| Literature DB >> 28529879 |
Sarah G H Sapp1,2, Pooja Gupta3,4, Melissa K Martin4, Maureen H Murray4, Kevin D Niedringhaus1, Madeleine A Pfaff1,4, Michael J Yabsley1,4.
Abstract
A total of 10 species of Baylisascaris, a genus of ascaridoid nematodes, occur worldwide and 6 of them occur in the New World. Most of the Baylisascaris species have a similar life cycle with carnivorous mammals or marsupials serving as definitive hosts and a smaller prey host serving as paratenic (or intermediate) hosts. However, one species in rodents is unique in that it only has one host. Considerable research has been conducted on B. procyonis, the raccoon roundworm, as it is a well-known cause of severe to fatal neurologic disease in humans and many wildlife species. However, other Baylisascaris species could cause larva migrans but research on them is limited in comparison. In addition to concerns related to the potential impacts of larva migrans on potential paratenic hosts, there are many questions about the geographic ranges, definitive and paratenic host diversity, and general ecology of these non-raccoon Baylisascaris species. Here, we provide a comprehensive review of the current knowledge of New World Baylisascaris species, including B. columnaris of skunks, B. transfuga and B. venezuelensis of bears, B. laevis of sciurids, B. devosi of gulonids, B. melis of badgers, and B. potosis of kinkajou. Discussed are what is known regarding the morphology, host range, geographic distribution, ecoepidemiology, infection dynamics in definitive and paratenic hosts, treatment, and control of these under-studied species. Also, we discuss the currently used molecular tools used to investigate this group of parasites. Because of morphologic similarities among larval stages of sympatric Baylisascaris species, these molecular tools should provide critical insight into these poorly-understood areas, especially paratenic and definitive host diversity and the possible risk these parasites pose to the health to the former group. This, paired with traditional experimental infections, morphological analysis, and field surveys will lead to a greater understanding of this interesting and important nematode genus.Entities:
Keywords: Ascarids; Baylisascaris; Larva migrans; Wildlife parasites; Zoonoses
Year: 2017 PMID: 28529879 PMCID: PMC5429227 DOI: 10.1016/j.ijppaw.2017.04.003
Source DB: PubMed Journal: Int J Parasitol Parasites Wildl ISSN: 2213-2244 Impact factor: 2.674
Fig. 1Generalized life cycle scheme for Baylisascaris spp.
Overview of Baylisascaris species endemic to the New World, including B. procyonis for comparison.
| Authority | Stefanski and Zarnowski, 1951 | Pérez, García & | ||||||
| Historical synonyms | N/A | N/A | ||||||
| Primary DH (genus or species) | Raccoons ( | Skunks ( | Fishers, Martens, Wolverines ( | Marmots, ground squirrels ( | Badgers ( | Kinkajou ( | Bears ( | Spectacled bear ( |
| Adult length | 46-119; 55-337 | 43-110; 72-266 | 57-123; 105-285 | 37-108; 32-212 | 120-127; 22-260 | 117-123; 214-223 | 63-120; 102-240 | 102; 250 |
| Adult midbody width (♂; ♀) | 1.0–2.0; 1.5–2.5 | 1.3–2.5 | 1.3–2.5 | 1.0–2.3; 1.7–3.2 | up to 3; up to 5 | 1.6–1.75; 2.51–2.9 | 1.2–1.9; 1.6–4.5 | 3.0; 4.1 |
| Esophageal length (♂; ♀) | 2.19–6.46; 2.41–7.53 | 2.69–5.21; 3.76–7.81 | 4.15–4.50; 4.00–4.83 | 2.73–5.64; 1.84–6.59 | 5.9; 7.25 | 4.10–4.56 | 3.7–4.7; 4.0–5.1 | ND |
| Spicules | 0.49–0.71 | 0.33–0.76 | 0.39–0.54 | 0.24–0.81 | 0.80–0.90 | 0.61–0.77 | 0.80–0.93 | 0.9 |
| Vulvar position | 25% | 25% | 33% | 34% | 37% | 28.2% | 37% | 40% |
| Number of pre-anal papillae | 43–67 | 36–53 | 30–40 | 41–61 | up to 63 | 44–52 | 46–70 | 44 |
| Cervical alae | Inconspicuous | Inconspicuous | Inconspicuous | Inconspicuous | Prominent | Inconspicuous | Prominent | Prominent |
| Average egg size | 80 × 60 μm | 73 × 63 μm | 77 × 61 μm | 75 × 62 μm | 87 × 75 μm | 83 × 73 μm | 90 × 75 μm | ND |
| Sources | ||||||||
ND = not determined.
