

Cell proliferation assay

The passaged HUVECs suspension was centrifuged at 1200 rpm/min for 10 min, the supernatant was discarded and the sample was washed twice with balanced salt solution. Following counting, the cell density was adjusted to 1 × 105/ml. The cells were seeded in a 96-well plate, diluted 1:40 in the drug-containing serum with culture medium, and 0.1 ml was added into each well, with 3 compound wells for each group. The samples were placed in the 5% CO2 cell incubator at 37 °C for 48 h, and the MTT solution was added prior to reading the colorimetric absorbance of each well, at wavelength of 490 nm.

Cell apoptosis assay with flow cytometry

In order to detect the early stages of apoptosis, the Annexin-VFLUOS staining kit (Roche) was used according to the manufacturer's instructions. Briefly, HUVEC was washed with PBS and incubated with annexin-V/propidium iodide (PI)/Hoechst 33342 at room temperature for 15 min. Apoptosis was assessed by flow cytometry (BD), Annexin-V positive and PI-negative cells were assessed. The percentage of apoptotic cells was calculated by dividing the annexin-V positive cells by the total number of cells displayed by Hoechst staining.

Enzyme-linked immunosorbent assay (ELISA)

The NO, MDA, SOD, GSH-PX, and LDH levels were measured using ELISA kits (Beyotime Institute of Biotechnology, Shanghai, China).

Western blot analysis

The cells were lysed in RIPA buffer containing the protease inhibitor cocktail (Roche). After incubation at 4 °C for 30 min, the soluble protein was collected by centrifugation at 12,000 rpm for 15 min. The protein concentration of the supernatant was analyzed using a Pierce Protein Assay Kit and stored at −80 °C. The protein was separated on a 10% SDS-polyacrylamide gel and then transferred to Immobilon-P membrane (Millipore). Rabbit monoclonal antibodies against VEGF (1:1000, R & D Systems) and antibodies against [beta]-actin (1:1000, R & D Systems) were used as internal control immunoimmun filters. Immunocomplexes were detected with secondary antibodies conjugated to horseradish peroxidase (1:10,000, Santa Cruz Biotechnology) and visualized using the Immobilon (TM) Western Chemiluminescent Kit (Millpore).

Tube formation assay

HUVECs (1.2 × 104/well) were cultured in 96-well plates coated with 60 µL of Matrigel (BD Biosciences). The tube formation is defined as a tubular structure having a length four times its width. The tube morphology was quantified using a computer-assisted microscope (Nikon) in 24 random microscopes for 24 h.

Statistical analysis

The data are expressed as mean ± standard deviation. The two groups of treatment groups were not paired students t test; single factor analysis of variance for continuous analysis. The value of P < 0.05 was considered statistically significant.

Results

The efficacy of infection of lentivirus

Primary HUVECs showed a cobblestone or pitching stone-like appearance with large dark nuclei, forming a confluent monolayer cells after 2–3 days of culture (Fig. 1A and B). The expression of GFP and cell transduction were assessed using a fluorescence microscope. After using the optimized transduction process, we found that 90–95% of the cells showed GFP expression (Fig. 1C).

Fig. 1

HUVECs under optical microscope (×100) (A) HUVECs passage 1 (B) HUVECs passage 5. (C) HUVECs infected by lentivirus for 48 h.

The efficacy of infection of lentivirus using RT-PCR

As shown in the melting curve (Fig. 2), GAPDH and FAD dissolution temperatures were 85.5 °C and 86.5 °C respectively. A single peak shape indicated that the primers had high specificity. The melting curve showed that the two genes were efficiently and specifically amplified.

Fig. 2

The melting curve of GAPDH and FAD.

We used GAPDH as internal control to relatively quantify the target gene FAD. As shown in Fig. 3, the expression level in the overexpression group was significantly higher than those of the control and negative control groups. The expression level in the ox-LDL group was significantly lower than those of other groups because of cell dysfunction caused by ox-LDL (Fig. 3).

Fig. 3

The relative expression level of FAD/GADPH in the different groups.

Cell proliferation assay using MTT

Compared with the control group, cell viability of the negative control and the over-expression groups slightly decreased. Cell viability of the ox-LDL and the negative + ox-LDL groups significantly decreased compared with the control group (P < 0.05 and P < 0.01 respectively). The overexpression of FAD reversed ox-LDL-induced cell viability decrease, especially in the overexpression + arachidonic acid group (p < 0.01) (Fig. 4).

Fig. 4

Cell proliferation assay using MTT. Data are means ± S.D.

The ox-LDL group had a larger number of apoptotic cells than the control group. Compared with those in the control and overexpression groups, the apoptosis index (AI) in the ox-LDL group was significantly higher (P < 0.01). The apoptosis rate was 0.1%, 64.9%, and 67.1% for the control, the ox-LDL, and the negative + ox-LDL groups respectively. It was significantly decreased in the overexpression, the overexpression+ox-LDL + arachidonic acid, and the over expression + arachidonic acid groups, which were 12.8%, 12.4% and 3.8% respectively (Fig. 5).

