Chengyi Jiang1, Hongtao Wang2, Lei Zhou3, Tao Jiang1, Yajia Xu1, Lin Xia1. 1. Department of Otolaryngology Head and Neck Surgery, The First Affiliated Hospital of Bengbu Medical College, Bengbu, Anhui, P.R. China. 2. Department of Immunology, Bengbu Medical College, Bengbu, Anhui, P.R. China. 3. Department of Pathology, Bengbu Medical College, Bengbu, Anhui, P.R. China.
Abstract
MicroRNAs are important factors in the pathogenic processes of human types of cancers including nasopharyngeal carcinoma (NPC). In the present study, we confirmed that the microRNA-212 expression level was significantly decreased both in NPC tissues and NPC cell lines. Decreased expression of miR-212 was associated with advanced tumor-node-metastasis (TNM) stage and metastasis of NPC. Patients with a lower level of miR-212 had significantly decreased rates of overall and disease-free survival. Functional experiments showed that forced expression of miR-212 inhibited the migration and invasion of NPC cells while inhibition of miR-212 increased the migration and invasion of NPC cells. Furthermore, the results of luciferase assay, qRT-PCR and western blotting showed that SOX4 was the direct downstream target of miR-212 in NPC cells. In addition, we further confirmed that miR-212 exerted its inhibitory influence on the migration and invasion of NPC cells by targeting SOX4.
MicroRNAs are important factors in the pathogenic processes of human types of cancers including nasopharyngeal carcinoma (NPC). In the present study, we confirmed that the microRNA-212 expression level was significantly decreased both in NPC tissues and NPC cell lines. Decreased expression of miR-212 was associated with advanced tumor-node-metastasis (TNM) stage and metastasis of NPC. Patients with a lower level of miR-212 had significantly decreased rates of overall and disease-free survival. Functional experiments showed that forced expression of miR-212 inhibited the migration and invasion of NPC cells while inhibition of miR-212 increased the migration and invasion of NPC cells. Furthermore, the results of luciferase assay, qRT-PCR and western blotting showed that SOX4 was the direct downstream target of miR-212 in NPC cells. In addition, we further confirmed that miR-212 exerted its inhibitory influence on the migration and invasion of NPC cells by targeting SOX4.
Nasopharyngeal carcinoma (NPC) is one of the most common cancers in China and is closely associated with Epstein-Barr virus (EBV) infection (1,2). Although marked advances have been achieved in NPC treatment (3), the long-term prognosis of NPC patients is still unsatisfactory. The metastasis of NPC is an important reason for the dismal survival of NPC patients in advanced stages. Therefore, it is critical to elucidate the molecular mechanisms underlying the metastatic behavior of NPC cells.MicroRNAs (miRNAs) are a group of short non-coding RNAs that inhibit gene expression by interacting with the 3′-UTR of targeted mRNAs (4). miRNAs are involved in numerous cellular processes including cell growth, differentiation, apoptosis and motility (5). Numerous studies have demonstrated that abnormal expression and function of miRNAs play oncogenic or tumor-suppressive roles in the development and progression of humancancers (6–8).Among the numerous cancer-related miRNAs, miR-212 was recently found to be a novel cancer-related miRNA. Studies of non-small cell lung cancer (NSCLC) (9,10), gastric (11) and hepatocellular carcinoma (12), and colon cancer (13) have shown that miR-212 plays a tumor-suppressive role in these cancers. In contrast, miR-212 plays an oncogenic role in humancancers including prostate (14) and pancreatic cancer (15). Therefore, the exact biological functions of miR-212 in humancancers are dependent on the cancer type. However, the expression and functional role of miR-212 in NPC remain unclear.In the present study, we found that the miR-212 expression level was decreased in NPC tissues and cells, and decreased expression of miR-212 was associated with adverse clinical features and poor prognosis of NPC patients. Functionally, miR-212 inhibited the migration and invasion of NPC cells. Furthermore, SOX4 was identified as a direct functional downstream target of miR-212.
Materials and methods
Clinical specimens
Seventy-three NPC and 30 normal nasopharyngeal tissues were obtained from the Department of Otolaryngology Head and Neck Surgery, The First Affiliated Hospital of Bengbu Medical College from January 2003 to December 2010. The NPC patients received no perioperative radiotherapy or chemotherapy prior to surgery. Written informed consent was obtained from all patients enrolled in the present study. The demographic and clinicopathological features of all patients are documented in Table I. The Ethics Committee of Bengbu Medical College approved all protocols involving the patient samples according to the Declaration of Helsinki (as revised in Tokyo 2004).
