Eunbi Kim1, Won Sun Park2, Seok-Ho Hong1. 1. Department of Internal Medicine, School of Medicine, Kangwon National University, Chuncheon 24341, Korea. 2. Department of Physiology, School of Medicine, Kangwon National University, Chuncheon 24341, Korea.
Abstract
Potassium channels, the largest group of pore proteins, selectively regulate the flow of potassium (K+) ions across cell membranes. The activity and expression of K+ channels are critical for the maintenance of normal functions in vessels and neurons, and for the regulation of cell differentiation and maturation. However, their role and expression in stem cells have been poorly understood. In this study, we isolated perivascular stem cells (PVCs) from human umbilical cords and investigated the expression patterns of big-conductance Ca2+-activated K+ (BKCa) and voltage-dependent K+ (Kv) channels using the reverse transcription polymerase chain reaction. We also examined the effect of high glucose (HG, 25 mM) on expression levels of BKCa and Kv channels in PVCs. KCa1.1, KCaβ3, Kv1.3, Kv3.2, and Kv6.1 were detected in undifferentiated PVCs. In addition, HG treatment increased the amounts of BKCaβ3a, BKCaβ4, Kv1.3, Kv1.6, and Kv6.1 transcripts. These results suggested that ion channels may have important functions in the growth and differentiation of PVCs, which could be influenced by HG exposure.
Potassium channels, the largest group of pore proteins, selectively regulate the flow of potassium (K+) ions across cell membranes. The activity and expression of K+ channels are critical for the maintenance of normal functions in vessels and neurons, and for the regulation of cell differentiation and maturation. However, their role and expression in stem cells have been poorly understood. In this study, we isolated perivascular stem cells (PVCs) from human umbilical cords and investigated the expression patterns of big-conductance Ca2+-activated K+ (BKCa) and voltage-dependent K+ (Kv) channels using the reverse transcription polymerase chain reaction. We also examined the effect of high glucose (HG, 25 mM) on expression levels of BKCa and Kv channels in PVCs. KCa1.1, KCaβ3, Kv1.3, Kv3.2, and Kv6.1 were detected in undifferentiated PVCs. In addition, HG treatment increased the amounts of BKCaβ3a, BKCaβ4, Kv1.3, Kv1.6, and Kv6.1 transcripts. These results suggested that ion channels may have important functions in the growth and differentiation of PVCs, which could be influenced by HG exposure.
Entities:
Keywords:
Cell therapy; High glucose; Ion channel; Perivascular stem cell
Perivascular stem cells (PVCs), originating from mesenchymal stem cells (MSCs), have
greater proliferation and differentiation potentials compared to those of bone
marrow-derived MSCs (Crisan et al., 2008).
Among the PVC sources, human umbilical cords (HUC) have some advantages over other
tissues because they are easily accessible as a clinical waste product and have low
inherent immunogenicity (Nagamura-Inoue et
al.). For these reasons, HUCPVCs have drawn
considerable interest as a promising material for regenerative medicine. In recent
years, the therapeutic effects of HUCPVCs on various diseases have been reported.
Tsang et al. (2013) showed that HUCPVCs
contributed to skeletal regeneration by generating a matrix and recruiting resident
progenitors in a bone defect model. HUCPVCs also contributed to the repair of
injured lung tissue as well as protected against neurodegenerative diseases through
paracrine effects (Montemurro et al., 2011;
Appaix et al., 2014). Thus, the
identification and functional assessment of internal and external factors regulating
PVC functions are critical for improving their therapeutic potential.Potassium channels, the largest group of pore proteins, are widely distributed in
various cell types (Day et al., 1993; Park et al.). They
selectively regulate the flow of potassium (K+) ions across cell
membranes (Day et al., 1993). K+
channels have important roles in maintaining normal functions and physiological
homeostasis in various cell types as well as regulating the cell cycle,
differentiation, and maturation (Kawano et al.,
2002). Although several studies have characterized the
electrophysiological properties of MSCs and pluripotent stem cells (Heubach et al., 2003; Li et al., 2005; Wang et al.
2005; Bai et al., 2007; Park et al., 2007; Jiang et al., 2010; Park et
al., 2013; Tarasov et al., 2017),
the expression and function of ion channels in HUCPVCs have not been studied.
