Literature DB >> 28511672

CrMAPK3 regulates the expression of iron-deficiency-responsive genes in Chlamydomonas reinhardtii.

Xiaowen Fei1, Junmei Yu2, Yajun Li2, Xiaodong Deng3.   

Abstract

BACKGROUND: Under iron-deficient conditions, Chlamydomonas exhibits high affinity for iron absorption. Nevertheless, the response, transmission, and regulation of downstream gene expression in algae cells have not to be investigated. Considering that the MAPK pathway is essential for abiotic stress responses, we determined whether this pathway is involved in iron deficiency signal transduction in Chlamydomonas.
RESULTS: Arabidopsis MAPK gene sequences were used as entry data to search for homologous genes in Chlamydomonas reinhardtii genome database to investigate the functions of mitogen-activated protein kinase (MAPK) gene family in C. reinhardtii under iron-free conditions. Results revealed 16 C. reinhardtii MAPK genes labeled CrMAPK2-CrMAPK17 with TXY conserved domains and low homology to MAPK in yeast, Arabidopsis, and humans. The expression levels of these genes were then analyzed through qRT-PCR and exposure to high salt (150 mM NaCl), low nitrogen, or iron-free conditions. The expression levels of these genes were also subjected to adverse stress conditions. The mRNA levels of CrMAPK2, CrMAPK3, CrMAPK4, CrMAPK5, CrMAPK6, CrMAPK8, CrMAPK9, and CrMAPK11 were remarkably upregulated under iron-deficient stress. The increase in CrMAPK3 expression was 43-fold greater than that in the control. An RNA interference vector was constructed and transformed into C. reinhardtii 2A38, an algal strain with an exogenous FOX1:ARS chimeric gene, to silence CrMAPK3. After this gene was silenced, the mRNA levels and ARS activities of FOX1:ARS chimeric gene and endogenous CrFOX1 were decreased. The mRNA levels of iron-responsive genes, such as CrNRAMP2, CrATX1, CrFTR1, and CrFEA1, were also remarkably reduced.
CONCLUSION: CrMAPK3 regulates the expression of iron-deficiency-responsive genes in C. reinhardtii.

Entities:  

Keywords:  Chlamydomonas reinhardtii; Iron deficiency; Mitogen-activated protein kinases; Real-time PCR

Mesh:

Substances:

Year:  2017        PMID: 28511672      PMCID: PMC5434638          DOI: 10.1186/s12858-017-0081-5

Source DB:  PubMed          Journal:  BMC Biochem        ISSN: 1471-2091            Impact factor:   4.059


Background

Chlamydomonas reinhardtii (Volvocales, Chlorophyta) is a single-celled eukaryotic and flagellated green alga, whose three genetic systems located in the nucleus, chloroplast, and mitochondria can be used for transformation. This alga is regarded as a “photosynthetic yeast” because of its easy culturing process, rapid growth, short life cycle, and high photosynthetic efficiency. With its three genome sequences, this model organism is highly useful for cell and molecular biology research [1]. In phosphorylation cascades, mitogen-activated protein kinases (MAPKs) are eukaryotic signal proteins involved in extracellular signal amplification and intracellular signal transduction in yeasts, animals, and plants [2-4]. Combined with other signal molecules, MAPKs transfer external stimuli via successive phosphorylation reactions: MAPKKKs → MAPKKs → MAPKs. Progressively and continuously enlarged signals, such as environmental stress factors, including high salinity, high osmotic pressure, and low temperature, reach the nucleus and regulate downstream gene expression [5, 6]. In eukaryotic cells, phosphorylation cascades are composed of MAPKs, MAPKKs, and MAPKKKs. Homo sapiens possesses 15 MAPKs, 7 MAPKKs, and 16 MAPKKKs, while Arabidopsis contains 20 MAPKs, 10 MAPKKs, and 80 MAPKKKs. Few MAPK cascades have been described because of the complexity of genetic networks and pleiotropic and interaction effects. MAPK genes have been identified in plants, such as Arabidopsis, rice, corn, wheat, and barley [7-13]. MAPKs function through stress-response pathways [14, 15]. Iron is an essential trace element for most living organisms. A precise iron regulation system is necessary to maintain the dynamic equilibrium of iron [16] because iron overload and deficiency cause metabolic disorders. Following nitrogen and phosphate deficiencies, iron deficiency restricts plant growth and yield and consequently induces crop chlorosis and yields low productivity. In humans, insufficient iron concentrations trigger iron deficiency anemia or iron deficiency syndrome. Iron has also been considered a growth-limiting factor in some tumor cells. Therefore, iron chelators are clinically used for cancer suppression. Under iron-deficient conditions, Chlamydomonas exhibits high affinity for iron absorption that slightly differs from iron absorption in plants. Environmental ferric iron is reduced to ferrous iron via FRE1 (homology of Arabidopsis FRO2 [17]) on the plasma membrane and then putatively transferred to FOX1 by FEA1 [18]. Afterward, FOX1 oxidizes ferrous iron to ferric iron, which is then transported to the cytoplasm by FTR1 on the plasma membrane [19-21]. The expression of the genes encoding these proteins is significantly increased under iron-deficient conditions, and this phenomenon indicates that iron deficiency signals in these genes are regulated. Nevertheless, the response, transmission, and regulation of downstream gene expression in algal cells have yet to be investigated. Considering that the MAPK pathway is essential for non-biological stress responses, we determined whether this pathway is involved in iron deficiency signal transduction in Chlamydomonas. In this study, Arabidopsis MAPKs were used to search for the corresponding genes in the Chlamydomonas genome database (https://phytozome.jgi.doe.gov/pz/portal.html #), and 16 homologous genes, namely, CrMAPK2–CrMAPK17, were obtained. The mRNA expression level variation of these genes exposed to different stressors, such as –Fe, −N, and osmotic shock (150 mM NaCl), was also detected. Among these genes, CrMAPK3 is specifically functionally analyzed by RNA silencing.