Table I.
Correlation analysis between the clinical features and expression of miR-212 in the NPC cases.
Human NPC cell lines 5–8F, 6-10B, CNE-1 and CNE-2 were purchased from the Cancer Center of Sun Yat-Sen University (Guagzhou, China) and cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS) (both from Gibco, Grand Island, NY, USA), 100 U/ml penicillin and 100 U/ml streptomycin. The human immortalized nasopharyngeal epithelial cell line NP69 was cultured in serum-free medium (Invitrogen, Carlsbad, CA, USA) supplemented with all necessary growth factors (Gibco). All cells were maintained in a humidified cell incubator with 5% CO2.The miR-212 mimics and inhibitor, and the corresponding negative control vectors were obtained from GeneCopoeia (Guangzhou, China). SOX4 siRNA and SOX4 overexpression vectors were obtained from Addgene (Cambridge, MA, USA). All the vectors were transfected into NPC cells to overexpress or inhibit the expression of miR-212 or SOX4 in NPC cells based on the instructions provided for Lipofectamine 2000.
TPIzol (Invitrogen) was used to extract the RNA from clinical specimens and NPC cells following the manufacturer's instructions. PCR amplification and quantification for miR-212 were performed using the TaqMan miRNA reverse transcription kit and the TaqMan human miRNA assay kit (both from Applied Biosystems, Foster City, CA, USA). Primers for miRNA miR-212 and U6 (HmiRQP9001) were purchased from GeneCopoeia. U6 was used as the internal control for measuring the relative level of miR-212.
Western blotting
Cellular proteins extracted from NPC cells using RIPA lysis buffer (BioMed, Beijing, China) were separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and were transferred to polyvinylidene fluoride (PVDF) membranes. The blots were incubated with the following primary antibodies overnight: GAPDH (1:2,500; Cell Signaling Technologies, Danvers, MA, USA) and SOX4 (1:500; Santa Cruz Biotechnology, Santa Cruz, CA, USA). After incubating with the primary antibody, the membranes were incubated with secondary antibodies (1:5,000; Bio-Rad, Hercules, CA, USA) at room temperature for 2 h, and then the protein signals were detected using the Bio-Rad Gel imaging system.
Transwell assays
NPC cells (1×105) transfected with the corresponding vectors were re-suspended in serum-free medium, and were seeded into the Transwell inserts of 8-µm pore size (Millipore, Billerica, MA, USA). Serum-containing medium (650 µl) (20% FBS) was added to the lower chamber as the attractant. Regarding the invasion assay, each upper chamber was coated with a mixture of Dulbeccos modified Eagles medium (DMEM) and Matrigel (Becton-Dickinson Labware, Franklin Lakes, NJ, USA) at a ratio of 8:1. Twenty-four hours later, the NPC cells that had migrated or invaded through the Transwell membranes on the lower surface were stained with 0.1% crystal violet, and the cell numbers were counted from 10 different fields of the lower surface of the filter. Three independent experiments were performed.
Luciferase reporter assay
Wild-type SOX4 3′-UTR sequence and the mutated SOX4 3′-UTR sequence were constructed into the pGL3 control vector (Promega, Madison, WI, USA) to obtain the wt SOX4-3′-UTR and mt SOX4-3′-UTR vector, respectively. Primers for SOX4 3′UTR are listed as follows: wild-type SOX4 3′UTR forward, GAGCTCCTCCGCCTTCT TTTCTAC and reverse, CTCGAGCACGTCTTCTCATTTA CACC; mutant SOX4 3′UTR forward, GAGCATTTGATGTG GTACAGGGGCAG and reverse, TCCTCTCCTCCACGCC TCCGGGGTC. For the luciferase reporter assay, NPC cells were co-transfected with the wild-type or mutant construct, and miR-212 mimics (CNE-2 cells), or inhibitor (6-10B cells), or control, or negative control vector. Forty-eight hours after transfection, the cells were harvested and lysed. The Dual-Luciferase reporter assay system (Promega, Shanghai, China) was used to measure the firefly and Renilla luciferase activities.
Statistical analysis
Statistical analysis was conducted with GraphPad Prism 5 software (GraphPad Software, Inc., La Jolla, CA, USA). Statistical analysis including the Pearson's Chi-square test, the Spearman's rank correlation coefficient, the two-tailed Student's t-test and Kaplan-Meier plots were used in the present study. P<0.05 was considered to indicate statistically significant difference.
