| Literature DB >> 28503491 |
María E Cáceres1, Analía I Etcheverría1, Daniel Fernández2, Edgardo M Rodríguez3, Nora L Padola1.
Abstract
Shiga toxin-producing Escherichia coli (STEC) are pathogens of significant public health concern. Several studies have confirmed that cattle are the main reservoir of STEC in Argentina and other countries. Although Shiga toxins represent the primary virulence factors of STEC, the adherence and colonization of the gut are also important in the pathogenesis of the bacteria. The aim of this study was to analyze and to compare the presence of putative virulence factors codified in plasmid -katP, espP, subA, stcE- and adhesins involved in colonization of cattle -efa1, iha- in 255 native STEC strains isolated from different categories of cattle from different production systems. The most prevalent gene in all strains was espP, and the less prevalent was stcE. katP was highly detected in strains isolated from young and rearing calves (33.3%), while subA was predominant in those isolated from adults (71.21%). Strains from young calves showed the highest percentage of efa1 (72.46%), while iha showed a high distribution in strains from rearing calves and adults (87.04 and 98.48% respectively). It was observed that espP and iha were widely distributed throughout all strains, whereas katP, stcE, and efa1 were more associated with the presence of eae and subA with the eae-negative strains. A great proportion of eae-negative strains were isolated from adults -dairy and grazing farms- and from rearing calves -dairy and feedlot-, while mostly of the eae-positive strains were isolated from dairy young calves. Data exposed indicate a correlation between the category of the animal and the production systems with the presence or absence of several genes implicated in adherence and virulence of STEC.Entities:
Keywords: adhesins; category of cattle; plasmid genes; production systems; shiga toxin-producing Escherichia coli
Mesh:
Substances:
Year: 2017 PMID: 28503491 PMCID: PMC5408013 DOI: 10.3389/fcimb.2017.00147
Source DB: PubMed Journal: Front Cell Infect Microbiol ISSN: 2235-2988 Impact factor: 5.293
Characteristics of the PCR primers used in this study.
| GCGCCAGTGGTGGTCAGCAA | 914 | Bustamante et al., | ||
| ATATCGGGCTGCCGGTCCCA | ||||
| GCTGGCAACCAGCAACAGCG | 774 | Bustamante et al., | ||
| CGGTAGCCCGCTTCTGCACC | ||||
| TATGGCTTCCCTCATTGCC | 556 | Paton and Paton, | ||
| TATAGCTGTTGCTTCTGACG | ||||
| GGCTCCGGAGGTGGGGGAAT | 399 | Bustamante et al., | ||
| GAAGCCGGTGGAGGAACGGC | ||||
| CAAATGGCTCTCTTCCGTCAATGC | 925 | Szalo et al., | ||
| CAGGTCGGGGTTACCAAGT | ||||
| 88T14 | GAGACTGCCAGAGAAAG | 479 | Nicholls et al., | |
| 88T9 | GGTATTGTTGCATGTTCAG |
Figure 1Distribution of virulence factors in STEC strains among the different categories of cattle.
Virulence profile carried by STEC clasified according to the category of cattle.
| Young calves ( | 15 (21.73) | |
| 10 (14.5) | ||
| 10 (14.5) | ||
| 8 (11.6) | ||
| 5 (7.2) | ||
| 4 | ||
| 2 | ||
| 2 | ||
| 2 | ||
| 2 | ||
| 2 | ||
| 1 | ||
| 1 | ||
| 1 | ||
| 1 | ||
| 1 | ||
| 1 | ||
| 1 | ||
| Rearing calves ( | 20 (37) | |
| 6 (11) | ||
| 5 (9.2) | ||
| 5 (9.2) | ||
| 4 (7.4) | ||
| 3 | ||
| 2 | ||
| 2 | ||
| 2 | ||
| 1 | ||
| 1 | ||
| 1 | ||
| 1 | ||
| 1 | ||
| Adults ( | 91 (68.3) | |
| 25 (19) | ||
| 3 (2.2) | ||
| 2 | ||
| 2 | ||
| 2 | ||
| 2 | ||
| 2 | ||
| 1 | ||
| 1 | ||
| 1 |
Virulence profiles in STEC strain according to presence or absence of .
| 18 | O5:NM, O8:H16, O8:H25, O20:HNT, O26:H11, O38:H39, O103:NM, O103:H2/H8/H18, O111:NM, O113:H2, O118:H16, O145:NM, O146:NM, O153:H25, O157:H7, O165:NM, O171:H25, O172:NM/H21, NT | 116 | O2:H5, O8:H19/H20, O20:H19, O27:H21, O37:H10, O39:H49, O46:H11, O41:H38, O55:NM, O64:NM, O74:H28, O79:NM, O88:H25, O91:H8/H21/H28, O103:H21, O105:H18, O113:H2/H21, O116:H21, O130:H11, O141:H7/H8, O153:H21/H25, O163:H19/H21, O174: H21, O178:H2/H7/H8/H19/H25/H28/H29, O179:NM, ONT:H7/H11/H46, NT, Autoaglutinante. | ||
| 18 | 31 | ||||
| 10 | 5 | ||||
| 9 | 2 | ||||
| 8 | 2 | ||||
| 7 | 2 | ||||
| 5 | 2 | ||||
| 2 | 1 | ||||
| 2 | 1 | ||||
| 2 | 1 | ||||
| 2 | 1 | ||||
| 1 | 1 | ||||
| 1 | |||||
| 1 | |||||
| 1 | |||||
| 1 | |||||