Results

Bioinformatics Analysis of MAPK Genes in Chlamydomonas

Sixteen homologous genes (Table 1), which are localized in chromosomes 1, 2, 3, 8, 12, 13, 16, and 17, were identified by searching the Chlamydomonas genome database with Blast. The predicted open reading frames of these genes were 1062–5301 bp in length, and their protein products contained 353–1766 amino acids with molecular weights of 39.8–178.76 kD and isoelectric points of 5.68–9.5. Fourteen of the MAPKs located in the cytosome were predicted by Euk-mPLoc2.0 except CrMAPK6 and CrMAPK14, which exist in the nucleus. Using PROSITE predictions, we verified that the 16 CrMAPKs were mitogen-activated protein kinases. Multi-sequence alignment of the MAPK-specific TXY motifs in the CrMAPK proteins revealed that the T(D/E/T/S/P)Y activation loop motifs were conserved in the serine-threonine kinase (S-Tkc) domain in the 16 CrMAPKs (Fig. 1). CrMAPK3, CrMAPK6, and CrMAPK8 contain TEY; CrMAPK2, CrMAPK4, CrMAPK5, CrMAPK7, CrMAPK9, CrMAPK10, and CrMAPK13 comprise TDY; CrMAPK11, CrMAPK12, CrMAPK15, and CrMAPK16 possess TSY; CrMAPK17 is composed of TPY; and CrMAPK14 consists of TTY. Chlamydomonas MAPKs were divided into two groups by using MEGA6. Group I contained CrMAPK2 to CrMAPK10, whereas Group II comprised CrMAPK11 to CrMAPK17 (Fig. 2a). All of the MAPK genes contained 6 to 10 exons. The gene length ranged from 2.8 kb to 10.5 kb. Among these genes, CrMAPK3 is the shortest and CrMAPK11 is the longest (Fig. 2b). In addition to the S-Tkc-conserved region, 8 other protein domains/motifs, such as Syn N(Syntaxin N-terminal domain), RIO (RIO-like kinase), CUE (domain that may be involved in binding ubiquitin-conjugating enzymes), and Tyr-kc (tyrosine kinase catalytic domain) motifs (Fig. 2c), are present in CrMAPKs. The annotated CrMAPK1(Cre13.g582650) in JGI database is a small protein with 149 aa. After the alignment was compared with the other CrMAPKs(CrMAPK2-CrMAPK17), the results revealed that the conserved domain (T(D/E/T/S/P)YXTRWYRAPEL(V)) in the MAPK family could not be found in CrMAPK1. As such, CrMAPK1 is not included in Table 1.
Table 1

List of the 16 MAPK genes identified in C. reinhardtii and their sequence characteristics

NameLocus NameORF (bp)Amino AcidskDpIChromosomal localizationSub cellular location
CrMAPK2Cre08.g385050222374079.08.61chr8:4906426..4913322 FCytoplasm
CrMAPK3Cre12.g509000106235339.88.76chr12:2119590..2122035 RCytoplasm
CrMAPK4Cre17.g745447229876581.27.20chr17:6855222..6862749 FCytoplasm
CrMAPK5Cre13.g607300130243348.58.88chr13:5094976..5099387 FCytoplasm
CrMAPK6Cre12.g508900112837542.57.66chr12:2129460..2133325 RNuclear
CrMAPK7Cre16.g661100175858563.39.7chr16:2519399..2524020 FCytoplasm
CrMAPK8Cre01.g010000117038944.05.68chr1:1838122..1842287 FCytoplasm
CrMAPK9Cre12.g538300192364068.49.1chr12:6473633..6479228 FCytoplasm
CrMAPK10Cre01.g052800369211631179.91chr1:7342585..7351700 RCytoplasm
CrMAPK11Cre01.g052850519917321689.5chr1:7356808..7367075 FCytoplasm
CrMAPK12Cre03.g200200530117661789.36chr3:8184080..8192783 RCytoplasm
CrMAPK13Cre10.g432250475215831608.31chr10:1948371..1956866 RCytoplasm
CrMAPK14Cre03.g169500332111061149.49chr3:3709775..3716106 RNuclear
CrMAPK15Cre02.g111014421214031429.15chr2:5820048..5827789 FCytoplasm
CrMAPK16Cre17.g709500323710781077.93chr17:1790415..1798683 RCytoplasm
CrMAPK17Cre17.g709750495616511658.56chr17:1821974..1831590 FCytoplasm

