Literature DB >> 28482814

Novel mutant alleles of the starch synthesis gene TaSSIVb-D result in the reduction of starch granule number per chloroplast in wheat.

Huijun Guo1, Yunchuan Liu1, Xiao Li1, Zhihui Yan1, Yongdun Xie1, Hongchun Xiong1, Linshu Zhao1, Jiayu Gu1, Shirong Zhao1, Luxiang Liu2.   

Abstract

BACKGROUND: Transient starch provides carbon and energy for plant growth, and its synthesis is regulated by the joint action of a series of enzymes. Starch synthesis IV (SSIV) is one of the important starch synthase isoforms, but its impact on wheat starch synthesis has not yet been reported due to the lack of mutant lines.
RESULTS: Using the TILLING approach, we identified 54 mutations in the wheat gene TaSSIVb-D, with a mutation density of 1/165 Kb. Among these, three missense mutations and one nonsense mutation were predicted to have severe impacts on protein function. In the mutants, TaSSIVb-D was significantly down-regulated without compensatory increases in the homoeologous genes TaSSIVb-A and TaSSIVb-B. Altered expression of TaSSIVb-D affected granule number per chloroplast; compared with wild type, the number of chloroplasts containing 0-2 granules was significantly increased, while the number containing 3-4 granules was decreased. Photosynthesis was affected accordingly; the maximum quantum yield and yield of PSII were significantly reduced in the nonsense mutant at the heading stage.
CONCLUSIONS: These results indicate that TaSSIVb-D plays an important role in the formation of transient starch granules in wheat, which in turn impact the efficiency of photosynthesis. The mutagenized population created in this study allows the efficient identification of novel alleles of target genes and could be used as a resource for wheat functional genomics.

Entities:  

Keywords:  Gene expression; Mutant; Starch granule; TILLING; TaSSIVb-D; Wheat

Mesh:

Substances:

Year:  2017        PMID: 28482814      PMCID: PMC5422989          DOI: 10.1186/s12864-017-3724-4

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

Starch granules in plants are classified into two types according to their physiological role. Some starch granules are stored for long periods in reserve tissues as storage starch. This type of starch is an important source of carbohydrates for human beings. Other types of starch are stored temporarily as transient starch to provide carbon and energy for plant growth. Transient starch is synthesized in chloroplasts during the day and consumed during the night. Storage starch granules are synthesized in the plastid stroma by joint action of ADP-glucose pyrophosphorylases (AGPase), starch synthases (SS), starch branching enzymes (SBE), starch debranching enzymes (DBE) and their isoforms; however, the synthesis and regulation of transient granules hold a specific feature [1]. Some synthase isoforms that synthesize storage starch are different from those that synthesize transient starch. AGPase is the first and rate-limiting enzyme in the biosynthesis of starch, it catalyzes the synthesis of ADP-glucose, which is the substrate of amylose starch, and over expression of the AGPase gene enhances the rate of starch biosynthesis [2-4]. Amylose, one of the main forms of starch, is synthesized from the substrate, ADP-glucose, by granule-bound starch synthase (GBSS). The isoform GBSS2 is responsible for amylose synthesis in leaves and other non-storage tissues [5-8], whereas amylopectin, the other major form of starch, is synthesized by the coordinated actions of AGPase, SS, and SBE. Five soluble SS isozymes, SSI, SSII, SSIII, SSIV, and SSV are found in plant genomes [9, 10]; and among them, SSI, SSII, and SSIII are involved in amylopectin elongation [11]. Isoform SSI is highly expressed in plant leaves [12, 13]. Two or three isoforms of SSII and SSIII are found in the genomes of different species, and at least one isoform is expressed in leaves and regulates starch granule biosynthesis [14-17]. Only one SSIV isoform is found in the Arabidopsis genome; AtSSIV is involved in the initiation of starch granule formation in leaves [18, 19]. Overexpression of AtSSIV increases the levels of starch accumulation by 30–40% and results in a higher rate of growth [20]; SSIV mutants have remarkably decreased numbers of granules and abnormal granules [18, 19, 21]. The functions of SSIV isozymes in the leaves of cereal crops are not as clear as in Arabidopsis. Two SSIV isoforms, SSIVa and SSIVb, are found in rice. SSIVa is mainly expressed in the endosperm and is responsible for starch accumulation in seeds, whereas SSIVb is mainly expressed in leaves at early development stages and is responsible for leaf granule biosynthesis [12, 14, 22]. It also has overlapping and crucial roles with SSIIIa in rice seeds in determining granule morphology and in maintaining the amyloplast envelope structure [23]. ZmSSIV is highly expressed in the embryo, endosperm and pericarp in maize. In wheat, only one isoform of SSIV has been identified until now. This gene is located on the long chromosome arm of homologous group I and shows high similarity with OsSSIVb, so this isoform is named TaSSIVb [12, 24]. TaSSIVb is preferentially expressed in leaves and is not regulated by the circadian clock [24]. TaSSIVb is also highly expressed at the middle stages of seed development [25, 26]; however, the impact of TaSSIVb on wheat leaf and seed granule characteristics at different growth stages have not yet been reported due to the lack of mutant lines. TILLING (Targeting-Induced Local Lesions IN Genomes) is a powerful approach for novel allele identification and has been used to screen mutagenized plant populations for novel alleles of target genes [27-34]. Hundreds of missense and nonsense mutant alleles of key starch synthesis-related wheat genes, such as TaSSII, TaSBEIIa, TaSBEIIb, have been identified using this platform [35, 36]. A hexaploid wheat line containing two waxy homozygous mutations created through TILLING and a pre-existing deletion of a third waxy homoeolog displays a near-null phenotype [37]. Novel alleles of TaSBEII have been identified in both durum wheat and bread wheat. Double mutant lines combining a TaSBEIIa-A mutation with a TaSBEIIa-B mutation in durum wheat and triple mutant lines combining mutations in TaSBEIIa-A, TaSBEIIa-B with TaSBEIIa-D have a significant increase in both amylose and resistant starch content [38-42]. Using this approach to identify novel alleles of TaSSIVb would be helpful in characterizing its role in transient starch granule synthesis in wheat leaves. In this paper, we used the TILLING approach to identify novel alleles of TaSSIVb–D with mutations in functional regions in an Ethyl methanesulphonate (EMS) mutagenized population derived from an elite hexaploid wheat cultivar. Homozygous mutants were used to investigate the specific role of TaSSIVb-D in starch granule synthesis in leaves at different stages of growth. We found that TaSSIVb-D mutations decrease gene expression and the number of starch granules in leaves.

