Literature DB >> 28560285

Data on the association of CMPK1 with clinicopathological features and biological effect in human epithelial ovarian cancer.

Daibing Zhou1,2, Lingyun Zhang1,2, Qunbo Lin1,2, Weimin Ren1,2, Guoxiong Xu1,2.   

Abstract

Human epithelial ovarian cancer (EOC) is the most lethal gynecological disease. However, the molecular mechanisms by which transforming growth factor-β (TGF-β) regulates ovarian tumor progression markers remain unclear. The present data show cytidine monophosphate kinase (CMPK) as an EOC biomarker and are related to the article entitled "Cytidine monophosphate kinase is inhibited by the TGF-β signalling pathway through the upregulation of miR-130b-3p in human epithelial ovarian cancer" [1]. CMPK, as well as cystatin B [2] and β-2-microglobulin [3], is overexpressed in human epithelial-type ovarian tumors. CMPK is an enzyme required for nucleic acid biosynthesis [4] and is regulated by the TGF-β signaling pathway in EOC cells [1]. Furthermore, the data show the effect of CMPK-shRNA on EOC cell apoptosis and TGF-β-induced Smad2 phosphorylation. CMPK expression in two EOC cell lines OVCAR-3 and SK-OV-3 is regulated by multiple miRNAs and some of these miRNAs may affect EOC chemoresistance [5].

Entities:  

Keywords:  TGF-β signaling; Therapeutic target; Tissue microarray; Tumorigenesis; UMP/CMP kinase; miRNA

Year:  2017        PMID: 28560285      PMCID: PMC5443893          DOI: 10.1016/j.dib.2017.05.022

Source DB:  PubMed          Journal:  Data Brief        ISSN: 2352-3409


Specifications Table Value of the data Data present CMPK as an ovarian serous tumor progression marker. The location of CMPK protein expression in the cytoplasm and nucleus of epithelial-type ovarian tumor cells is shown. Suppression of CMPK affects the doubling time of EOC cells. Data describe for the first time that knockdown of CMPK influences EOC cell apoptosis. Data show the effect of CMPK-shRNA on TGF-β-induced Smad2 phosphorylation.

Data

The data represent the observation from experiments of tissue microarray, Western blot and flow cytometry. Data in Table 1 are the list of sequences of siRNA, shRNA, miRNA and PCR primer used in a related research article [1]. The data of the association of CMPK protein expression with clinicopathological features of patients with epithelial ovarian tumours are shown in Table 2. Data in Fig. 1 show the positive rate for CMPK staining in the cytoplasm and nucleus. Fig. 2 confirms the knockdown of CMPK protein by Western blot after CMPK-siRNA transfection in OVCAR-3 and SK-OV-3 cells. Doubling times (DT) based on the optical density (OD) values at the time of measurement is shown in Fig. 3. Data in Fig. 4 represent the proportion of early apoptotic cells detected by flow cytometry and the expression of cleaved caspase-3 protein, an active form of apoptotic protein, detected by Western blot after CMPK-shRNA infection. Data of phospho-Smad2 detection by Western blot are shown in Fig. 5. Screening data of the effect of miRNAs on CMPK expression are shown in Fig. 6.
Table 1

Sequences of siRNA, shRNA, miRNA and PCR primer.

NameSequence (5’ → 3’)Target position
CMPK-siRNA
SenseGAAAGAUUGUACCAGUUGAttnt 424–442
AntisenseUCAACUGGUACAAUCUUUCtt
NC-siRNA
SenseUUCUCCGAACGUGUCACGUTTScramble
AntisenseACGUGACACGUUCGGAGAATT
CMPK-shRNA
SensegatccGAAAGATTGTACCAGTTGAttcaagagaTCAACTGGTACAATCTTTCttttttgnt 424–442
AntisenseaattcaaaaaaGAAAGATTGTACCAGTTGAtctcttgaaTCAACTGGTACAATCTTTCg
miR-130b-3p
miR-130b mimicCAGUGCAAUGAUGAAAGGGCAUnt 1824–1834
miR-CtrlUCACAACCUCCUAGAAAGAGUAGA
anti-miR-130bAUGCCCUUUCAUCAUUGCACUGnt 1824–1834
anti-CtrlUCUACUCUUUCUAGGAGGUUGUGA
CMPK PCR primer
ForwardTGTCAGCTCCCTCAGCGTCnt 114–132
ReverseCGAGGACGAACACGACCAGnt 255–273
β-actin PCR primer
ForwardCATTGCCGACAGGATGCAGnt 1008–1026
ReverseCTCGTCATACTCCTGCTTGCTGnt 1155–1176
miR-130b-3p primer
ForwardGGCAGTGCAATGATGAAAGG
ReverseGTGCAGGGTCCGAGGT
U6 primer
ForwardCTCGCTTCGGCAGCACA
ReverseAACGCTTCACGAATTTGCGT
miR-130b RT primerGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACatgccc

The target position in CMPK mRNA sequence (GenBank Accession: NM_016308) and β-actin mRNA sequence (GenBank Accession: NM_001101) is shown. Sequence in lowercase indicates a linker. NC, negative control; nt, nucleotide; PCR, polymerase chain reaction; siRNA, small interfering RNA; shRNA, short hairpin RNA.

Table 2

Association of CMPK protein expression with clinicopathological features of patients with epithelial ovarian tumours.

Clinicopathological featuresnTotal CMPK expression
P-value
Positive (%)Negative (%)
Age0.221a
≤452611 (42.31)15 (57.69)
>454928 (57.14)21 (42.86)
Histological type
Serous tumour440.005b
Benign50 (00.00)5 (100.00)
Borderline55 (100.00)0 (00.00)
Malignant3414 (41.18)20 (58.82)
Mucinous tumour140.748b
Benign93 (33.33)6 (66.67)
Borderline21 (50.00)1 (50.00)
Malignant32 (66.67)1 (33.33)
Endometrioid adenocarcinoma108 (80.00)2 (20.00)
Transitional cell carcinoma44 (100.00)0 (00.00)
Adenocarcinoma32 (66.67)1 (33.33)
FIGO stage0.778b
I2413 (54.17)11 (45.83)
II106 (60.00)4 (40.00)
III1910 (52.62)9 (47.37)
IV11 (100.00)0 (00.00)

The expression of CMPK was detected by immunohistochemistry using tissue microarray. For comparison of CMPK expression associated with age, a χ2 test was applied

For multiple comparisons of CMPK expression associated with and histological types and clinical stages, a Fisher׳s exact test was applied.

n, number of cases; Positive, positive expression; Negative, negative expression; FIGO, International Federation of Gynaecological Oncologists. Normal ovarian tissues (n=19) showing a negation staining of CMPK are served as control.

Fig. 1

Evaluation of positive rate for CMPK staining in tissue microassay. CMPK protein staining in subcellular localization was scored. Histogram shows the positive rate of CMPK staining in different tissues. A positive staining of CMPK was found in the cytoplasm and nucleus of ovarian tumor cells, whereas normal tissue appeared negative staining. Data are presented as mean. N, case number; Normal, normal ovarian tissue; Benign, benign tumor; Borderline, borderline tumor; Malignant, malignant tumor.

Fig. 2

Knockdown of CMPK expression in EOC cells is confirmed by Western blot after siRNA transfection. OVCAR-3 (A, C) and SK-OV-3 (B, D) cells were transiently transfected with CMPK-siRNA (CMPK-siR) and negative control-siRNA (NC-siR), respectively. Untreated cells were used as blank control (Blank). (A, B) CMPK protein was detected by Western blot at 24 h post-transfection. (C, D) Histograms show semi-quantitative analysis after densitometry on the gels of (A) and (B), respectively. Data are presented as mean ± SEM (N = 3). *P<0.05; **P<0.01 (CMPK-siRNA vs. Blank or NC-siR).

Fig. 3

Doubling times (DT) based on the OD values at the time of measurement. (A) Histogram shows the DT (h, hour) of OVCAR-3 cells: Blank, 24.52±0.74; CTL, 23.91±0.82; NC, 30.07±3.02; CMPK-siR, 46.32±2.03. (B) Histogram shows the DT of SK-OV-3: Blank, 24.02±1.41; CTL, 25.06±2.06; NC, 26.19±1.64; CMPK-siR, 46.46±7.80. *P<0.05 (CMPK-siRNA group vs. other groups). Blank, control without transfection; CTL, reagent control, NC, negative control of transfection; CMPK-siR, CMPK-siRNA transfection.