F and R represent the forward and reverse directions on the chromosome, respectively. In total, 16 CrMAPK proteins were obtained by BLASTP search using the C. reinhardtii V5.5 proteome database and MAPK proteins from Arabidopsis thaliana as queries. The 16 CrMAPK genes were named based on their name annotated in JGI database. The molecular weights and pIs of the 16 CrMAPK proteins were predicted using ExPASy. The CrMAPK sub-cellular locations were predicted using the Euk-mPLoc2.0 program

Fig. 1

Multiple alignments of T(D/E/T/S/P)Y domains from MAPK proteins. The U-box domains in CrPUB proteins were predicted using MEME programs. Their sequences were aligned using ClustalX 2.1, and the alignments were edited using GeneDoc 2.7 sequence editor. Black, gray, and light gray shades indicate the identities and similarities among these sequences as 100, 80, and 60%, respectively

Fig. 2

An analytical view of the CrMAPK gene family. a An unrooted tree summarizing the evolutionary relationships among the 16 members of the CrMAPK family. Multiple alignments of the 16 CrMAPK protein sequences from C. reinhardtii were conducted using ClustalX 2.1. The phylogenetic tree was constructed using MEGA6. The numbers on each node are Shimodaira-Hasegawa-like test indices of statistical support provided by MEGA6. Bar = 2.0 is a branch length that represents the number of amino acid substitutions per site. The tree shows the 3 phylogenetic subfamilies (numbered I to III and marked with different color backgrounds) with high predictive values. b Intron/exon structures: the gene structures were drawn using the online tool GSDS. As shown in the legend, the exons and introns are indicated by green rectangles and thin lines, respectively. The untranslated regions (UTRs) are indicated by blue boxes. The sizes of exons and introns can be estimated using the scale shown at the bottom. c Schematic representation of the conserved motifs in the 16 CrMAPK proteins elucidated using SMART and PROSITE online. The different domains are indicated by different colored boxes denoted at the bottom right corner. The lengths of the proteins and motifs can be estimated using the scale shown at the bottom

List of the 16 MAPK genes identified in C. reinhardtii and their sequence characteristics F and R represent the forward and reverse directions on the chromosome, respectively. In total, 16 CrMAPK proteins were obtained by BLASTP search using the C. reinhardtii V5.5 proteome database and MAPK proteins from Arabidopsis thaliana as queries. The 16 CrMAPK genes were named based on their name annotated in JGI database. The molecular weights and pIs of the 16 CrMAPK proteins were predicted using ExPASy. The CrMAPK sub-cellular locations were predicted using the Euk-mPLoc2.0 program Multiple alignments of T(D/E/T/S/P)Y domains from MAPK proteins. The U-box domains in CrPUB proteins were predicted using MEME programs. Their sequences were aligned using ClustalX 2.1, and the alignments were edited using GeneDoc 2.7 sequence editor. Black, gray, and light gray shades indicate the identities and similarities among these sequences as 100, 80, and 60%, respectively An analytical view of the CrMAPK gene family. a An unrooted tree summarizing the evolutionary relationships among the 16 members of the CrMAPK family. Multiple alignments of the 16 CrMAPK protein sequences from C. reinhardtii were conducted using ClustalX 2.1. The phylogenetic tree was constructed using MEGA6. The numbers on each node are Shimodaira-Hasegawa-like test indices of statistical support provided by MEGA6. Bar = 2.0 is a branch length that represents the number of amino acid substitutions per site. The tree shows the 3 phylogenetic subfamilies (numbered I to III and marked with different color backgrounds) with high predictive values. b Intron/exon structures: the gene structures were drawn using the online tool GSDS. As shown in the legend, the exons and introns are indicated by green rectangles and thin lines, respectively. The untranslated regions (UTRs) are indicated by blue boxes. The sizes of exons and introns can be estimated using the scale shown at the bottom. c Schematic representation of the conserved motifs in the 16 CrMAPK proteins elucidated using SMART and PROSITE online. The different domains are indicated by different colored boxes denoted at the bottom right corner. The lengths of the proteins and motifs can be estimated using the scale shown at the bottom

Analysis of mRNA levels of MAPK gene under − Fe, −N, and 150 mM NaCl stress conditions

The RNA extracted from the samples of Chlamydomonas cultivated under − Fe, −N, and 150 mM NaCl conditions was used for quantitative analysis, and the results are shown in Fig. 3. CrMAPK2–CrMAPK17 expression levels were affected by iron deficiency, nitrogen deficiency, and high salt concentration. Compared with the expression of the gene in the TAP medium, the mRNA expression levels of CrMAPK2, CrMAPK3, CrMAPK4, CrMAPK5, CrMAPK6, CrMAPK8, CrMAPK9, and CrMAPK11 were increased by iron deficiency to various degrees. CrMAPK3, CrMAPK5, and CrMAPK11 respectively increased by 43-, 5-, and 40-fold after cultivation for 48 h. However, iron deficiency decreased the mRNA levels of CrMAPK7, CrMAPK12, CrMAPK13, CrMAPK15, CrMAPK16, and CrMAPK17 after cultivation for 48 h. In nitrogen deficiency, the mRNA expression levels of CrMAPK6 and CrMAPK14 were significantly increased, whereas the expression levels of most MAPKs, such as those of CrMAPK2, CrMAPK3, CrMAPK5, CrMAPK5, CrMAPK8, CrMAPK9, CrMAPK10, CrMAPK11, CrMAPK12, CrMAPK13, CrMAPK15, CrMAPK16, and CrMAPK17, of C. reinhardtii were inhibited, and the mRNA expression levels of these genes were significantly decreased. The mRNA expression levels of all MAPK genes were also inhibited under high salt (150 mM NaCl) condition, and the mRNA expression of CrMAPK17 was reduced by 10E10.
Fig. 3