Therefore, for therapeutic applications, we need to investigate not only the
multi-lineage differentiation capacity, but also the electrophysiological properties
of K+ channels in HUCPVCs. In the present study, we investigated the
expression pa tterns of big-conductance Ca2+-activated (BKCa)
and vol tage-dependent K+ (Kv) channels in undifferentiated
HUCPVCs and examined the effects of high glucose (HG, 25 mM) on the expression
levels of BKCa and Kv channels.
MATERIALS AND METHODS
1. Cell isolation and culture
HUC tissues (n = 3) were obtained from mothers undergoing Caesarian sections,
with written informed consent after approval by the Institutional Review Board
of Kangwon National University Hospital. The isolation and culturing of HUCPVCs
were performed as described previously (An et
al., 2015a). Briefly, HUCs were rinsed with sterile
phosphate-buffered saline (PBS; Sigma-Aldrich) and incised along their length in
dishes. Both ends of the isolated vessels were ligated with black silk and then
transferred into 100 mm culture dishes containing α-minimal essential media
(MEM) supplemented with 10% fetal bovine serum (FBS; Hyclone), 1%
penicillin-streptomycin (Sigma-Aldrich) and amphotericin B (0.3 µg/mL;
Sigma-Aldrich). After 7-10 days, the vessels were removed from the dishes and
the colonies were subcultured. Once the cells reached 80% confluency, they were
passaged by treatment with 0.05% trypsin-EDTA (Sigma-Aldrich). To evaluate the
effect of high glucose on the expression of ion channels in PVCs, the cells were
plated at a density of 4×105 cells in 35 mm dishes and cultured in
α-MEM medium supplemented with low glucose (LG) (1.0 g/L, 5 mM) and HG (4.5 g/L,
25 mM) for 5 days.
2. Flow cytometry analysis
HUCPVCs were dissociated into single cells using trypsin-EDTA and resuspended in
1% FBS-PBS. The cells were filtered through a 70 µm cell strainer and reacted
with the following antibodies conjugated with fluorochrome for 1 hr at 4℃:
CD31-phycoerythrin (PE), CD34-fluorescein-isothiocyanate (FITC),
CD45-allophycoerythrin (APC), CD44-APC, CD90-APC, CD146-FITC, and SSEA-4-FITC
(all, BD Biosciences). The dead cells were excluded with 7-aminoactinomycin D.
Stained cells were analyzed using the FACSCanto II (BD Biosciences) and data
were analyzed by FlowJo software (FlowJo).
Total RNA was isolated using the RNeasy Mini Kit (Qiagen) according to the
manufacturer’s instructions. Briefly, total RNA was reverse transcribed by using
the TOPscript™ RT DryMIX kit (#RT200; Enzynomics). Transcripts were
quantitated using TOPreal™ qPCR 2X PreMIX (#RT501S; Enzynomics) and
the ABI StepOnePlus™ System Instrument (Applied Biosystems). The
expression levels of BKCa and Kv channel genes were
normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and the relative
quantification was performed using the comparative CT method according to the
manufacturer’s instructions (Applied Biosystems). The primer sequences are
listed in Table 1.
