| Literature DB >> 28533769 |
Madhavi Annamanedi1, Gajapati Y N Varma1, K Anuradha2, Arunasree M Kalle1.
Abstract
Treatment of multidrug resistant bacterial infections has been a great challenge globally. Previous studies including our study have highlighted the use of celecoxib, a non-steroidal anti-inflammatory drug in combination with antibiotic has decreased the minimal inhibitory concentration to limit Staphylococcus aureus infection. However, the efficacy of this combinatorial treatment against various pathogenic bacteria is not determined. Therefore, we have evaluated the potential use of celecoxib in combination with low doses of antibiotic in limiting Gram-positive and Gram-negative bacteria in vivo in murine polymicrobial sepsis developed by cecum ligation and puncture (CLP) method and against clinically isolated human ESKAPE pathogens (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species). The in vivo results clearly demonstrated a significant reduction in the bacterial load in different organs and in the inflammatory markers such as COX-2 and NF-κB via activation of SIRT1 in mice treated with imipenem, a choice of antibiotic for polymicrobial sepsis treatment. Combinatorial treatment of ampicillin and celecoxib was effective on clinical isolates of ESKAPE pathogens, 45% of tested clinical isolates showed more than 50% reduction in the colony forming units when compared to ampicillin alone. In conclusion, this non-traditional treatment strategy might be effective in clinic to reduce the dose of antibiotic to treat drug-resistant bacterial infections.Entities:
Keywords: ESKAPE pathogens; ampicillin; antibiotic drug resistance; celecoxib; imipenem; polymicrobial sepsis
Year: 2017 PMID: 28533769 PMCID: PMC5420555 DOI: 10.3389/fmicb.2017.00805
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Primers used for the quantitative real time PCR analysis of cytokines.
| Gene | Forward primer | Reverse primer | Source |
|---|---|---|---|
| TNF-α | TTCTGTCTACTGAACTTCGGGGTGATCGGTCC | GTATGAGATAGCAAATCGGCTGACGGTGTGGG | |
| IL-β | ATGGCAACTGTTCCTGAACTCAACT | CAGGACAGGTATAGATTCTTTCCTTT | |
| IL-6 | AGGATACCACTCCCAACAGACCT | CAAGTGCATCATCGTTGTTCATAC | |
| IL-10 | ATTTGAATTCCCTGGGTGAGAAG | CACAGGGGAGAAATCGATGACA | |