Results

Novel alleles of TaSSIVb-D in a mutagenized population

Three primer sets corresponding to TaSSIVb-D were designed for allele mining (Table 1), and their specificities were validated using nullisomic-tetrasomic lines (Fig. 1a). The location of these primers on the TaSSIVb-D sequence is shown in Fig. 1b.
Table 1

Primer sequences used for allele mining

NameForward (5’-3’)Reverse (5’-3’)
s4b-D1ACTAAAACCCACTTTGCGACGGTAGGAATGATACAGAACACC
s4b-D2CTGCAAAAAATTGTCTAAAAGCTACCATGCTTTGAAATTATCTACTTTCG
s4b-D3ACCAGAAATTCAGGTGCGTTTGAGTCGTGTTGTGCCCG
Fig. 1

Validation of subgenome-specific TaSSIVb-D primers using the Chinese Spring nullisomic-tetrasomic lines. a Products from the Chinese Spring (CS), nullisomic-tetrasomic lines (N1AT1B, N1AT1D, N1BT1D and N1DT1B) and wild type (J411) amplified using the three different sets of TaSSIVb-D-specific primer pairs shown in b. TaSSIVb-D is absent from N1DT1B. b Diagram of D subgenome primers. The black rectangle represents the gene sequence; orange arrowheads indicate exon regions; blue rectangles represent the location of each primer

Primer sequences used for allele mining Validation of subgenome-specific TaSSIVb-D primers using the Chinese Spring nullisomic-tetrasomic lines. a Products from the Chinese Spring (CS), nullisomic-tetrasomic lines (N1AT1B, N1AT1D, N1BT1D and N1DT1B) and wild type (J411) amplified using the three different sets of TaSSIVb-D-specific primer pairs shown in b. TaSSIVb-D is absent from N1DT1B. b Diagram of D subgenome primers. The black rectangle represents the gene sequence; orange arrowheads indicate exon regions; blue rectangles represent the location of each primer In the mutagenised population, 54 mutations were identified with a mutation density of 1/165 Kb. Among these mutations, 52 are G to A (61.12%) or C to T (35.19%) transition point mutations, and the other 2 are T insertions. Of these mutations, 26 are in the coding region (Table 2), including 1 nonsense mutation (E054-13), 15 missense mutations and 10 silent mutations. The remaining 26 are located in introns and include 2 splice junction mutations.
Table 2