Table 1
List of primer sequences for RT-PCR
Gene
Forward (5' to 3')
Reverse (5' to 3')
BKCa1.1
AGGAATGCATCTTGGCGTCACT
GCGGCAGCGGTCCCTATT
BKCa2.1
TGGAGGGGGCAGCTGAAGGAGAAC
CCGCCCCACGCTGCCATTGT
BKCa2.2
CCACCAATTCCGGACGCAGTA
GGGACCGCTCAGCATTGTAAGTG
BKCa2.3
AGCCACCGCATCCCCTGTCTCA
TGCCGGCATGCTGGTGGTTG
BKCa3.1
CACCCTAGCCCCTCCTTATTCTCA
CCGGGGTCTTGGGGCTCAG
BKCa4.1
AGACGCCAAGGCCTACGGGTTCAA
CTCGGCGCTCATGGTGCTCTCCTT
BKCaβ1
GGCGGCCCAGAAGTAGAGC
ATGCAGCCGGAAACAGGTATGAGT
BKCaβ2
CAAAGCGGCGAGTGGTGT
TCCCCGGAAGAAGTCAGGTTA
BKCaβ3a
CGAGGCGGAAACACAGG
GGCAAGGCGGAGCGGTCAGT
BKCaβ4
CAGCGGGCGATGGAGACAGAGA
ACGACGCCGGAGATGATGAGAAAC
Kv1.1
CATCTGGTTCTCCTTCGAGC
GTTAGGGGAACTGACGTGGA
Kv1.2
TCCGGGATGAGAATGAAGAC
TTGGACAGCTTGTCACTTGC
Kv1.3
GTTCTCCTTCGAACTGCTGG
CTGAAGAGGAGAGGTGCTGG
Kv1.4
CCCCAGCTTTGATGCCATCTTG
TGAGGATGGCAAAGGACATGGC
Kv1.5
TGCGTCATCTGGTTCACCTTCG
TGTTCAGCAAGCCTCCCATTCC
Kv1.6
TCAACAGGATGGAAACCAGCCC
CTGCCATCTGCAACACGATTCC
Kv1.7
TGCCCTTCAATGACCCGTTCTTC
AAGACACGCACCAATCGGATGAC
Kv2.1
TACAGCCTCGACGACAACG
ACCACGCGGCGGACATTCTG
Kv2.2
AACGAACTGAGGCGAGAG
ACTCCGCCTAAGGGTGAAAC
Kv3.1
AACCCCATCGTGAACAAGACGG
TCATGGTGACCACGGCCCA
Kv3.2
CTGCTGCTGGATGACCTACC
TGTGCCATTGATGACTGGTT
Kv3.3
TTCTGCCTGGAAACCCATGAGG
TGTTGACAATGACGGGCACAGG
Kv4.1
ATCTCGAGGAGATGAGGTTC
TTCTTTCGGTCCCGATAC
Kv4.3
TGGCTTCTTCATCGCTGTCTCG
CCGAAGATCTTCCCTGCAATCG
Kv4.4
AGCCAAGAAGAACAAGCTG
AGGAAGTTTAGGACATGCC
Kv5.1
TCCACATGAAGAAGGGCATCTGC
TCACGTAGAAGGGGAGGATG
Kv6.1
TGCACCAACTTCGACGACATCC
GGAACTCCAGGGAGAACCAGCC
Kv6.2
AAGCTCTTCGCCTGCGTGTC
CAGCAGCAGCGACACGTAGAAC
Kv6.3
ATGCCCATGCCTTCCAGAGA
AGAGCTGCACGATCTCCTCG
Kv8.1
TTCCACAGCTGCCCGTATCTTTG
TTTTGCCTGTGGTGGTGTCTGG
Kv9.1
TTTGAGGACTTGCTGAGCAGCG
TTGCTCCAGGCACACCAACAAG
Kv9.2
GTACTGGGGCATCAACGAGT
CCACGGAGAGGTAGAGCAAG
Kv9.3
CTCTGTGGGCATTTCCATTT
AGAAACAGGCACAAACACCC
Kv10.1
GCTTGCCCGTCACTTCATTGGTC
TTCTTCCAGGCACTGTGATAGGA
Kv11.1
AGCCATGCTCAAACAGAGTG
CTCCTCGTAGTCGTCGCACA
GAPDH
TGCACCACCAACTGCTTAGC
GGCATGGACTGTGGTCATGAG
4. Data analysis
All results were expressed as mean±standard error of mean (SEM). Student’s
t-test was used to determine statistical significance. We
considered *p<0.05 to be statistically significant.
RESULTS
1. Characterization of HUCPVCs
We obtained PVCs from the vessels of HUC tissues using a non-enzymatic (NE)
isolation method (An et al., 2015b). To
prevent cross contamination with hematopoietic and endothelial cells, both ends
of the vessel were ligated and then plated into dishes. On days 7-10
post-plating, PVC colonies were subcutured and successfully expanded. HUCPVCs
exhibited fibroblast or spindle-like morphology (Fig. 1A). The phenotypic expression of HUCPVCs (Passage 2) was
analyzed by flow cytometry. The cells were positive for CD146 (93%), SSEA-4
(10.1 %), CD44 (99.9 %), and CD90 (99%), and negative for CD31, CD45, and CD34,
which precluded contamination by endothelial and hematopoietic cells (Fig. 1B). These results suggested that the NE
method enabled us to obtain a homogenous PVC population and that the expression
pattern of surface markers on HUCPVCs was in agreement with that of human PVCs
reported in previous studies.