Measurements in mm unless otherwise specified.
Percentage of body length from anterior end.
Inconspicuous = only visible in transverse section.
Measurement represents examination of single specimen.
Host and locality records for Baylisascaris columnaris in North America.
| Host | Location | No. infected/no. examined (%) | Source |
|---|---|---|---|
| Striped skunk ( | New York, USA (central) | NG/74 (>90) | |
| Massachusetts, USA (western) | 15/19 (84) | ||
| Texas, USA (central) | 0/NG (0) | ||
| Oregon, USA (northwestern) | 1/1 | ||
| California, USA (central) | 0/45 (0) | ||
| North Dakota, USA | 8/42 (19) | ||
| Ontario, Canada (southern) | (62) | ||
| Illinois, USA (northeastern) | 18/73 (25) | ||
| Texas, USA (west-central) | 0/23 (0) | ||
| Saskatchewan, Canada | 65/173 (38) | ||
| Eastern spotted skunk ( | Minnesota, USA | 4/23 (17) | |
| California, USA (central) | 0/14 (0) | ||
| Arkansas, USA (western) | 1/29 (3) | ||
| Western spotted skunk ( | Texas, USA (central) | 0/NG (0) | |
| Texas, USA (west-central) | 0/9 (0) | ||
| American hog-nosed skunk ( | Texas, USA (central) | 0/NG (0) | |
| Texas, USA (west-central) | 0/28 (0) |
NG = not given.
Morphometrics of Baylisascaris transfuga adults and eggs from various hosts and geographic regions.
| Host | Location | Male length (mm) | Female length (mm) | Egg width (μm) | Egg length (μm) | Source |
|---|---|---|---|---|---|---|
| Multiple captive and wild species | Multiple | Up to 120 | Up to 240 | Up to 75.0 | Up to 90 | |
| Sloth bear ( | India | 64–94 | 138–183 | 47.0–75.2 | 65.8–94.0 | |
| Polar bear ( | Italy | 63–116 | 102–203 | NG | NG | |
| NG | NG | 57.6–64.0 | 60.8–73.6 | |||
| Multiple captive species | Pennsylvania (USA) | 81–142 | 108–166 | NG | NG | |
| Multiple captive species | Louisiana (USA) | NG | NG | 66.3–74.7 | 78.3–88.0 |
NG = not given.
Reports of Baylisascaris transfuga in free-ranging and captive bears in North America.
| Host | Location | Captive/Wild | No. infected/no. examined (%) | Method of detection | Source |
|---|---|---|---|---|---|
| Brown bear ( | Northwest Territories, Canada | Wild | 3/56 (5) | Fecal flotation | |
| Wyoming and Montana, USA | Wild | 53/70 (76) | Necropsy | ||
| Canada | Wild | 16/21 (76) | Necropsy | ||
| Alaska, USA | Wild | 0/28 (0) | Fecal flotation | ||
| British Columbia and Alberta, Canada | Wild | 7/13(54) | Necropsy | ||
| Black bear ( | Florida, USA | Wild | 5/22 (23) | Necropsy | |
| New York, USA | Wild | 17/55 (31) | |||
| Minnesota and Michigan, USA | Wild | 5/9 (56) | Necropsy | ||
| Wisconsin, USA | Wild | 59/92 (64) | Fecal Flotation | ||
| Wyoming and Montana, USA | Wild | 24/30 (80) | Necropsy | ||
| Minnesota, USA | Wild | 1/1 (100)(august) | Necropsy | ||
| Southeastern USA | Wild | 28/53 (53) | Necropsy | ||
| New Brunswick, Canada | Wild | 1/12 (8) | Necropsy | ||
| Alberta, Canada | Wild | 35/56 (62) | Necropsy | ||
| Quebec, Canada | Wild | 17/80 (21) | Fecal flotation | ||
| Quebec, Canada | Wild | 38/168(23) | Fecal flotation | Frechette and Rau 1978 | |
| Ontario, Canada | Wild | 20/83(24) | |||
| British Columbia and Alberta, Canada | Wild | 24/40(60) | Necropsy | ||
| Northwest Territories, Canada | Wild | 12/27 (44) | Fecal flotation | ||
| Polar bear ( | Massachusetts, USA | Captive | 1/1(100) | Necropsy | |
| California, USA | Captive | 2/3 (66) | |||
| Various | USA, various | Captive | 125/260 (48) | Fecal flotation |
Host and locality records of Baylisascaris devosi in North American mustelid species.