Mutations identified in the coding region of the TaSSIV b-D gene

LineAlleleMutation TypeEffectPSSMSIFT
E334G1783ASilent
E1239G1813AMissenseE181K4.40.6
E469G1822AMissenseE183K−60.42
E939G1848ASilent
E1337G1863ASilent
E2-2-226T1880CMissenseL203S26.70
E2-2-437T1880CMissenseL203S26.70
E468G1890ASilent
E1245G1920ASilent
E391G1975AMissenseD235N
E137G2008AMissenseD246N0.40.96
E054-13C2077TNonsenseQ269-Stop
E2-2-193C2143TMissenseL291F0.60.02
E2-2-95C2152TMissenseL294F
E570A2219GMissenseQ316R8.40
E1347C2353TSilent
E783G2402AMissenseS377N
E236G2413ASilent
E996C3516TSilent
E2-2-181G3536AMissenseV469I
E054-9C3740TIntronic
E1226G3932AMissenseV550I0.90.09
E972C3950TMissenseH556Y27.50
E930G5872ASilent
E1373C5878TSilent
E1137G6327AMissenseS833N120

Nucleotide changes are numbered relative to the start codon ATG

Mutations identified in the coding region of the TaSSIV b-D gene Nucleotide changes are numbered relative to the start codon ATG Using SIFT program, five missense mutations (E2-2-226 and E2-2-437, E2-2-193, E570, E972, E1137) are predicted to have a severe impact on protein function. Based on the PSSM program, three missense mutations (E2-2-226 and E2-2-437, E972, E1137) are predicted to have a severe impact. As the nonsense mutant E054-13 results in the loss of both the starch catalytic domain and glycosyltranferase domain, it might have a severe impact on protein function. Because the E1137 mutation is located in the glycosyltranferase domain which has less similarity with other SS isoforms [24], and might have distinct functions from other starch synthases, mutants E1137 and E054-13 were selected for analysis of gene expression and starch granule number.

The expression of TaSSIVb in mutant leaves at different growth stages

Specific primer sets for each sub-genome (Additional file 1: Table S1, Additional file 2: Figure S1) were used to analyze the pattern of TaSSIVb gene expression. In wild type, gene expression profiling revealed non-significant differences in expression between different growth stages (Fig. 2). In the mutants, TaSSIVb-D was down-regulated, and TaSSIVb-A and TaSSIVb-B did not show significant compensatory responses. The expression of TaSSIVb-D in the nonsense mutant E054-13 was reduced by ~8-fold compared with the wild type at all three growth stages, whereas in E1137, its expression level gradually increased with plant growth and only showed a significant reduction (36.12%) at the seedling stage (Fig. 2a). In contrast, no significant differences in the expression of TaSSIVb-A (Fig. 2b) and TaSSIVb-B (Fig. 2c), were detected in the two TaSSIVb-D mutants at all three stages, except for TaSSIVb-A expression in the E054-13 mutant at the seedling stage (9.55% reduction).
Fig. 2

Expression patterns of the three homeologous TaSSIVb genes in leaves at different stages. a Relative expression level of TaSSIVb-D; b Relative expression level of TaSSIVb-A; c Relative expression level of TaSSIVb-B. Error bars represent standard deviation; WT: wild type; * means significantly different from WT at the P = 0.05 level and ** means significantly different from WT at the P = 0.01 level based on Student’s t test

Expression patterns of the three homeologous TaSSIVb genes in leaves at different stages. a Relative expression level of TaSSIVb-D; b Relative expression level of TaSSIVb-A; c Relative expression level of TaSSIVb-B. Error bars represent standard deviation; WT: wild type; * means significantly different from WT at the P = 0.05 level and ** means significantly different from WT at the P = 0.01 level based on Student’s t test

Variation in the number of starch granules in the chloroplast

We investigated starch granule characteristics in the chloroplasts of wild type and the two mutants at three growth stages (Fig. 3). Granule number varied plast by plast in each genotype, with numbers ranging from 0 to 8 and more than 90% of chloroplasts contained no more than 4 granules (Additional file 1: Table S2). The difference between the wild type and mutants was mainly in the number of chloroplasts containing no more than 4 granules.
Fig. 3

Starch granules observed in the chloroplasts of wild type (a, b, c) and TaSSIVb-D E054-13 (d, e, f) and E1137 (g, h, i) mutants by transmission electron microscopy. Arrows indicate starch granules, bars = 5 μm

Starch granules observed in the chloroplasts of wild type (a, b, c) and TaSSIVb-D E054-13 (d, e, f) and E1137 (g, h, i) mutants by transmission electron microscopy. Arrows indicate starch granules, bars = 5 μm The biggest difference in granule number per chloroplast was observed at the seedling stage, and mutation of TaSSIVb-D led to a reduction in granule number. The percentage of chloroplasts with 0–2 granules in both mutants, E054-13 (96.70%) and E1137 (84.70%), were significantly higher compared with wild type (70.30%) (Fig. 4), whereas at the elongation and heading stages, the difference between E1137 and wild type became smaller; only the E054-13 mutant had a significantly higher percentage of chloroplasts with 0–2 and 3–4 granules (17.74% and 18.72% higher than wild type, respectively). In contrast, the percentage of chloroplasts containing 3–4 granules was lower in the mutants than in wild type. At the seedling stage, the percentage of chlorplasts in E054-13 and E1137 with 3–4 granules was 22.00% and 10.3% lower than wild type, respectively. At the elongation and heading stages, only the E054-13 mutant was significantly different from wild type; the percentage of chlorplasts with 3–4 granules was 14.26% and 15.05% lower than wild type, respectively. The observation of the chloroplast granule number phenotype at all stages for the E054-13 mutant and only at the seedling stage for the E1137 mutant is consistent with the lower levels of TaSSIVb-D gene expression in the mutants at these stages (Fig. 2).
Fig. 4