Fig. 4

Suppression of CMPK influences EOC cell apoptosis. OVCAR-3 cells were infected with CMPK-shRNA lentiviral particles or empty vector lentiviral particles. (A) The proportion of apoptotic cells of OVCAR-3 CMPK-shRNA expressing cells (CMPK-shRNA) and negative control cells (NC) was determined by flow cytometry. (B) Histogram shows the quantitative analysis of the percentage of early apoptotic cells from (A). (C) Cleaved caspase-3 and full sized caspase-3 proteins in NC and CMPK-shRNA cells were detected by Western blot. (D) Histogram shows the semi-quantitative analyses of the gels from (C) after densitometry (N = 3). Data are presented as mean±SEM. *P<0.05; **P<0.01 (CMPK-shRNA vs. NC).

Fig. 5

Effect of CMPK-shRNA on TGF-β-induced Smad2 phosphorylation. (A) Expression of protein detected by Western blot. (B, C) Histogram shows the semi-quantitative analyses of pSmad2 in OVCAR-3 and SK-OV-3 cells after densitometry in the gels from (A). Data are presented as mean±SEM. Different superscripts denote a significant difference from each other (P<0.05; N=3).

Fig. 6

Effect of miRNAs on CMPK expression. CMPK protein expression was detected by Western blot. OVCAR-3 and SK-OV-3 cells were transiently transfected with nine miRNA mimics. Negative control miRNA (miR-NC) was used as control. Experiment was repeated twice.

Evaluation of positive rate for CMPK staining in tissue microassay. CMPK protein staining in subcellular localization was scored. Histogram shows the positive rate of CMPK staining in different tissues. A positive staining of CMPK was found in the cytoplasm and nucleus of ovarian tumor cells, whereas normal tissue appeared negative staining. Data are presented as mean. N, case number; Normal, normal ovarian tissue; Benign, benign tumor; Borderline, borderline tumor; Malignant, malignant tumor. Knockdown of CMPK expression in EOC cells is confirmed by Western blot after siRNA transfection. OVCAR-3 (A, C) and SK-OV-3 (B, D) cells were transiently transfected with CMPK-siRNA (CMPK-siR) and negative control-siRNA (NC-siR), respectively. Untreated cells were used as blank control (Blank). (A, B) CMPK protein was detected by Western blot at 24 h post-transfection. (C, D) Histograms show semi-quantitative analysis after densitometry on the gels of (A) and (B), respectively. Data are presented as mean ± SEM (N = 3). *P<0.05; **P<0.01 (CMPK-siRNA vs. Blank or NC-siR). Doubling times (DT) based on the OD values at the time of measurement. (A) Histogram shows the DT (h, hour) of OVCAR-3 cells: Blank, 24.52±0.74; CTL, 23.91±0.82; NC, 30.07±3.02; CMPK-siR, 46.32±2.03. (B) Histogram shows the DT of SK-OV-3: Blank, 24.02±1.41; CTL, 25.06±2.06; NC, 26.19±1.64; CMPK-siR, 46.46±7.80. *P<0.05 (CMPK-siRNA group vs. other groups). Blank, control without transfection; CTL, reagent control, NC, negative control of transfection; CMPK-siR, CMPK-siRNA transfection. Suppression of CMPK influences EOC cell apoptosis. OVCAR-3 cells were infected with CMPK-shRNA lentiviral particles or empty vector lentiviral particles. (A) The proportion of apoptotic cells of OVCAR-3 CMPK-shRNA expressing cells (CMPK-shRNA) and negative control cells (NC) was determined by flow cytometry. (B) Histogram shows the quantitative analysis of the percentage of early apoptotic cells from (A). (C) Cleaved caspase-3 and full sized caspase-3 proteins in NC and CMPK-shRNA cells were detected by Western blot. (D) Histogram shows the semi-quantitative analyses of the gels from (C) after densitometry (N = 3). Data are presented as mean±SEM. *P<0.05; **P<0.01 (CMPK-shRNA vs. NC). Effect of CMPK-shRNA on TGF-β-induced Smad2 phosphorylation. (A) Expression of protein detected by Western blot. (B, C) Histogram shows the semi-quantitative analyses of pSmad2 in OVCAR-3 and SK-OV-3 cells after densitometry in the gels from (A). Data are presented as mean±SEM. Different superscripts denote a significant difference from each other (P<0.05; N=3). Effect of miRNAs on CMPK expression. CMPK protein expression was detected by Western blot. OVCAR-3 and SK-OV-3 cells were transiently transfected with nine miRNA mimics. Negative control miRNA (miR-NC) was used as control. Experiment was repeated twice. Sequences of siRNA, shRNA, miRNA and PCR primer. The target position in CMPK mRNA sequence (GenBank Accession: NM_016308) and β-actin mRNA sequence (GenBank Accession: NM_001101) is shown. Sequence in lowercase indicates a linker. NC, negative control; nt, nucleotide; PCR, polymerase chain reaction; siRNA, small interfering RNA; shRNA, short hairpin RNA. Association of CMPK protein expression with clinicopathological features of patients with epithelial ovarian tumours. The expression of CMPK was detected by immunohistochemistry using tissue microarray. For comparison of CMPK expression associated with age, a χ2 test was applied For multiple comparisons of CMPK expression associated with and histological types and clinical stages, a Fisher׳s exact test was applied. n, number of cases; Positive, positive expression; Negative, negative expression; FIGO, International Federation of Gynaecological Oncologists. Normal ovarian tissues (n=19) showing a negation staining of CMPK are served as control.

