| Literature DB >> 28553280 |
Jin Yuan1, Zhiyong Han1, Jun Li1, Yunzhen Huang1, Jiongfeng Yang1, Hongxing Ding1, Jingyuan Zhang1, Mengjiao Zhu1, Yangyi Zhang1, Jiedan Liao1, Mingqiu Zhao1, Jinding Chen1.
Abstract
Pestiviruses are highly variable RNA viruses. A growing number of novel pestiviruses has been discovered in domestic and wild species in the last two decades. Recently, a novel atypical porcine pestivirus (APPV) linked with the development of congenital tremor (CT) in neonatal pigs was described in Europe and the Americas. Here, the first Asian APPV complete polyprotein coding sequence was assembled from serum samples from newborn piglets affected with CT in Southern China, and termed APPV_GD. 14 organ samples from affected piglets were analyzed by quantitative RT-PCR (qRT-PCR) to investigate the tissue tropism of APPV, and 135 serum samples from pigs from 10 farms were used for identifying APPV in adult pigs. The highest genome loads were found in submaxillary lymph nodes, and PCR-based detection showed that APPV genomes were present in seven samples from five farms. A phylogenetic tree was constructed based on the full-length genomes of the pestiviruses, and APPV_GD appeared on a new branch with another newly discovered APPV. Nucleotide identity analysis demonstrated that APPV_GD shared the highest nucleotide sequence identity with a German APPV. Bayesian inference was performed using 25 partial sequences of the APPV NS5B gene (528 bp) isolated from four countries in recent years. According to this analysis, the most recent common ancestor (tMRCA) of the current APPV strains might have emerged in Germany and then diversified and spread to Asia, the Americas, and other countries in Europe. However, the result of bayesian inference could change when more APPV strains are isolated in the future. The present study is the first to report APPV in China and infers the origin and dissemination of the current strains of the virus.Entities:
Keywords: APPV; China; congenital tremor; sequence analysis; tissue tropism
Year: 2017 PMID: 28553280 PMCID: PMC5425480 DOI: 10.3389/fmicb.2017.00862
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
The special primers for atypical porcine pestivirus (APPV) used in the study.
| Primer | Sequence (5′–3′) | Target | Purpose |
|---|---|---|---|
| APPV_NS3-F | CAGAGRAAAGGKCGAGTGGG | NS3 | qRT-PCR |
| APPV_NS3-R | ACCATAYTCTTGGGCCTGSAG | NS3 | qRT-PCR |
| APPV_NS3-T7-F | GATCACTAATACGACTCACTATAGGG CAGAGGAAAGGCCGAGTGGG | NS3 | qRT-PCR |
| APPV_NS5B-F | CCTGGGACACTCAAGTAACGA | NS5B | PCR |
| APPV_NS5B-R | GTGTCCCTTTGTTAG CTGCAT | NS5B | PCR |
PCR results for piglet serum samples from 10 farms in China.
| Farm | No. positive/Total | Percent (%) |
|---|---|---|
| 1 | 1/5 | 20 |
| 2 | 0/12 | 0 |
| 3 | 0/5 | 0 |
| 4 | 0/15 | 0 |
| 5 | 2/15 | 13.3 |
| 6 | 1/6 | 16.7 |
| 7 | 1/13 | 7.7 |
| 8 | 0/16 | 0 |
| 9 | 0/24 | 0 |
| 10 | 2/24 | 8.3 |
Nucleotide identity of APPV_GD to related pestiviruses with sequences in GenBank.
| No. | Virus | Identity (%) |
|---|---|---|
| 1 | APPV_Bavaria_S5/9_gtKU041639.1 | 93.5 |
| 2 | APPV_GER_01_LT594521.1 | 91.1 |
| 3 | APPV_NL1_gtKX929062.1 | 91.1 |
| 4 | Porcine_pestivirus_1_isolate_ISDVDL2014016573_gtKU194229.1 | 90.7 |
| 5 | Porcine_pestivirus_1_strain_000515_KR011347.1 | 88.3 |
| 6 | Rhinolophus affinis pestivirus 1_ JQ814854.1 | 64.5 |
| 7 | BVDV_NADL_AJ133738.1 | 42.7 |
| 8 | BDV_Gifhorn_KF925348.1 | 42.5 |
| 9 | BVDV3_D32/00_HoBi_AB871953.1 | 42.5 |
| 10 | CSFV_C-strain_Z46258.1 | 42.3 |
| 11 | Giraffe-1_AF144617.2 | 42.3 |
| 12 | BVDV2_NY-93_KR093034.1 | 42.1 |
| 13 | NrPV_NC_025677.1 | 41.2 |
| 14 | Porcine_pestivirus_isolate_Bungowannah_NC_023176.1 | 41.1 |
| 15 | Pronghorn_NC_024018.2 | 41.0 |