Results
The expression level of miR-212 is decreased in NPC tissues and cells
The expression level of miR-212 in clinical tissues derived from NPC patients was evaluated by qRT-PCR. As shown in Fig. 1A, the expression level of miR-212 in NPC tissues was significantly lower than that in normal tissues (P<0.01, Fig. 1A). Moreover, the expression level of miR-212 was significantly decreased in patients with metastasis (P<0.05, Fig. 1B) and patients in tumor-node-metastasis (TNM) stage III–IV (P<0.05, Fig. 1C). Next, we compared the expression of miR-212 among 4 NPC cell lines (6-10B, 5–8F, CNE1 and CNE2) and NP69 a nasopharyngeal epithelial cell line. Compared with the NP69 cells, all NPC cells had a significantly decreased miR-212 level (P<0.05, Fig. 1D). These data suggest that miR-212 plays a tumor-suppressive role in NPC and is involved in the progression of NPC.
Figure 1.
Decreased expression level of miR-212 in NPC tissues and cells. RNA was extracted from the NPC tissue specimens and qRT-PCR was performed to evaluate the miR-212 level in these samples. Then, the differences in miR-212 expression were compared between (A) NPC and normal tissues; (B) patients with and without metastasis; (C) patients with tumors of TNM I–II stages and those of TNM III–IV stages; and (D) normal human nasopharyngeal epithelial cell line (NP-69) and NPC cell lines (CNE-1, CNE-2, 5-8F and 6-10B). *P<0.05, **P<0.01.
Decreased level of miR-212 is associated with the adverse clinicopathological features and poor prognosis of NPC patients
We investigated the clinical significance of the decreased expression level of miR-212 in NPC. We divided the NPC patients into two groups based on the cut-off value which was defined as the median value of the miR-212 level: miR-212 low expression group (n=36) and miR-212 high expression group (n=37). Then, the correlation between the clinicopathological features of the NPC patients and miR-212 level was evaluated. As shown in Table I, a decreased expression level of miR-212 was significantly associated with advanced TNM stage (P=0.013), and the occurrence of metastasis of NPC (P<0.001). Furthermore, Kaplan-Meier analysis showed that patients with a low expression level of miR-212 had a significantly lower overall survival rate (P=0.0158, Fig. 2A) and disease-free survival rate (P=0.0092, Fig. 2B).
Figure 2.
A decreased level of miR-212 is associated with the poor prognosis of NPC patients. Patients were divided into 2 groups based on the cut-off value which was defined as the median value of the miR-212 levels: miR-212 low and miR-212 high group. Compared with the patients with a high miR-212 level, patients with a low miR-212 level had a significantly decreased (A) overall and (B) disease-free survival rate.
miR-212 inhibits the migration and invasion of NPC cells
After confirming the expression status and clinical significance of miR-212 in NPC, we examined the biological functions of miR-212 in NPC cells. In addition, a significant association between miR-212 and TNM stage and metastasis motivated us to investigate whether miR-212 modulates the metastatic behaviors of NPC cells. Transfection of the miR-212 mimic into the CNE-2 cells significantly increased the expression level of miR-212 (P<0.01, Fig. 3A). Subsequently, overexpression of miR-212 in the CNE-2 cells led to significantly decreased migration (P<0.05, Fig. 3B) and invasion (P<0.01, Fig. 3C) of CNE-2 cells. To further confirm functional influences of miR-212 on the migration and invasion of NPC cells, we downregulated the expression of miR-212 in 6-10B cells with the miR-212 inhibitor. Transfection of the miR-212 inhibitor significantly decreased the level of miR-212 in the 6-10B cells (P<0.01, Fig. 3D), and led to significantly increased migration (P<0.01, Fig. 3E) and invasion (P<0.01, Fig. 3F) of 6-10B cells.
Figure 3.
miR-212 inhibits the migration and invasion of NPC cells. CNE-2 and 6-10B cells were transfected with miR-212 mimc and inhibitor, respectively. Transwell assay was used to examine the alteration in the migratory and invasive abilities. (A) Transfection of miR-212 mimic significantly increased miR-212 expression in the CNE-2 cells. Overexpression of miR-212 significantly decreased the (B) migration and (C) invasion abilities of the CNE-2 cells. (D) miR-212 inhibitor significantly reduced the expression of miR-212 in the 6-10B cells. Downregulation of miR-212 significantly reduced the (E) migration and (F) invasion abilities of the 6-10B cells. *P<0.05, **P<0.01.