Fig. 5

Cell apoptosis assay using flow cytometry. (A) The blank control group (B) the negative control group (C) the overexpression group (D) the ox-LDL group (E) the negative + ox-LDL group (F) the overexpression + arachidonic acid + ox-LDL group (G) the overexpression + arachidonic acid group.

After ox-LDL treated HUVEC, the NO content decreased from 4.5 μmol/ml in the control group to 1.25 μmol/ml and 0.66 μmol/ml in the ox-LDL and the negative + ox-LDL groups respectively. It increased from 4.5 μmol/ml in the control group to 12.25 μmol/ml, 4.55 μmol/ml, and 12.23 μmol/ml in the overexpression, the overexpression+ox-LDL + arachidonic acid, and the overexpression + arachidonic acid groups respectively (Fig. 6A).

Fig. 6

NO, MAD, SOD, GSH-PX, and LDL assay using ELISA. Data are means ± S.D. (A) NO content (B) MAD content (C) SOD activity (D) GSH-PX activity (E) LDL activity.

After ox-LDL treated HUVEC, the MAD content significantly increased from 5.67 μmol/ml in the control group to 13.43 μmol/ml and 13.01 μmol/ml in the ox-LDL and the negative + ox-LDL groups respectively. It decreased from 5.67 μmol/ml in the control group to 1.74 μmol/ml, 5.97 μmol/ml, and 1.83 μmol/ml in the overexpression, the overexpression+ox-LDL + arachidonic acid, and the overexpression + arachidonic acid groups respectively (Fig. 6B).

After ox-LDL treated HUVEC, the SOD activity significantly decreased from 1.41U in the control group to 0.44 U and 0.45 U in the ox-LDL and the negative + ox-LDL groups respectively. It increased from 1.41 U in the control group to 2 U, 1.15 U, and 2.2 U in the overexpression, the overexpression+ox-LDL + arachidonic acid, and the overexpression + arachidonic acid groups respectively (Fig. 6C).

After ox-LDL treated HUVEC, the GSH-PX activity significantly decreased from 587 mU/mg in the control group to 132.9 mU/mg and 278.6 mU/mg in the ox-LDL and the negative + ox-LDL groups respectively. It increased from 587 mU/mg in the control group to 1466 mU/mg, 587 mU/mg, and 1552 mU/mg in the overexpression, the overexpression+ox-LDL + arachidonic acid, and the overexpression + arachidonic acid groups respectively (Fig. 6D).

After ox-LDL treated HUVEC, the LDH activity significantly increased from 414 U/L in the control group to 610 U/L and 786 U/L in the ox-LDL and the negative + ox-LDL groups respectively. It decreased from 414 U/L in the control group to 216 U/L, 388 U/L, and 234 U/L in the overexpression, the overexpression+ox-LDL + arachidonic acid, and the overexpression + arachidonic acid groups respectively (Fig. 6E).

It is evident from the results shown in Fig. 7 that ox-LDL suppresses the expression of VEGF by HUVECs. In contrast to this, Δ-17 FAD increased ox-LDL-inhibited VEGF expression, suggesting that when there is a stimulus that normally inhibits VEGF expression, it will be kept in check by Δ-17 FAD.

Fig. 7

VEGF expression among the seven groups using Western blot. (A) The blank control group (B) the negative control group (C) the overexpression group (D) the ox-LDL group (E) the negative + ox-LDL group (F) the overexpression + arachidonic acid + ox-LDL group (G) the overexpression + arachidonic acid group.

HUVECs incubation with Matrigel without exogenous stimulation showed that HUVEC was rearranged or aligned in an organized manner within 1 or 2 h of electroplating. After 16–18 h plating, the molding process reaches its maximum value. In the absence of stimulation, HUVEC only formed a small amount of short, incomplete tube. Most of the tubes are not connected to each other, but remain close to the derived cell bodies. After 18 h, the tube begins to decompose and its network becomes less (Fig. 8A and B). In the presence of Δ-17 FAD, tube formation was significantly inhibited (Fig. 8C). After 6 h of matling on Matrigel, the effect of ox-LDL on HUVECs was noted. Visual differences were evident when compared to [Delta] -17 FAD overexpression control cells (Fig. 8D and E). The ox-LDL-treated HUVECs formed significantly less tubes in comparison to Δ-17 FAD-overexpression cells (Fig. 8F and G).

Fig. 8

In vitro tube formation assay. (A) The blank control group (B) the negative control group (C) the overexpression group (D) the ox-LDL group (E) the negative + ox-LDL group (F) the overexpression + arachidonic acid + ox-LDL group (G) the overexpression + arachidonic acid group.