Fig. 1
Isolation and characterization of HUCPVCs.
(A) Non-enzymatic isolation of HUCPVCs. Both ends of the dissected vessel
were ligated and plated into a 100 mm dish. Perivascular stem cell (PVC)
colonies were collected and subcultured when 80% confluent. Scale bar,
100 μm. (B) Phenotypes of isolated HUCPVCs were analyzed by flow
cytometry. PVC marker, CD146; MSC markers, CD44 and CD90; endothelial
and hematopoietic markers, CD31, CD34, and CD45. HUCPVC = human
umbilical cords perivascular stem cells; MSC = mesenchymal stem
cells.
Isolation and characterization of HUCPVCs.
(A) Non-enzymatic isolation of HUCPVCs. Both ends of the dissected vessel
were ligated and plated into a 100 mm dish. Perivascular stem cell (PVC)
colonies were collected and subcultured when 80% confluent. Scale bar,
100 μm. (B) Phenotypes of isolated HUCPVCs were analyzed by flow
cytometry. PVC marker, CD146; MSC markers, CD44 and CD90; endothelial
and hematopoietic markers, CD31, CD34, and CD45. HUCPVC = human
umbilical cords perivascular stem cells; MSC = mesenchymal stem
cells.
2. High glucose treatment alters the expression of BKCa and Kv
channels in undifferentiated HUCPVCs
We first investigated the expression patterns of BKCa and
Kv channel subtypes in undifferentiated HUCPVCs. We found
comparable mRNA expression of KCaβ3a and Kv1.3
subtypes in undifferentiated HUCPVCs (Fig.
2A and 2B). The expression
levels of BKCa1.1, BKCa2.2, KCaβ,
Kv3.3, and Kv6.1 subtypes were relatively low (Fig. 2A and 2B). High concentrations of glucose in the blood affected the growth
and functions of endogenous stem cells. Thus, we next asked if high glucose
influenced the expression levels of ion channels. HUCPVCs were plated at a
density of 4×105 cells in 35 mm dishes and cultured in both LG and HG
conditions for 5 days. HG did not induce morphological changes in HUCPVCs (Fig. 2C), but reduced the proliferative
activity (data not shown). HG-treated HUCPVCs showed increased mRNA levels of
BKCaβ3a, BKCaβ4,
Kv1.3, Kv1.6, and Kv6.1 subtypes. We confirmed
the upregulation of BKCaβ4, Kv1.6, and
Kv6.1 transcripts in HUCPVCs exposed to HG using quantitative
real-time PCR (Fig. 3). These results
suggested that BKCa and Kv channels may have unique
functions in the growth and differentiation of HUCPVCs, which could be affected
by HG exposure.
Fig. 2
Expression of BKCa and Kv channel subtypes in
HUCPVCs treated with LG and HG.
(A) The mRNA expression of BKCa channel subtypes in HUCPVCs
cultured with LG and HG by RT-PCR. The expression levels of
BKCaβ3a and BKCaβ4
subtypes were increased in HG-treated HUCPVCs. (B) The mRNA expression
of Kv channel subtypes in HUCPVCs cultured with LG and HG
measured by RT-PCR. The expression levels of Kv1.3,
Kv1.6, and Kv6.1 subtypes were increased in
HG-treated HUCPVCs. (C) Representative images of HUCPVCs cultured in LG
(5 mM) and HG (25 mM) conditions for 5 days. Scale bar, 100 μm. LG = low
glucose; HG = high glucose. Other abbreviations are as in Fig. 1.
Fig. 3
Upregulation of BKCaβ4, Kv1.6 and
Kv6.1 subtypes in HG-treated HUCPVCs
Real-time qPCR was used for confirmation of upregulated subtypes in
HG-treated HUCPVCs. Error bars indicate SEM.