SOX4 is a the direct downstream target of miR-212 in NPC cells
To elucidate the molecular mechanisms responsible for the functional influence of miR-212 in NPC cells, we searched publically available database TargetScan to identify the downstream target of miR-212. Data from TargetScan showed that SOX4, a well-known oncogenic protein in humancancers (16–19), was a possible downstream target of miR-212. As suggested by Fig. 4A, the sequences complementary to the binding sites of miR-212 were found in the 3′-UTR of SOX4. Then, we performed luciferase reporter assay to further confirm that miR-212 could bind to the 3′-UTR of SOX4. The results showed that forced expression miR-212 significantly decreased the luciferase activity of wild-type SOX4 3′-UTR (P<0.01, Fig. 4B) while had no influence on that of the mutant SOX4 3′-UTR (Fig. 4B). Furthermore, inhibition of miR-212 expression increased the luciferase activity of wild-type SOX4 3′-UTR (P<0.05, Fig. 4C) and did not affect the luciferase activity of mutant SOX4 3′-UTR. After confirming that miR-212 affected the luciferase activity of SOX4 3′-UTR by interacting with the 3′-UTR of SOX4, we performed qRT-PCR and western blotting to confirm that miR-212 modulates the expression of SOX4 in NPC cells. The results of qRT-PCR and western blotting demonstrated that forced expression of miR-212 significantly reduced the mRNA (P<0.05, Fig. 5A) and protein (P<0.01, Fig. 5B) levels of SOX4 in the CNE-2 cells. In contrast, knockdown of miR-212 significantly increased the mRNA (P<0.05, Fig. 5C) and protein (P<0.01, Fig. 5D) levels of SOX4 in the 6-10B cells. These data demonstrated that SOX4 is a direct downstream target of miR-212 in NPC cells.
Figure 4.
miR-212 interacts with the 3′-UTR of SOX4. (A) miR-212 and its predicted complementary sequence in the wild-type SOX4 3′-UTR. The mutant miR-212 binding site was generated in the complementary site for the seed region of miR-212. CNE-2 cells were co-transfected with the wild-type SOX4 3′-UTR construct or mutant SOX4 3′-UTR construct, along with miR-212 mimics or control vector. Forty-eight hours after transfection, cells were lysed for the Dual-Luciferase reporter assay. (B) Overexpression of miR-212 significantly inhibited the luciferase activity of wt 3′-UTR of SOX4, but had no obvious influence on mt 3′-UTR of SOX4. 6-10B cells were co-transfected with the wild-type SOX4 3′-UTR construct or mutant SOX4 3′-UTR construct, along with the miR-212 inhibitor or negative control vector. Forty-eight hours after transfection, the cells were lysed for the Dual-Luciferase reporter assay. (C) Knockdown of miR-212 significantly increased the luciferase activity of wt 3′-UTR of SOX4, but had no obvious influence on mt 3′-UTR of SOX4. *P<0.05, **P<0.01.
Figure 5.
miR-212 regulates the expression of SOX4 in NPC cells. CNE-2 and 6-10B cells were transfected with the miR-212 mimic and inhibitor, respectively. Western blotting and qRT-PCR were used to examine the alteration of SOX4 mRNA and protein. Overexpression of miR-212 significantly reduced the (A) mRNA and (B) protein level of SOX4 in the CNE-2 cells. Inhibition of miR-212 resulted in obviously increased (C) mRNA and (D) protein levels of SOX4 in the 6-10B cells. *P<0.05, **P<0.01.
miR-212 inhibits the migration and invasion of NPC cells by targeting SOX4
To further clarify whether SOX4 is not only a downstream target of miR-212, but also a functional mediator of miR-212 in NPC cells, we performed the transfection of the SOX4-expressing vector into CNE-2 cells with miR-212 overexpression (CNE-2-miR-212 cells). Transfection of the SOX4 overexpression vector significantly increased SOX4 expression in the CNE-2-miR-212 cells (P<0.05, Fig. 6A). Subsequently, SOX4 overexpression abrogated the inhibitory effects of miR-212 on the migration (P<0.05, Fig. 6B) and invasion (P<0.01, Fig. 6C) of CNE-2 cells. In contrast-, SOX4 siRNA transfection into 6-10B cells with miR-212 knockdown (6-10B-anti-miR-212 cells) significantly reduced the expression of SOX4 (P<0.05, Fig. 6D). Knockdown of SOX4 reversed the promoting effects of the miR-212 inhibitor on the migration (P<0.01, Fig. 6E) and invasion (P<0.01, Fig. 6F) of 6-10B cells. These findings indicate that SOX4 is not only a downstream target of miR-212, but also a functional mediator of miR-212 in NPC cells.