Discussion

Atherosclerosis is one of the most frequent and common cardiovascular diseases nowadays. There is a consensus among investigators and clinicians that endothelial cell injury initiates atherogenesis. Recent evidence also correlates endothelial injury with monocyte and platelet adhesion, aggregation and release of cytokines and platelet-derived growth factors (Mannaioni et al., 1997). It has been shown that endothelium usually regulates oxidized low-density lipoprotein (ox-LDL) (plasma predominantly cholesterol-carrying lipoproteins) into the arterial wall of the inlet (Patel et al., 2014). Despite some discrepancies, the indication from cohort studies that there is an association between oxLDL and cardiovascular (CV) events seems to point toward a role for ox-LDL in atherosclerotic plaque progress and disruption (Xie et al., 2016, Feng et al., 2016, Natalia et al., 2016, Francesca et al., 2015). Δ-17 FAD, a newly identified FAD, shares 55% identity at the amino acid level with SCD-1 which is the limiting step of the desaturation of saturated to monounsaturated fatty acid (Andreas et al., 2008). Since SCD-1 plays a beneficial role protecting endothelial cells against lipotoxicity, we postulated that Δ-17 FAD, played a key role in endothelial cell functional preservation.

Oxidative damage and endothelial dysfunction are considered to be significant factors underlying the initiation and progression of atherosclerosis. Zhang et al. (2016) observed that ox-LDL decreased cell viability in a dose-dependent manner. We noted that ox-LDL significantly suppressed HUVEC viability. The overexpression of Δ-17 FAD reversed ox-LDL-induced cell viability decrease (Fig. 4). Ox-LDL induced apoptosis in vascular endothelial cells is the pathogenic basis of atherosclerosis (Jonathan et al., 2001). In this study, we demonstrated the protective effect of Δ-17 FAD on ox-LDL-induced apoptosis in HUVECs (Fig. 5). Further studies are needed to clarify the underlying mechanisms involved in the protective effects of Δ-17 FAD on endothelial cell apoptosis.

During physiological and pathological processes, human body often produces some free radicals, which will be subsequently removed by antioxidant systems including superoxide dismutase (SOD), glutathione peroxidase (GSH-PX), glutathione transferase enzymes, and other enzymes, as well as glutathione (GSH), vitamin C, vitamin E, uric acid, β-carotene, ceruloplasmin and the like, among which SOD and GSH-PX are the major free radical scavenging enzymes (Valko et al., 2006). If the dynamic equilibrium of oxygen free radicals and antioxidant systems were compromised, excessive production of oxygen or reduced clearance of free radicals, combined with decreased antioxidant capacity of SOD can result in a significant increase in malondialdehyde (MDA), causing further cell damages, cellular metabolic dysfunctions, cell death, and tissue damages through decomposition products of lipid hydroperoxide (Merrill and Fred, 2013). Therefore, determination of MDA may reflect the degree of lipid peroxidation in body. We showed that ox-LDL significantly decreased SOD and GSH-PX and increased MDA by HUVECs. The overexpression of Δ-17 FAD abrogated the oxidative damages induced by ox-LDL (Fig. 6B–D).

Nitric oxide (NO) is an important bioactive substance which is produced from L-arginine via NO synthase in endothelial cells (Louis et al., 2002). As an intercellular communication molecule, NO inhibits platelet and monocyte-macrophage adhesion and endothelial cells and smooth muscle cell proliferation (Arnal et al., 1999). It has been shown that ox-LDL acted on HUVECs, reducing NO synthesis via reducing the NO synthase activity, which promote cell adhesion, proliferation, and blood vessel contraction (Sean and Michael, 2007). In the present study, we demonstrated that the protective effect of Δ-17 FAD on ox-LDL-induced reduction of NO in HUVECs (Fig. 6A). Besides, we also showed that the overexpression of Δ-17 FAD abrogated ox-LDL-induced release of LDL by HUVECs (Fig. 6E). These results imply that Δ-17 FAD can reverse ox-LDL-induced oxidative damages to endothelial cells to some extent.

Lee et al. (2007) demonstrated that VEGF secreted by endothelial cells is very important for endothelial cell survival and the maintenance of homeostasis. They also observed that the vast majority of VEGF-knockout mice have suffered internal bleeding, thrombosis, and other symptoms, which fully illustrated the importance of VEGF in maintaining vascular integrity. VEGF is the most specific regulatory factor to regulate endothelial cell growth and differentiation, which is also an endothelial cell mitotic agent. In the present study, we demonstrated the protective effect of Δ-17 FAD on ox-LDL-induced decrease of HUVECs expression by HUVECs (Fig. 7).

Successfully cultured HUVEC have similar ability to form tube-like structures on Matrigel to mimic the migration and formation process during in vivo angiogenesis, whichC is an important indicator of vascular endothelial cell function (Guidolin et al., 2010). As shown in Fig. 8, HUVECs in the control and ox-LDL groups failed to form a network structure on the gel, and the Δ-17 FAD overexpression and arachidonic acid groups were capable of forming a tube-like structures. These results imply that Δ-17 FAD has a certain role in promoting HUVECs angiogenesis.

Conclusion

In conclusion, our study demonstrated that Δ-17 FAD can protect endothelial cells from oxidative damage induced by ox-LDL. This finding indicates that Δ-17 FAD can serve as a potential therapeutic agent in the prevention and treatment of atherosclerosis.