Results of qPCR analysis of the CrMAPK genes under − Fe, −N, or 150 mM NaCl conditions. C. reinhardtii CC425 was pre-cultured in TAP to the mid-logarithmic phase, followed by centrifugation and resuspension in TAP, TAP-Fe, TAP-N, and TAP with 150 mM NaCl. All the samples continued culturing for 12, 36, and 48 h. The cells were collected, and RNA samples were isolated. The gene transcript levels were determined using Real Time quantitative PCR. All expression values were normalized to the value of the 18S rRNA gene. The relative amounts were calibrated based on the number of transcripts of the corresponding genes in cells maintained in TAP for 12 h

Results of qPCR analysis of the CrMAPK genes under − Fe, −N, or 150 mM NaCl conditions. C. reinhardtii CC425 was pre-cultured in TAP to the mid-logarithmic phase, followed by centrifugation and resuspension in TAP, TAP-Fe, TAP-N, and TAP with 150 mM NaCl. All the samples continued culturing for 12, 36, and 48 h. The cells were collected, and RNA samples were isolated. The gene transcript levels were determined using Real Time quantitative PCR. All expression values were normalized to the value of the 18S rRNA gene. The relative amounts were calibrated based on the number of transcripts of the corresponding genes in cells maintained in TAP for 12 h

CrMAPK3 positively regulates the expression of CrFOX1 gene

The C. reinhardtii 2A38 strain was prepared by using the integrated FOX1 promoter:ARS box into the chromosome of the CC425 strain. Under iron-deficient conditions, CrFOX1 promoted the ARS reporter expression and appeared deep blue when this gene was mixed with XSO4 substrate or yellow when this gene was mixed with p-nitrophenylsulfate. A total of 133 colonies were obtained after Maa7IR/CrMAPK3IR was transformed into C. reinhardtii 2A38 and then transferred onto –Fe plates with XSO4 to determine the ARS activities. Only 44 colonies and the control sample of 2A38 appeared blue, whereas the 99 other colonies were colorless or light blue. Furthermore, 74.4% of chromogenic reactions indicated that CrMAPK3 silencing affected the FOX1 promoter function in –Fe. The transformants of RNAi11, RNAi37, and RNAi62 appeared colorless in both + Fe (16 uM) and –Fe except the non-transgenic C. reinhardtii 2A38 control, which appeared deep blue under –Fe conditions (Fig. 4a). These results were further confirmed by the ARS activity in transgenic strains. The ARS activities of RNAi11, RNAi37, and RNAi62 respectively decreased by 82, 85, and 83% compared with those of the C. reinhardtii 2A38 control (Fig. 4b). The mRNA of the ARS2 of the transgenic stains decreased by more than 97% in –Fe (Fig. 4c). The mRNA levels of the target CrMAPK3 of the transgenic strains RNAi11, RNAi37, and RNAi62 decreased remarkably by 97, 97, and 98%, respectively (Fig. 4d). These data implied that CrMAPK3 silencing positively regulated FOX1:ARS expression. CrMAPK3 silencing also decreased the gene expression of endogenous FOX1 in Chlamydomonas. The mRNA levels of CrFOX1 of the RNAi11 strain decreased by 63, 54, and 71% when this strain was cultured for 12, 24, and 48 h under the –Fe condition, respectively. CrMAPK3 silencing also repressed the iron-induced upregulation of CrFOX1 gene expression. Therefore, CrMAPK3 positively regulated the endogenous expression of CrFOX1 (Fig. 4e).
Fig. 4

Analysis of CrMAPK3 RNAi transgenic algal strains. Of the 133 CrMAPK3 RNAi transformants, 99 were colorless or light blue. Among them, the ARS activities of transgenic strains RNAi11, RNAi37, and RNAi62 were significantly decreased under − Fe (a, b). Moreover, the mRNA levels of ARS were significantly decreased (c). The mRNA level of target gene CrMAPK3 was decreased by 97–98% compared with the control (d), indicating that CrMAPK3 in transgenic strains of RNAi11, RNAi37, and RNAi62 has been effectively silenced. The mRNA levels of endogenous CrFOX1 were reduced by 63, 54, and 71%, respectively, at 12, 24, and 48 h post-incubation in –Fe, indicating that CrMAPK3 positively regulates the expression of CrFOX1 gene (e). The data are shown as the means (±SD, n = 3). Significance is indicated as *P < 0.05, **P < 0.01