Percentage of chloroplasts in wild type (WT) and TaSSIVb-D mutants (E054-13 and E1137) containing 0–2 and 3–4 granules at three different growth stages. a Seedling stage; b Elongation stage; c Heading stage. The percentage of chloroplasts equals the number chloroplasts containing 0–2 and 3–4 starch granules divided by the total number of chloroplasts observed. * means significantly different from WT at the P = 0.05 level and ** means significantly different from WT at the P = 0.01 level

Percentage of chloroplasts in wild type (WT) and TaSSIVb-D mutants (E054-13 and E1137) containing 0–2 and 3–4 granules at three different growth stages. a Seedling stage; b Elongation stage; c Heading stage. The percentage of chloroplasts equals the number chloroplasts containing 0–2 and 3–4 starch granules divided by the total number of chloroplasts observed. * means significantly different from WT at the P = 0.05 level and ** means significantly different from WT at the P = 0.01 level

Photosynthesis parameters and the efficiency of PSII

As transient starch in chloroplasts provides carbon and energy for plant growth, we deduced that photosynthesis might be affected by reduced granule numbers. Granule numbers in the mutant E054-13 were more severely reduced than those in E1137, and the impact on photosynthesis parameters are expected to be more severe. Therefore, photosynthesis parameters in the mutant E054-13 and the wild type at the heading stage were compared to determine the impact of reduced granule number. We found that the maximum quantum yield (F /F ) and yield of PSII (Y(II)) of E054-13 were significantly lower than in wild type (Table 3), and differences between the mutant and wild type in both Y(II) and electron transport rate (ETR) increased with increasing photosynthetically active radiation (PAR) (Fig. 5). As Y(II) provides the effective quantum yield and could be used to estimate the effective portion of absorbed quanta; while ETR provides information for plant stress reaction, so the results indicates that mutation of TaSSIVb-D leads to a decrease in relative quantum yield and has a negative effect on PSII efficiency.
Table 3

Changes in chlorophyll fluorescence parameters in the TaSSIVb-D E054-13 nonsense mutant at the heading stage

GenotypeY(II) F v/F m
Wild type0.641 ± 0.00190.818 ± 0.0175
E054-130.617 ± 0.0020 **0.622 ± 0.0274 **

Y(II) and F /F were measured in dark-adapted plants, and Photosynthetically Active Radiation (PAR) equals 281. Values are means ± standard deviation

** significantly different from the wild type at the P < 0.01 level based on Student’s t test

Fig. 5

Y(II) (a) and ETR (b) fast light curves for wild type and the TaSSIVb-D E054-13 nonsense mutant at the heading stage. Error bars represent standard deviation

Changes in chlorophyll fluorescence parameters in the TaSSIVb-D E054-13 nonsense mutant at the heading stage Y(II) and F /F were measured in dark-adapted plants, and Photosynthetically Active Radiation (PAR) equals 281. Values are means ± standard deviation ** significantly different from the wild type at the P < 0.01 level based on Student’s t test Y(II) (a) and ETR (b) fast light curves for wild type and the TaSSIVb-D E054-13 nonsense mutant at the heading stage. Error bars represent standard deviation

Discussion

Conserved and functional regions of TaSSIVb

As one of the isoforms of the soluble starch synthesis family, wheat SSIV contains the starch catalytic domain (GT-5) and glycosyltranferase domain (GT-1). GT-5 (amino acids 422–661) is more conserved than GT-1 (amino acids 706–886) between SS isoforms [24]. Two mutations that we identified in this study, E972 and E1137, are located in GT-5 and GT-1, respectively, and in the wild type these amino acids are involved in the formation of β-sheets (data not shown). In contrast the N-terminus (amino acids 1–405) is distinct from other SS isoforms, and this region contains two coiled-coil domains and a 14-3-3-protein binding site [24]. The missense mutation E2-2-226 and the truncation mutation E054-13 are located in this region. These novel alleles could be very useful in understanding the specific functions of SSIV in starch granule synthesis in wheat. The gene expression patterns and alteration of granule number in the E1137 and E054-13 mutants demonstrate the important roles of these predicted functional regions. The E054-13 truncation mutation has a more severe effect than the missense mutation; TaSSIVb gene expression is reduced by 5 ~ 13-fold compared with E1137 (Fig. 2), and granule number is also significantly decreased compared with E1137 (Additional file 1: Table S2).