Figure 6.
SOX4 mediates the inhibitory effects of miR-212 on migration and invasion of NPC cells. The SOX4 vector was transfected into CNE-2 cells with miR-212 overexpression. (A) SOX4 overexpression vector significantly increased SOX4 expression in the CNE-2-miR-212 cells. Restoration of SOX4 in the CNE-2-miR-212 cells abrogated the inhibitory effect of miR-212 mimics on (B) migration and (C) invasion of CNE-2 cels. SOX4 siRNA was transfected into 6-10B cells with miR-212 knockdown. (D) SOX4 siRNA significantly decreased SOX4 expression in the 6-10B-anti-miR-212 cells. Inhibition of SOX4 in the 6-10B-anti-miR-212 cells prevented the promoting effect of miR-212 inhibitor on (E) migration and (F) invasion of 6-10B cells. *P<0.05, **P<0.01.
Discussion
Local and systemic metastasis of NPC is the culprit for the dismal survival of NPC patients in advanced stages (20). Recently, miRNAs were identified as a group of important regulators in cancer metastatic processes (21). In addition, miRNAs have been regarded as attractive therapeutic targets and biomarkers of humancancers including NPC (22).Previous studies have shown that miR-212 is actively involved in the pathogenic processes of various types of humancancers. miR-212 was found to exert a tumor-suppressive role in non-small cell lung cancer (NSCLC) (9), gastric (11) and hepatocellular carcinoma (HCC) (12). However, miR-212 was also found to play an oncogenic role in humancancers including prostate (14) and pancreatic cancer (15). In the present study, we found that the expression of miR-212 was decreased in NPC clinical tissues and cell lines, suggesting a tumor-suppressive role of miR-212 in NPC. In addition, a decreased level of miR-212 was associated with the adverse clinical features of the NPC patients including TNM stage and metastasis. Importantly, a decreased level of miR-212 conferred a significantly decreased survival rate of the NPC patients. These data demonstrated that miR-212 plays a tumor-suppressive role in NPC, and can potentially serve as a novel biomarker for NPC patients.Increased metastatic ability is a prominent hallmark of humancancers. The present study showed that miR-212 overexpression inhibited the migration and invasion of NPC cells while miR-212 knockdown potentiated the metastatic ability of NPC cells. These findings suggest that miR-212 inhibits the progression of NPC by preventing the migration and invasion of NPC cells. Notably, a recent study on HCC showed that miR-212 exerted its tumor-suppressive role in HCC by modulating the growth of HCC cells (12). These studies indicate that the biological functions of miR-212 are dependent on the type of cancer.SOX4, a protein belonging to the SOX family, is a critical oncogenic protein and a versatile factor in humancancers (16,23). Importantly, SOX4 was found to promote the progression of NPC by contributing to the metastasis of NPC cells (19). In the present study, we found that SOX4 is a downstream target of miR-212 in NPC cells which was supported by data from the luciferase assay, qRT-PCR and western blotting. Moreover, functional assays showed that the alteration of SOX4 expression abrogated the functional influence of miR-212 on the migration and invasion of NC cells, indicating that SOX4 is also a functional mediator downstream of miR-212 in NPC cells.In conclusion, the present study demonstrated that miR-212 is significantly decreased in NPC. A decreased level of miR-212 was found to be correlated with poor clinicopathological features and prognosis of NPC patients. Functionally, miR-212 inhibited the migration and invasion of NPC cells. Moreover, SOX4 was identified as a direct downstream target and a functional mediator of miR-212 in NPC cells.
Authors: Chenchao Ma; Kate Nong; Bo Wu; Bo Dong; Yueqing Bai; Hongda Zhu; Weiwei Wang; Xinyu Huang; Zhou Yuan; Kaixing Ai Journal: J Exp Clin Cancer Res Date: 2014-06-25
Authors: Pierre-Antoine Bissey; Mona Teng; Jacqueline H Law; Wei Shi; Jeff P Bruce; Valentin Petit; Sai W Tsao; Kenneth W Yip; Fei-Fei Liu Journal: BMC Cancer Date: 2020-06-26 Impact factor: 4.430