Analysis of CrMAPK3 RNAi transgenic algal strains. Of the 133 CrMAPK3 RNAi transformants, 99 were colorless or light blue. Among them, the ARS activities of transgenic strains RNAi11, RNAi37, and RNAi62 were significantly decreased under − Fe (a, b). Moreover, the mRNA levels of ARS were significantly decreased (c). The mRNA level of target gene CrMAPK3 was decreased by 97–98% compared with the control (d), indicating that CrMAPK3 in transgenic strains of RNAi11, RNAi37, and RNAi62 has been effectively silenced. The mRNA levels of endogenous CrFOX1 were reduced by 63, 54, and 71%, respectively, at 12, 24, and 48 h post-incubation in –Fe, indicating that CrMAPK3 positively regulates the expression of CrFOX1 gene (e). The data are shown as the means (±SD, n = 3). Significance is indicated as *P < 0.05, **P < 0.01

CrMAPK3 positively regulates the expression levels of iron uptake-associated genes

Chlamydomonas exhibits an iron uptake pattern similar to Type I plants. During iron deficiency, Chlamydomonas cells undergo the affinity iron absorption mechanism by inducing the expression of CrFOX1 [19], CrNRAMP2 [18], CrATX1 [22], CrFTR1 [20], and CrFEA1 to enhance iron absorption [18]. CrFEA1 is located in the cell walls and responsible for the transport of reduced Fe2+ via FRE1 (homolog of Arabidopsis FRO2) to CrFOX1, which is found in the plasma membrane (homolog of yeast FET3 [23]), and reoxidizes Fe2+ to Fe3+. CrFOX1 is then transported inside the cells through the plasma membrane protein CrFTR1, and ATX1 of yeast transports Cu2+ to the cytoplasm. Thus far, direct evidence supporting iron transmission has yet to be obtained, but studies have shown that ATX1 is an iron-deficiency-inducible protein. The NRAMP gene family is located on the vacuole membrane, and it shuttles Fe2+ between vacuole membranes to maintain the iron concentration in the cytoplasm. The mRNA levels of iron absorption-related genes, such as CrNRAMP2, CrATX1, CrFTR1, and CrFEA1, in the CrMAPK3 RNAi transgenic strain RNAi11 are shown in Fig. 5. The mRNA levels of the genes decreased after the strains were cultivated for 48 h under –Fe. The mRNA level of CrNRAMP2 was decreased by 86% compared with the control after cultivation for 48 h in –Fe. Similarly, the mRNA levels of CrATX1, CrFTR1, and CrFEA1 were decreased by 96, 96, and approximately 53%, respectively. These results indicated the association of CrMAPK3 of Chlamydomonas with the iron metabolism-related genes. In the CrMAPK3-silenced strain RNAi11, the mRNA levels of the genes, including CrNRAMP2, CrATX1, CrFTR1, and CrFEA1, were also decreased when the mRNA level of CrMAPK3 was decreased. Thus, CrMAPK3 might positively regulate the expression of iron-uptake-associated genes, such as CrNRAMP2, CrATX1, CrFTR1, and CrFEA1.
Fig. 5

mRNA expressions of iron absorption-related genes in CrMAPK3 RNAi transgenic strain RNAi11 in –Fe. In the CrMAPK3-silenced strain RNAi11, the mRNA levels of genes, including CrNRAMP2, CrATX1, CrFTR1, and CrFEA1, were decreased when the mRNA level of CrMAPK3 was decreased and after they were incubated with –Fe after 48 h. This finding indicated that CrMAPK3 may positively regulate the expression of iron uptake-associated genes, such as CrNRAMP2, CrATX1, CrFTR1, and CrFEA1. The data are shown as means ± SD (n = 3). Significance is indicated as *P < 0.05, **P < 0.01

mRNA expressions of iron absorption-related genes in CrMAPK3 RNAi transgenic strain RNAi11 in –Fe. In the CrMAPK3-silenced strain RNAi11, the mRNA levels of genes, including CrNRAMP2, CrATX1, CrFTR1, and CrFEA1, were decreased when the mRNA level of CrMAPK3 was decreased and after they were incubated with –Fe after 48 h. This finding indicated that CrMAPK3 may positively regulate the expression of iron uptake-associated genes, such as CrNRAMP2, CrATX1, CrFTR1, and CrFEA1. The data are shown as means ± SD (n = 3). Significance is indicated as *P < 0.05, **P < 0.01