Expression of TaSSIVb homoeologs

Wheat has three sub-genomes, and the literature shows that the contribution of each homeologous gene can be different. For example, of the three SSIIa genes, SSIIa on the B genome has the largest contribution to amylopectin structure than those on the other two genomes [43]. Each waxy gene encoding GBSSI has different effects on amylopecitin characteristics [37, 44, 45]. SS isoform SSIV is encoded by three homeologous genes located on group I chromosomes [24] and the effect of each gene and their interactions is not clear. Here we designed homeologous-specific primers to determine the gene expression patterns of the three SSIV genes. In TaSSIVb-D mutants, decreased expression of TaSSIVb-D did not result in significant changes in the expression of TaSSIVb-A or TaSSIVb-B. This is similar to what was observed in the single null mutant of SBEIIa; a mutation in one sub-genome does not result in appreciably different expression in the other two sub-genomes [46]. However, the identification of mutations in TaSSIVb-A and TaSSIVb-B is needed to analyze the interaction between homoeologous copies or their dosage effects.

Expression of TaSSIV-D in wheat leaves

The function of AtSSIV, which it is highly expressed in leaves in Arabidopsis is very well understood. In wheat, the expression of TaSSIVb is tissue-dependent, and is much more highly expressed in leaves than in the endosperm [24]. Our results are consistent with these reports; all three homeologous genes are highly expressed in leaves during the entire growth period. There is also evidence that TaSSIVb is expressed during seed development [24-26]. In ongoing research we are investigating the accumulation of storage starch in both the E054-13 and E1137 mutants to elucidate the role of TaSSIVb in storage starch synthesis.

Starch granule synthesis

Starch granules are initiated early in the development of young leaves in Arabidopsis. Because more starch granules are observed in immature leaves than in mature leaves [47], it is believed that SSIV functions in granule initiation at earlier growth periods [21]. The ssIV mutant in Arabidopsis has reduced granules in most chloroplasts [18, 21]. The results of this study demonstrate that in young wheat leaves TaSSIV-D has a function similar to AtSSIV, and it is involved in initiation of transitory starch synthesis. At the seedling stage, the expression patterns of both the E054-13 and E1137 TaSSIV-D mutants are down regulated. In the E1137 mutant, the significant reduction of granule number is only observed when the expression of TaSSIV-D is reduced; while in the nonsense mutant, starch granules are reduced at all the three stages. This indicates that reduction of starch granule number results from the mutation of TaSSIV-D and not other genes.

Effect of homeologous genes

In many cases, homeologous genes from different sub-genomes of wheat have dosage effects on phenotypes. Only double or triple mutants of SSIIa have severe effects on starch properties [48, 49], and single-gene mutants do not show significant phenotypes [38]. However in single TaSSIV-D gene mutants, gene expression level, granule number, relative quantum yield and PSII efficiency are significantly reduced with respect to the wild type. It has been reported that single mutants of the genes SBEIIa and gpc (grain protein content) also show significant phenotypic differences compared with the wild type [46, 50], so not only double and triple mutants, but also single mutants can lead to phenotypic changes in hexaploid wheat.

Relationship between transient starch content and photosynthesis

It has been reported that the capacity for starch synthesis and the rate of photosynthesis are positively correlated [51]. A starchless tobacco mutant shows about 50% inhibition of maximum photosynthetic capacity [52]. Mutation of SSIV in Arabidopsis also has negative effects on photosynthesis efficiency [53]. Our SSIV mutant in wheat shows the same effects; photosynthesis efficiency is significantly reduced. This is likely because SSIV mutants accumulate high concentrations of the substrate ADPglucose [21], which leads to photooxidative stress and decreased photosynthesis efficiency [53].

Conclusions

We identified novel alleles, including missense and nonsense mutations, of the starch synthesis gene, TaSSIVb-D. Gene expression, granule number and photosynthetic parameters are down-regulated or reduced in the missense mutant E1137 and the nonsense mutant E054-13, and the impact of E054-13 is much more severe than that of E1137. This demonstrates TaSSIVb-D plays an important role in the formation of transient starch granules in wheat, and mutation of TaSSIVb-D results in remarkable reduction in transitory starch granules in leavies. The mutagenized population generated in this study could be used as a resource for gene functional research.

Methods

Materials

Wheat (Triticum aestivum L.) cultivar Jing411 was used as the wild type (WT) to create the mutagenized population. Homozygous mutant lines grown in the field with normal management were used for RT-qPCR and phenotyping.