| Host species | Location | No. infected/No. examined (%) | Source |
|---|---|---|---|
| American marten ( | Manitoba, Canada | 1/139 (0.7) | |
| Alaska, USA | 1/141 (0.7) | ||
| Washington, USA | 4/78 (5) | ||
| Wolverine ( | Northwest Territories, Canada | NG | |
| Alaska, USA | 17/80 (21) | ||
| Fisher ( | New Brunswick, Canada | NG | |
| Manitoba, Canada | 52/162 (32) | ||
| Pacific marten ( | Idaho, USA | 6/17 (35) | |
| Ontario, Canada | NG |
NG=Not given.
Unidentified larvae authors suggested could be B. devosi were found in digestions of hind limb musculature of 10 martens in addition to the 23 adult nematodes identified as B. devosi in study.
Identified as Ascaris columnaris.
Locality records of presumed Baylisascaris melis from North American badgers (Taxidea taxus).
| Location | No. infected/No. examined | Source |
|---|---|---|
| Minnesota | 1/8 | |
| Iowa | 29/NG | |
| North Dakota | 6/17 | |
| Kansas | 10/30 | |
| Wisconsin | 2/4 | |
| South Dakota | NG | |
| Colorado | NG | |
| Wyoming | 1 roadkill badger, 1 captive badger |
NG=Not given.
Identified as Ascaris columnaris but are assumed to be B. melis.
2 of the 8 badgers had been in captivity for 2 years.
Summary of different PCR primers available for identification of Baylisascaris species.
| Target gene | Length of the target gene | Species | Primer | Reference |
|---|---|---|---|---|
| ATPase subunit 6 ( | 600bp | F (5′-CGCGGATCCTTCGATATTCGTGG CCT-3′) | ||
| cytochrome oxidase c subunit I ( | 413bp | F: (5′-TTTTTTGGGCATCCTGAGGTTTAT-3′) | ||
| cytochrome oxidase c subunit 2 ( | 1578bp | F (5′-TTTAGAGGTTGGAATGTAGGGT-3′) | ||
| 483bp | F: (5’-AATTTTAATTGTAGTCTTTTGTTTGG-3′) | |||
| mitochondrial cytochrome b cytb | ∼1500bp | Cytb-1 (5′-GGTGCTATGCTCGGTTACG-3′) | ||
| 12s rRNA | 499bp | F (5′-AGCGGAGGAAAAGAAACTAA3′) | ||
| 18s rDNA | 1708bp | F (5′-AGCGGAGGAAAAGAAACTAA-3′) | ||
| 28s rDNA | 751bp | F (5′-CCCGATTGATTCTGTCGGC-3′) | ||
| 718bp | F: (5′-CGAGGATTCCCTTAGTAACT-3′) | |||
| ITS1-5.8S-ITS2 | 630-650bp | F: (5’-ATAGTGAGTTGCACACTAATGT-3′) | ||
| Complete mt genome- (atp6, CO1–CO3, cytb, nad1–nad6 nad4L, 22 transfer RNA (trn) | See reference for numerous sets of primers. | |||
| ITS2 rDNA | 301 bp | F (5’-TTATGAATTTTCAACATGGC-3’) | ||
| 3′ end of the ITS- | 700bp | zghu (5′- AAGGTGGAGAGAAAGCTCCTC | ||
| ITSs (18s and 28S) | 1177bp | F (5′-ACTGCTGTTTCGAGACCTTTCGAG-3′) |
Different length in different parasites due to insertions and tandem repeat.