Discussion

MAPKs are widely distributed in eukaryotic organisms, such as yeast, humans, and plants, and are involved in phosphorylation signaling cascades in extracellular amplification and intracellular transduction [23]. The MAPK pathway is responsive to biological and non-biological stress stimuli, hormones, or growth factors and to cell division and apoptosis. Moreover, the MAPK pathway comprises MAPKKK, MAPKK, and MAPK and amplifies signals via subsequent phosphorylation by using protein kinases and by migrating to the nucleus; thus, the extracellular stimuli of membrane receptors are connected to the molecular effectors of the cytoplasm and the nucleus [24, 25]. A few MAPKs, including 20 in Arabidopsis, 17 in rice, 19 in corn, 21 in aspen (Populus), 17 in tobacco, 16 in tomato, and 26 in apple, have been identified [26-28]. Proteins encoded by MAPKs in different species contain various domains. In Chlamydomonas, 3 of TEY, 7 of TDY, 4 of TSY, 1 of TPY, and 1 of TTY exist. In Arabidopsis, 8 of TDY and 12 of TEY are present. These diversities of types and kinase domains demonstrate that MAPKs participate in many metabolic activities. Through cluster analysis, we found that TDY and TEY of Chlamydomonas kinases are highly homologous to those of Arabidopsis kinases possibly because only TDY and TEY domains are found in Arabidopsis. Other domains are highly similar to human kinases. Organisms need iron for respiration, DNA synthesis, and enzyme reactions. Transport systems have been developed for iron absorption because iron balance is vital. Iron regulation, especially iron absorption and transportation, has been extensively investigated, but iron signal response systems have been rarely explored. Iron deficiency in humans causes iron deficiency anemia and adolescent iron deficiency 1 syndrome. Iron is an important element required by the body; excessive or scarce amounts of iron likely cause metabolic disorders; therefore, organisms should have a sophisticated control system to regulate the dynamic balance of iron elements [16]. Iron deficiency is the third-most important limiting factor of plant growth and yield in agriculture. Photosynthetic plants reduce their chlorophyll synthesis and photosynthesis rate under iron-deficient conditions. In humans, iron deficiency causes anemia. Conversely, excess iron increases the risk of liver disease, heart attack, and hypothyroidism. Iron is also a limiting factor in the growth of some tumor cells, and iron chelators are used clinically to inhibit tumor cell growth. Furthermore, studies on iron MAPK signal cascades have focused on human cancers. Iron deficiency inhibits the mitosis of lung carcinoma cells, melanoma cells, and dysembryoplastic neuroepithelial tumor cells and thus induces cell apoptosis [29-31]. Therefore, iron chelators, desferrioxamine (DFO), and Dp44mT are used to treat these cancers clinically [32, 33]. Iron deficiency signals are also transduced through the activation of JNA and P38 by ASK1 (MAPKKK) to regulate the suspension of the mitotic activity and apoptosis of cancer cells [34]. Plant MAPK gene responses to various stresses have also been detected. In our study, gene expression analysis revealed that 16 MAPK genes in Chlamydomonas were involved in response to stress. During iron deficiency, 8 MAPK genes, including CrMAPK3, were upregulated. Therefore, CrMAPK3 possibly responded to iron regulation. These findings were further verified by silencing CrMAPK3, and our results demonstrated that the mRNA levels of FOX1-ARS, the enzyme activities of ARS, and the endogenous mRNA level of CrFOX1 decreased. Therefore, CrMAPK3 positively regulated CrFOX1 expression. The mRNA levels of –Fe-inducing genes, including CrNRAMP2, CrATX1, CrFTR1, and CrFEA1, and the expression of CrMAPK3 were reduced. These findings confirmed that CrMAPK3 positively regulated the expression of iron-absorption genes. However, the exact proteins upstream and downstream of CrMAPK3 should be identified to reveal the MAPK pathway of iron deficiency response in Chlamydomonas.

Methods

Algal strains and culture conditions

C. reinhardtii CC425 (mt) was purchased from the Chlamydomonas Genetics Center at Duke University. C. reinhardtii 2A38 is a transgenic strain with an integrated Fox1 promoter:ARS chimeric gene in C. reinhardtii CC425 genome. Under iron-deficient conditions, the CrFOX1 promoter in 2A38 strain stimulated the ARS gene expression and appeared blue when the XSO4 substrate was added. Liquid cultures were grown in the TAP medium at 26 °C with agitation at 220 rpm under 110 μmol⋅m−2s−1 of continuous light for 3 days and then to the TAP, TAP-Fe, TAP-N, or TAP + 150 mM NaCl media for various time periods (12, 24, and 36 h). Total RNA was extracted to prepare cDNA for gene cloning and real-time PCR assay. All Chlamydomonas strains were cultured in the TAP or deficiency medium of TAP with Hunter’s trace element mix.

Bioinformatics analysis of MAPK gene family of Chlamydomonas

Chlamydomonas MAPK homologous genes were retrieved from Chlamydomonas database (https://phytozome.jgi.doe.gov/pz/portal.html) by using the BLAST of Arabidopsis MAPK. Multiple sequence alignments were generated using ClustalX 2.1 and MEGA6. The following parameters were predicted: molecular weights and isoelectric points of proteins in Expasy (http://web.expasy.org/compute_pi/); protein structures in SMART; and conserved protein motifs in PROSITE (http://prosite.expasy.org/) and MEME (http://meme.nbcr.net/meme/). The structures of CrMAPK genes were generated online by using the Gene Structure Display Server (GSDS) (http://gsds.cbi.pku.edu.cn/), and the homologous chromosome segments were detected using a synteny plot in Plaza (http://bioinformatics.psb.ugent.be/plaza/versions/pico-plaza/synteny/index). The CrMAPK genes were subjected to BLAST analysis in Plaza, and their duplication patterns were detected using a synteny plot. The subcellular localization of Chlamydomonas MAPKs was performed using Euk-mPLoc2.0 (http://www.csbio.sjtu.edu.cn/bioinf/euk-multi-2/).