Development of the wheat TILLING population

Seeds from the wild type Jing411 were soaked in tap water for 10 h at 20°C, then incubated in 1.5% EMS in 0.1 M sodium phosphate buffer (pH7.0) for 4 h or 6 h at 20°C. This was followed by washing with running tap water for 4 h at room temperature. The mutagenized seeds (M1 generation) were planted directly in the field and self-fertilized. The M2 was developed using the single-seed descent (SSD) method. The mutagenized population consists of 3058 M2 plants, including 1441 individuals from the 4 h 1.5% EMS treatment and 1617 from the 6 h treatment. A young leaf from each individual was sampled at the seedling stage for genomic DNA extraction using the DNA-quick Plant System kit (Tiangen Biotech, Beijing, China). DNA concentration was measured with the NanoDrop2000 spectrophotometer (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions, and the final concentration was adjusted to 50 ng/μl. Individual DNA samples were pooled 2-fold into 96-well plates for TILLING screening, which was done according to Till et al. [54].

Primer design

The sequence of TaSSIVb (DQ400416) was downloaded fromhttps://www.ncbi.nlm.nih.gov/nuccore/DQ400416, and the sequences of TaSSIVb-A, TaSSIVb-B and TaSSIVb-D were obtained through alignment with long arm of chromosome 1A, 1B and 1D (https://wheat-urgi.versailles.inra.fr/Seq-Repository). TaSSIVb-D was used as the target gene for mining and phenotyping novel alleles. Primer Premier 5.0 (Premier Biosoft International, Palo Alto, CA) was used to design homoeolog-specific TILLING and qPCR primers (Table 1 and Additional file 1: Table S1), and their specificities were validated using Chinese Spring nullisomic-tetrasomic lines (N1AT1B, N1AT1D, N1BT1D and N1DT1B; Fig. 1a and Additional file 2: Figure S1).

Mutation screening

Each primer used for TILLING detection was synthesized with and without fluorescent dye label. Unlabeled primers (Sangon Biotech, China), forward primers labeled with the fluorescent dye IRD700 and reverse primers labeled with the fluorescent dye IRD800 (Bioneer, China) were mixed with the ratio of unlabeled forward: labeled forward: unlabeled reverse: labeled reverse = 4: 1: 1: 4. PCR amplification and polyacrylamide gel electrophoresis were carried out as previously described [54]. Identified mutations were sequenced to verify nucleotide variation. Mutation density was calculated by dividing the total number of mutations by the total length of the sampled DNA sequence (length of the amplified fragment × number of individuals sampled). Totally 3058 individual plants were screened for each primer set, and the amplicon size of primer set s4b-D1, s4b-D1 and s4b-D1 was 1191, 1361 and 960 bp respectively. As DNA products at the top and bottom of the gel were difficult to detect, we subtracted 100 bp from the 5’ terminus and 100 bp from the 3’ terminus of each fragment. The PARSESNP (Project Aligned Related Sequences and Evaluate SNPs; http://blocks.fhcrc.org/proweb/parsesnp/) and SIFT (Sorting Intolerant from Tolerant; http://sift.bii.a-star.edu.sg/) programs were used to predict the severity of each mutation. Mutations with PSSM >10 or SIFT <0.05 are predicted to have a severe effect on protein function [55, 56].

RT-qPCR

The effects of mutations on the expression of TaSSIVb gene homoeologs was evaluated for leaves at the seedling, elongation and heading stages. Total RNA was extracted from three individual plant leaves, and cDNA was synthesized using the FastQuant RT kit (With gDNase, Tiangen Biotech) according to the manufacturer’s instructions. RNA extraction and cDNA synthesis was done for three biological replicates per genotype with three technical replicates for each biological replicates, and their concentrations measured with the NanoDrop2000 spectrophotometer, the same volume and concentration of normalized template was used for the next step experiment. RT-qPCR was performed on a CFX96 system using the SsoFast EvaGreen Supermix kit (Bio-Rad), PCR was performed at 94°C for 3 min, followed by 40 cycles at 94°C for 30 s, annealing for 30 s, and 72°C for 10 s, and then a melt curve stage. Concentration of each primer was 0.3 μmol, amplification efficiency of the three genes ranged from 97% to 100%. The actin gene used as a control was the same as described by Gu et al. [57]. The relative expression level was calculated with ΔΔCt method according to the CFX96 manual, data were analyzed by one-way ANOVA using Microsoft Excel software.

Electron microscopy

At the seedling, elongation, and heading stages, leaves of mutants and WT at the same developmental stage were sampled with 3 replicates for transmission electron microscope analysis. Each sample was processed as described in Guo et al. [58] and photographed with a transmission electron microscope (HT-7700, Hitachi, Japan). Starch granule numbers per chloroplast were calculated, and data were analyzed using the SPSS software [59].