*p<0.05. Other abbreviations are as in Fig. 1.
Expression of BKCa and Kv channel subtypes in
HUCPVCs treated with LG and HG.
(A) The mRNA expression of BKCa channel subtypes in HUCPVCs
cultured with LG and HG by RT-PCR. The expression levels of
BKCaβ3a and BKCaβ4
subtypes were increased in HG-treated HUCPVCs. (B) The mRNA expression
of Kv channel subtypes in HUCPVCs cultured with LG and HG
measured by RT-PCR. The expression levels of Kv1.3,
Kv1.6, and Kv6.1 subtypes were increased in
HG-treated HUCPVCs. (C) Representative images of HUCPVCs cultured in LG
(5 mM) and HG (25 mM) conditions for 5 days. Scale bar, 100 μm. LG = low
glucose; HG = high glucose. Other abbreviations are as in Fig. 1.
Upregulation of BKCaβ4, Kv1.6 and
Kv6.1 subtypes in HG-treated HUCPVCs
Real-time qPCR was used for confirmation of upregulated subtypes in
HG-treated HUCPVCs. Error bars indicate SEM.
*p<0.05. Other abbreviations are as in Fig. 1.
DISCUSSION
In the present study, we showed for the first time the expression patterns of
BKCa and Kv ion channels in HUCPVCs, which could be
altered by exposure to HG. In recent years, PVCs have been suggested as a promising
source for cell-based therapy due to their greater regenerative potential (Crisan et al., 2008). Ion channels are detected
in a variety of cell types and play fundamental roles in controlling cell
proliferation and differentiation as well as maintaining homeostasis (Kawano et al., 2002). Therefore, we
investigated the electrophysiological properties of HUCPVCs to improve their
proliferative and regenerative capacities.Recent studies reported the electrophysiological properties of multipotent MSCs and
found that the expression patterns of ion channels were relatively heterogeneous
among MSCs. While similar expression levels of Kv1.4, Kv4.1, Kv4.2, and Kv4.3
subtypes were observed between adipose tissues (AD)- and bone marrow (BM)-derived
MSCs, expression of Kv1.1, Kv1.4, and Kv7.3 subtypes varied across the tissues or
among studies (Heubach et al., 2003; Li et al., 2005; Bai et al., 2007; Park et al.,
2007; Park et al., 2013). Bai et al. (2007) could not detect Kv4.1 subtype
in AD-MSCs. However, Park et al. (2013)
reported strong expression of Kv4.1 subtype in AD-MSCs. The heterogeneity of Kv ion
channels in MSCs may be attributed to variations among donors or the tissues from
which MSCs are isolated. Our data showed different expression patterns of ion
channel subtypes in PVCs compared with AD- and BM-MSCs, indicating that PVCs are
different subpopulations and are more homogeneous than MSCs. Culture conditions
might also influence the expression of specific ion channel subtypes detected in
MSCs. For example, BM-MSCs cultured in HG medium exhibited senescence and genetic
instability by upregulation of autophagy and oxidative stress (Chang et al., 2015). In addition, hyperglycemia impaired the
proliferation and function of endogenous stem and somatic cells such as MSCs,
hematopoietic stem cells and Müller cells (Kim et
al., 2015; Kocabas ; Manea ; Hadarits et al.,
2016; Qiu ,
2016). Thus, we assumed that the glucose concentration in the culture medium may
affect the expression levels of ion channels in PVCs and found increased levels of
BKCaβ3a, BKCaβ4, Kv1.3,
Kv1.6, and Kv6.1 transcripts in HG-treated PVCs compared
to those of LG-treated PVCs.In summary, this is the first characterization of ion channels in HUCPVCs, which
provides fundamental information to improve the regenerative capacity of HUCPVCs.
Further study will be needed to define the physiological roles of specific ion
channels in the proliferation and differentiation of HUCPVCs.
Authors: Won Sun Park; Soon Chul Heo; Eun Su Jeon; Da Hye Hong; Youn Kyoung Son; Jae-Hong Ko; Hyoung Kyu Kim; Sun Young Lee; Jae Ho Kim; Jin Han Journal: Am J Physiol Cell Physiol Date: 2013-06-12 Impact factor: 4.249