Statistical analyses

Data were presented as mean ± S.D. One-way ANOVA followed by Duncan’s post-test was performed to examine significant differences between means. In all cases, comparisons showing P < 0.05 were considered significant.

mRNA abundance detection

Three independent cell populations exposed to different stress conditions in various periods were collected. Total RNA was extracted and real-time PCR was performed as described previously [35]. The primers used in this study are listed in Tables 2 and 3. All the products were 300 +/- 50 nt The amplification rate of each transcript (Ct) was calculated using the PCR Base Line Subtracted method performed in the iCycler software at a constant fluorescence level. Cts were determined with three repeats. Relative fold differences were calculated on the basis of the relative quantification analytical method (2-ΔΔCT) using 18 s rRNA amplification as internal standard [36].
Table 2

Primer sequences for amplifying the Chlamydomonas MAPK genes

Primer NamePrimer Sequences
CrMAPK2-FGAGGCAAACCGATACACGAT
CrMAPK2-RCGAGTACTTGGCGAAGAAGG
CrMAPK3-FCGTCCGCAAAAGACAGTGTA
CrMAPK3-RGGAGCACCTGGTAGACGAAG
CrMAPK4-FGCACAGCCTCATAGGAAAGG
CrMAPK4-RCCAATCACTGTGTGCAGGTC
CrMAPK5-FGGAGGTGCACAAGCAGTACA
CrMAPK5-RGTGCTACCCAGCAGGATCTC
CrMAPK6-FCCAGCTCAAGCTCATCATCA
CrMAPK6-RCATCTCGTCAAAGTCCAGCA
CrMAPK7-FAAGACCGGGACAAGTTCCTT
CrMAPK7-RATGTACAGCTCCGCCATGAT
CrMAPK8-FAGAGATTTGAAGCCCAGCAA
CrMAPK8-RACCTTGGTGATGAGGGACAG
CrMAPK9-FGCTGTGCGACTTTGGCTTTGC
CrMAPK9-RTACTTGCGGTCCAGCGTCTCCG
CrMAPK10-FCGTTGTGGCGGTGAAAGG
CrMAPK10-RGAACCCGAAGTCGCACAGC
CrMAPK11-FATCAAGCCCGCCAACATCC
CrMAPK11-RGTTGTCAGATACCAGCACCTCC
CrMAPK12-FGATGCCTTCAAATCTAAAACCG
CrMAPK12-RAAGTCGCACAGCCGCACCAC
CrMAPK13-FTCGGGCACGCCGCTGTTC
CrMAPK13-RTAGCGTGCGACCTGGTGCGG
CrMAPK14-FGGGCGTATGGGTCGGTAT
CrMAPK14-RGCAGGTTGACGATGTTCAC
CrMAPK15-FCACGATTGATGCGATAGAGGAG
CrMAPK15-RAAGGTCGGGAACGGTGGA
CrMAPK16-FTGGCAGTTAGCCTCCGTCATT
CrMAPK16-RCGCAAAGCCAAAGTCGCA
CrMAPK17-FGAGGTTACCGTGCTCAATGGC
CrMAPK17-RGGGTAGCGGTCCTCCAACA
Table 3

Primer sequences for amplifying Chlamydomonas iron responsive genes

Gene NameLocus NamePrimer NamePrimer Sequences
CrARS2Cre16.g671350ARS2-FATGGGTGCCCTCGCGGTGTTC
ARS2-RGTAGCGGATGTACTTGTGCAG
CrFOX1Cre09.g393150FOX1-FGACGTGGAGGCCCAGAAG
FOX1-RCGCGACGAAGTAGGTGTTG
CrFTR1Cre03.g192050FTR1-FTCTTTCGGGAGACCATTGAG
FTR1-RGAAGCATAGCAAAGCCAAGG
CrFEA1Cre12.g546550FEA1-FCTCAAGTACCACCTGCACGA
FEA1-RACATAGCTCTTGCCGAGGAA
CrATX1Cre09.g392467ATX1-FAGCTCGTGTCCTCGTAAAGC
ATX1-RCTGCAACAGGTTCCGTGTAA
CrNRAMP2Cre07.g321951NRAMP2-FCTGTCGCAGGTGATCCTGT
NRAMP2-RTTTGCACCACCAGGTTAATG
Primer sequences for amplifying the Chlamydomonas MAPK genes Primer sequences for amplifying Chlamydomonas iron responsive genes

Construction of CrMAPK3 RNA interference vector and transformation of Chlamydomonas

Using Chlamydomonas cDNA as a template, we amplified the fragments through PCR with forward primer CrMAPK3-F: CGTCCGCAAAAGACAGTGTA and reverse primer CrMAPK3-R: CTTCGTCTACCAGGTGCTCC. We then inserted the amplified fragments into pMD18-T vector to generate CrMAPK3-18 T, which was further digested with HindIII and BamHI and ligated into the intermediate vector T282 to produce CrMAPK3-T282. CrMAPK3-T282-CrMAPK3 with inverted repeat sequence of CrMAPK3 (CrMAPK3IR) was developed by digesting CrMAPK3-18 T and CrMAPK3-T282. CrMAPK3IR was inserted into EcoRI-digested pMaa7/XIR to produce Maa7IR/CrMAPK3IR. Maa7IR/CrMAPK3IR was then transformed into C. reinhardtii 2A38 by applying the glass bead procedure [37].