Chlorophyll fluorescence parameters

A pulse amplitude modulation fluorometer (MINI-PAM, Heinz Walz, Effeltrich, Germany) was used to measure chlorophyll fluorescence parameters. At the seedling, elongation, and heading stages, individual plants at the same developmental stage were selected for measurements with three biological and three technical replicates. From 10:00-11:00 am on the same day, after dark adaption by Dark Leaf Clip for 30 min, the value of F /F and Y(II) were measured with a photosynthetically active radiation (PAR) of 281 μmol m-2s-1 according to the manufacturer’s instructions. The response of photosynthetic fluorescence parameters to light intensity changes was determined using rapid light curves. Imaging Win software (Heinz Walz, Effeltrich, Germany) was used to collect and analyze fluorescence parameter data. Data were analyzed by one-way ANOVA with Microsoft Excel software. Primers used for RT-qPCR. Table S2. Percentage of chloroplasts containing different numbers of starch granules. (DOCX 19 kb) Validation of sub-genome-specific RT-qPCR primers using Chinese Spring nullisomic-tetrasomic lines. CS: Chinese Spring; N1DT1B, N1AT1B, N1AT1D, and N1BT1D: Chinese Spring nullisomic-tetrasomic lines; J411: wild type; s4b-qD: TaSSIVb-D-specific primers; s4b-qA: TaSSIVb-A-specific primers; s4b-qB: TaSSIVb-B-specific primers. (DOCX 1759 kb)
  50 in total

Review 1.  Mutation discovery for crop improvement.

Authors:  Martin A J Parry; Pippa J Madgwick; Carlos Bayon; Katie Tearall; Antonio Hernandez-Lopez; Marcela Baudo; Mariann Rakszegi; Walid Hamada; Adnan Al-Yassin; Hassan Ouabbou; Mustapha Labhilili; Andrew L Phillips
Journal:  J Exp Bot       Date:  2009-06-10       Impact factor: 6.992

2.  The phenotype of soluble starch synthase IV defective mutants of Arabidopsis thaliana suggests a novel function of elongation enzymes in the control of starch granule formation.

Authors:  Isaac Roldán; Fabrice Wattebled; M Mercedes Lucas; David Delvallé; Veronique Planchot; Sebastian Jiménez; Ricardo Pérez; Steven Ball; Christophe D'Hulst; Angel Mérida
Journal:  Plant J       Date:  2007-01-01       Impact factor: 6.417

3.  Regulation of photosynthesis by end-product accumulation in leaves of plants storing starch, sucrose, and hexose sugars.

Authors:  E E Goldschmidt; S C Huber
Journal:  Plant Physiol       Date:  1992-08       Impact factor: 8.340

4.  Enhanced ADP-glucose pyrophosphorylase activity in wheat endosperm increases seed yield.

Authors:  Eric D Smidansky; Maureen Clancy; Fletcher D Meyer; Susan P Lanning; Nancy K Blake; Luther E Talbert; Michael J Giroux
Journal:  Proc Natl Acad Sci U S A       Date:  2002-02-05       Impact factor: 11.205

5.  Loss of starch granule initiation has a deleterious effect on the growth of arabidopsis plants due to an accumulation of ADP-glucose.

Authors:  Paula Ragel; Sebastian Streb; Regina Feil; Mariam Sahrawy; Maria Grazia Annunziata; John E Lunn; Samuel Zeeman; Ángel Mérida
Journal:  Plant Physiol       Date:  2013-07-21       Impact factor: 8.340

6.  Molecular cloning and expression analysis of three genes encoding starch synthase II in rice.

Authors:  Huawu Jiang; Weimin Dian; Feiyang Liu; Ping Wu
Journal:  Planta       Date:  2004-01-23       Impact factor: 4.116

7.  Functional characterization of GPC-1 genes in hexaploid wheat.

Authors:  Raz Avni; Rongrong Zhao; Stephen Pearce; Yan Jun; Cristobal Uauy; Facundo Tabbita; Tzion Fahima; Ann Slade; Jorge Dubcovsky; Assaf Distelfeld
Journal:  Planta       Date:  2013-10-30       Impact factor: 4.116

8.  Wheat TILLING mutants show that the vernalization gene VRN1 down-regulates the flowering repressor VRN2 in leaves but is not essential for flowering.

Authors:  Andrew Chen; Jorge Dubcovsky
Journal:  PLoS Genet       Date:  2012-12-13       Impact factor: 5.917

9.  A high-throughput method for the detection of homologous gene deletions in hexaploid wheat.

Authors:  Timothy L Fitzgerald; Kemal Kazan; Zhongyi Li; Matthew K Morell; John M Manners
Journal:  BMC Plant Biol       Date:  2010-11-29       Impact factor: 4.215

10.  High resolution melting analysis for the detection of EMS induced mutations in wheat SBEIIa genes.

Authors:  Ermelinda Botticella; Francesco Sestili; Antonio Hernandez-Lopez; Andrew Phillips; Domenico Lafiandra
Journal:  BMC Plant Biol       Date:  2011-11-10       Impact factor: 4.215

View more
  18 in total

Review 1.  Crop resistant starch and genetic improvement: a review of recent advances.