Experimental design, materials and methods

Tissue microarray

Ovarian tissue microarray (TMA) was obtained from Xi׳an Alena Biotechnology Ltd., Co. (Xi’an, Shanxi, China). Association of CMPK protein expression with clinicopathological features of patients with EOC was analyzed after immunohistochemistry staining.

Cell culture, treatment with TGF-β and transduction

OVCAR-3 and SK-OV-3 cells (ATCC, Manassas, VA, USA) were cultured in RPMI-1640 and DMEM (Corning Inc., Manassas, VA, USA), respectively. The cells were treated with 10 ng/ml of recombinant human TGF-β1 (R&D Systems, Minneapolis, MN, USA) for 24 hours. Small interfering RNA (siRNA) was purchased from GenePharma Company (Shanghai, China). The cells were transiently transfected with siRNA mixture (Roche Applied Science, Indianapolis, IN, USA) for 5 h. CMPK-shRNA was constructed with double-strand oligonucleotides. The efficiency of CMPK-shRNA lentiviral transduction was examined by fluorescence microscopy as the construct contains green fluorescent protein (GFP). Knockdown of CMPK was confirmed by qRT-PCR and Western blot.

Transfection of miRNA mimics

Nine miRNA mimics and negative control miRNA were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, Guangdong, China). The cells were transfected with miRNA mimics for 5 h and then incubated in a complete medium for up to 72 hours.

Western blot

Protein was detected by Western blot using antibodies specific to phospho-Smad2 and Smad2 (Cell Signalling Technology, Inc. Danvers, MA, USA), active caspase-3 and full sized caspase-3 (Abways Technology, Inc. Shanghai, China).

Flow cytometry

Apoptotic cells were detected by staining cells with APC Annexin-V and propidium iodide (PI) using an Annexin-V Apoptosis Detection Kit (BD Pharminggen, San Diego, CA, USA). Lentivirus infected EOCs were seeded in a 6-well plate and were incubated for 24 hours. Both supernatant and attached cells were collected and resuspended in 100 µl of 1X binding buffer. After adding 5 µl of Annexin-V and/or 5 µl of PI, the cells were incubated in the dark at room temperature for 15 min. After adding 400 µl of 1X binding buffer, the cell population was analyzed by flow cytometry.
Subject areaCell biology; Health science
More specific subject areaApoptosis; Ovarian cancer
Type of dataTable and figure
How data was acquiredTissue microarray, human EOC cell lines OVCAR-3 and SK-OV-3 (ATCC, Manassas, VA, USA), Transfection, Western blot, Flow cytometry (Becton Dickinson Beckman Coulter, Inc., Brea, CA, USA)
Data formatAnalyzed
Experimental factorsCells were transfected with siRNA or shRNA; Cells were treated with 10 ng/ml TGF-β1 for 24 h
Experimental featuresThe tissue microarray included 100 paraffin-embedded ovarian tissues; Screen 9 miRNAs that potentially target CMPK1
Data source locationShanghai, China
Data accessibilityThe data are with this article
Related research articleZhou et al.[1]“Cytidine monophosphate kinase is inhibited by the TGF-β signalling pathway through the upregulation of miR-130b-3p in human epithelial ovarian cancer” j.cellsig 35:197–207.
  5 in total