ARS (arylsulfatase) activity detection

ARS activity was determined as described by Davies and Grossman [38]. XSO4 (10 mM) was added to plates with –Fe TAP solid medium and scribed before clones were inoculated. After 1 day, the transformants that expressed ARS activity were identified using blue halos around their colonies. The cells were initially collected by centrifugation to quantify the ARS activity. The supernatant was mixed with 0.1 M glycineNaOH at pH 9.0, 10 mM imidazole, and 4.5 mM p-nitrophenyl sulfate. The reaction mixture was incubated at 27 °C for 30 min. The reaction was terminated by adding 0.25 M NaOH, and its absorbance at 410 nm was determined. A standard curve of p-nitrophenol (Sigma Chemical Co.) was obtained using 0.2 M NaOH.

Conclusions

Silencing CrMAPK3 decreased the mRNA levels and ARS activities of FOX1:ARS chimeric gene and endogenous CrFOX1. The mRNA levels of iron-responsive genes, such as CrNRAMP2, CrATX1, CrFTR1, and CrFEA1, were also remarkably reduced. Therefore, CrMAPK3 regulated the expression of iron-deficiency-responsive genes in C. reinhardtii.
  38 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

Review 2.  Complexity, cross talk and integration of plant MAP kinase signalling.

Authors:  Claudia Jonak; László Okrész; László Bögre; Heribert Hirt
Journal:  Curr Opin Plant Biol       Date:  2002-10       Impact factor: 7.834

3.  Genome-wide analysis of the mitogen-activated protein kinase gene family in Solanum lycopersicum.

Authors:  Fuling Kong; Jie Wang; Lin Cheng; Songyu Liu; Jian Wu; Zhen Peng; Gang Lu
Journal:  Gene       Date:  2012-01-28       Impact factor: 3.688

4.  A ferroxidase encoded by FOX1 contributes to iron assimilation under conditions of poor iron nutrition in Chlamydomonas.

Authors:  Jen-Chih Chen; Scott I Hsieh; Janette Kropat; Sabeeha S Merchant
Journal:  Eukaryot Cell       Date:  2008-02-01

5.  Metal ion chaperone function of the soluble Cu(I) receptor Atx1.

Authors:  R A Pufahl; C P Singer; K L Peariso; S J Lin; P J Schmidt; C J Fahrni; V C Culotta; J E Penner-Hahn; T V O'Halloran
Journal:  Science       Date:  1997-10-31       Impact factor: 47.728

6.  Elicitor- and A23187-induced expression of WCK-1, a gene encoding mitogen-activated protein kinase in wheat.

Authors:  D Takezawa
Journal:  Plant Mol Biol       Date:  1999-08       Impact factor: 4.076

7.  FEA1, FEA2, and FRE1, encoding two homologous secreted proteins and a candidate ferrireductase, are expressed coordinately with FOX1 and FTR1 in iron-deficient Chlamydomonas reinhardtii.

Authors:  Michael D Allen; José A del Campo; Janette Kropat; Sabeeha S Merchant
Journal:  Eukaryot Cell       Date:  2007-07-27

8.  ATMPKs: a gene family of plant MAP kinases in Arabidopsis thaliana.

Authors:  T Mizoguchi; N Hayashida; K Yamaguchi-Shinozaki; H Kamada; K Shinozaki
Journal:  FEBS Lett       Date:  1993-12-28       Impact factor: 4.124

9.  MAP-ping genomic organization and organ-specific expression profiles of poplar MAP kinases and MAP kinase kinases.

Authors:  Marie-Claude Nicole; Louis-Philippe Hamel; Marie-Josée Morency; Nathalie Beaudoin; Brian E Ellis; Armand Séguin
Journal:  BMC Genomics       Date:  2006-08-31       Impact factor: 3.969

10.  Identification of new members of the MAPK gene family in plants shows diverse conserved domains and novel activation loop variants.

Authors:  Tapan Kumar Mohanta; Pankaj Kumar Arora; Nibedita Mohanta; Pratap Parida; Hanhong Bae
Journal:  BMC Genomics       Date:  2015-02-06       Impact factor: 3.969

View more
  4 in total

1.  TaMIR1139: a wheat miRNA responsive to Pi-starvation, acts a critical mediator in modulating plant tolerance to Pi deprivation.

Authors:  Zhipeng Liu; Xiaoying Wang; Xi Chen; Guiqing Shi; Qianqian Bai; Kai Xiao
Journal:  Plant Cell Rep       Date:  2018-06-09       Impact factor: 4.570

2.  Identification of the MAPK Cascade and its Relationship with Nitrogen Metabolism in the Green Alga Chlamydomonas reinhardtii.

Authors:  Aitor Gomez-Osuna; Victoria Calatrava; Aurora Galvan; Emilio Fernandez; Angel Llamas
Journal:  Int J Mol Sci       Date:  2020-05-12       Impact factor: 5.923

Review 3.  Regulation of Iron Homeostasis and Use in Chloroplasts.

Authors:  Gretchen E Kroh; Marinus Pilon
Journal:  Int J Mol Sci       Date:  2020-05-11       Impact factor: 5.923

4.  Chlamydomonas CHT7 is involved in repressing DNA replication and mitotic genes during synchronous growth.

Authors:  Yang-Tsung Lin; Tomomi Takeuchi; Brian Youk; James Umen; Barbara B Sears; Christoph Benning
Journal:  G3 (Bethesda)       Date:  2022-03-04       Impact factor: 3.154

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.