Authors:  Jian Xia; Dong Zhu; Ruomei Wang; Yue Cui; Yueming Yan
Journal:  Theor Appl Genet       Date:  2018-10-29       Impact factor: 5.699

2.  STARCH SYNTHASE5, a Noncanonical Starch Synthase-Like Protein, Promotes Starch Granule Initiation in Arabidopsis.

Authors:  Melanie R Abt; Barbara Pfister; Mayank Sharma; Simona Eicke; Léo Bürgy; Isabel Neale; David Seung; Samuel C Zeeman
Journal:  Plant Cell       Date:  2020-05-29       Impact factor: 11.277

3.  CBM20CP, a novel functional protein of starch metabolism in green algae.

Authors:  Nicolas Hedin; Maria B Velazquez; Julieta Barchiesi; Diego F Gomez-Casati; Maria V Busi
Journal:  Plant Mol Biol       Date:  2021-09-21       Impact factor: 4.076

Review 4.  Wheat genomic study for genetic improvement of traits in China.

Authors:  Jun Xiao; Bao Liu; Yingyin Yao; Zifeng Guo; Haiyan Jia; Lingrang Kong; Aimin Zhang; Wujun Ma; Zhongfu Ni; Shengbao Xu; Fei Lu; Yuannian Jiao; Wuyun Yang; Xuelei Lin; Silong Sun; Zefu Lu; Lifeng Gao; Guangyao Zhao; Shuanghe Cao; Qian Chen; Kunpu Zhang; Mengcheng Wang; Meng Wang; Zhaorong Hu; Weilong Guo; Guoqiang Li; Xin Ma; Junming Li; Fangpu Han; Xiangdong Fu; Zhengqiang Ma; Daowen Wang; Xueyong Zhang; Hong-Qing Ling; Guangmin Xia; Yiping Tong; Zhiyong Liu; Zhonghu He; Jizeng Jia; Kang Chong
Journal:  Sci China Life Sci       Date:  2022-08-24       Impact factor: 10.372

Review 5.  Resistant starch formation in rice: Genetic regulation and beyond.

Authors:  Lisha Shen; Jiayang Li; Yunhai Li
Journal:  Plant Commun       Date:  2022-04-20

6.  Reverse genetic approaches for breeding nutrient-rich and climate-resilient cereal and food legume crops.

Authors:  Jitendra Kumar; Ajay Kumar; Debjyoti Sen Gupta; Sachin Kumar; Ron M DePauw
Journal:  Heredity (Edinb)       Date:  2022-03-05       Impact factor: 3.832

7.  Unraveling novel and rare mutations for alpha-amylase and key transcription factors in EMS-induced wheat mutants for amylose by TILLING.

Authors:  Vinita Sharma; Ankita Mishra; Himanshu Sharma; Pankaj Kumar; Joy K Roy
Journal:  Mol Biol Rep       Date:  2022-01-29       Impact factor: 2.742

8.  Development of a High-Efficient Mutation Resource with Phenotypic Variation in Hexaploid Winter Wheat and Identification of Novel Alleles in the TaAGP.L-B1 Gene.

Authors:  Huijun Guo; Zhihui Yan; Xiao Li; Yongdun Xie; Hongchun Xiong; Yunchuan Liu; Linshu Zhao; Jiayu Gu; Shirong Zhao; Luxiang Liu
Journal:  Front Plant Sci       Date:  2017-08-10       Impact factor: 5.753

Review 9.  Posttranslational Modification of Waxy to Genetically Improve Starch Quality in Rice Grain.

Authors:  Tosin Victor Adegoke; Yifeng Wang; Lijuan Chen; Huimei Wang; Wanning Liu; Xingyong Liu; Yi-Chen Cheng; Xiaohong Tong; Jiezheng Ying; Jian Zhang
Journal:  Int J Mol Sci       Date:  2021-05-03       Impact factor: 5.923

10.  Identification of Rice Blast Loss-of-Function Mutant Alleles in the Wheat Genome as a New Strategy for Wheat Blast Resistance Breeding.

Authors:  Huijun Guo; Qidi Du; Yongdun Xie; Hongchun Xiong; Linshu Zhao; Jiayu Gu; Shirong Zhao; Xiyun Song; Tofazzal Islam; Luxiang Liu
Journal:  Front Genet       Date:  2021-05-19       Impact factor: 4.599

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.