1.  Cytidine monophosphate kinase is inhibited by the TGF-β signalling pathway through the upregulation of miR-130b-3p in human epithelial ovarian cancer.

Authors:  Daibing Zhou; Lingyun Zhang; Wenwen Sun; Wencai Guan; Qunbo Lin; Weimin Ren; Jihong Zhang; Guoxiong Xu
Journal:  Cell Signal       Date:  2017-04-14       Impact factor: 4.315

2.  The contribution of CMP kinase to the efficiency of DNA repair.

Authors:  Ning Tsao; Ming-Hsiang Lee; Wei Zhang; Yung-Chi Cheng; Zee-Fen Chang
Journal:  Cell Cycle       Date:  2015       Impact factor: 4.534

Review 3.  Mechanisms and Therapeutic Targets of microRNA-associated Chemoresistance in Epithelial Ovarian Cancer.

Authors:  Lingyun Zhang; Lubna Nadeem; Kristin Connor; Guoxiong Xu
Journal:  Curr Cancer Drug Targets       Date:  2016       Impact factor: 3.428

4.  Cystatin B is a progression marker of human epithelial ovarian tumors mediated by the TGF-β signaling pathway.

Authors:  Xingxing Wang; Lu Gui; Youyuan Zhang; Jihong Zhang; Jimin Shi; Guoxiong Xu
Journal:  Int J Oncol       Date:  2014-01-21       Impact factor: 5.650

5.  Human epithelial-type ovarian tumour marker beta-2-microglobulin is regulated by the TGF-β signaling pathway.

Authors:  Wenwen Sun; Lu Gui; Xulei Zuo; Lingyun Zhang; Daibing Zhou; Xiaoling Duan; Weimin Ren; Guoxiong Xu
Journal:  J Transl Med       Date:  2016-03-16       Impact factor: 5.531

  5 in total
  2 in total

1.  Oncogenic KSHV-encoded interferon regulatory factor upregulates HMGB2 and CMPK1 expression to promote cell invasion by disrupting a complex lncRNA-OIP5-AS1/miR-218-5p network.

Authors:  Wan Li; Qingxia Wang; Qi Feng; Fei Wang; Qin Yan; Shou-Jiang Gao; Chun Lu
Journal:  PLoS Pathog       Date:  2019-01-30       Impact factor: 6.823

2.  Preclinical Studies on Convalescent Human Immune Plasma-Derived Exosome: Omics and Antiviral Properties to SARS-CoV-2.

Authors:  Neslihan Pakize Taşlı; Zeynep Burçin Gönen; Oğuz Kaan Kırbaş; Nur Seda Gökdemir; Batuhan Turhan Bozkurt; Buse Bayrakcı; Derya Sağraç; Ezgi Taşkan; Sevda Demir; Nur Ekimci Gürcan; Melike Bayındır Bilgiç; Ömer Faruk Bayrak; Hazel Yetişkin; Büşra Kaplan; Shaikh Terkıs Islam Pavel; Gökçen Dinç; Müge Serhatlı; Gamze Çakırca; Ahmet Eken; Vedat Aslan; Mehmet Yay; Musa Karakukcu; Ekrem Unal; Fethi Gül; Kemal Erdem Basaran; Yusuf Ozkul; Fikrettin Şahin; Olcay Y Jones; Şaban Tekin; Aykut Özdarendeli; Mustafa Cetin
Journal:  Front Immunol       Date:  2022-03-24       Impact factor: 7.561

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.