Literature DB >> 28476152

A novel nonsense mutation in the tyrosinase gene is related to the albinism in a capuchin monkey (Sapajus apella).

Felipe Tadeu Galante Rocha de Vasconcelos1, Einat Hauzman1,2, Leonardo Dutra Henriques1, Paulo Roney Kilpp Goulart3, Olavo de Faria Galvão3, Ronaldo Yuiti Sano1,4, Givago da Silva Souza5,6, Jessica Lynch Alfaro7,8, Luis Carlos de Lima Silveira5,6, Dora Fix Ventura1,2, Daniela Maria Oliveira Bonci9,10.   

Abstract

BACKGROUND: Oculocutaneous Albinism (OCA) is an autosomal recessive inherited condition that affects the pigmentation of eyes, hair and skin. The OCA phenotype may be caused by mutations in the tyrosinase gene (TYR), which expresses the tyrosinase enzyme and has an important role in the synthesis of melanin pigment. The aim of this study was to identify the genetic mutation responsible for the albinism in a captive capuchin monkey, and to describe the TYR gene of normal phenotype individuals. In addition, we identified the subject's species.
RESULTS: A homozygous nonsense mutation was identified in exon 1 of the TYR gene, with the substitution of a cytosine for a thymine nucleotide (C64T) at codon 22, leading to a premature stop codon (R22X) in the albino robust capuchin monkey. The albino and five non-albino robust capuchin monkeys were identified as Sapajus apella, based on phylogenetic analyses, pelage pattern and geographic provenance. One individual was identified as S. macrocephalus.
CONCLUSION: We conclude that the point mutation C64T in the TYR gene is responsible for the OCA1 albino phenotype in the capuchin monkey, classified as Sapajus apella.

Entities:  

Keywords:  Albino; OCA; Sapajus apella; Stop codon; TYR gene

Mesh:

Substances:

Year:  2017        PMID: 28476152      PMCID: PMC5420114          DOI: 10.1186/s12863-017-0504-8

Source DB:  PubMed          Journal:  BMC Genet        ISSN: 1471-2156            Impact factor:   2.797


Background

Albinism is a heterogeneous disorder, characterized by the absence or loss of melanin pigmentation in either skin, hair or eyes. This condition is considered rare in wild populations [1] possibly due to the reduction in camouflage [2, 3] and to its role in a number of pathologies that can compromise an animal’s fitness. Several pathological conditions are associated with albinism, such as immunological [4-6], auditory [7, 8] and visual deficiencies, e.g., nystagmus, absence of fovea, alteration of the optic chiasm decussation, reduction of rod density, photophobia, strabismus, iris transilumination and reduction of visual acuity [5, 9–13]. The biochemical pathway of melanin production is catalyzed by the tyrosinase enzyme, which is expressed by the tyrosinase gene (TYR) [14]. A deficiency in tyrosinase production leads to the total or partial absence of melanin, resulting in the Oculocutaneous Albinism Type 1 (OCA1) [15]. Cases of OCA1 caused by mutations in the TYR gene have been reported in several mammalian species, e.g., in rabbits [16], cattle [17], rats [18], cats [19], ferrets [20], whales [21] and buffalos [22]. Among primates a genetic mutation in the TYR gene was described in two unrelated individuals of rhesus monkey (Macaca mulatta), with phenotypes similar to human OCA1 [23]. Also in primates, a mutation in the SLC45A2 gene was indicated to cause the Type 4 Oculocutaneous Albinism (OCA4) phenotype in one specimen of gorilla (Gorilla gorilla) [24]. In this study, we investigated the genetic causes of albinism in a capuchin monkey, named Sivuca, held in the Experimental School for Primates (EEP), at the Universidade Federal do Pará (UFPA), Belém, Brazil. This adult male (Fig. 1) was found abandoned in the streets of Breves, an Amazon riverside town, handed in to the Brazilian Institute of Environment and Natural Resources (IBAMA), and transferred to the EEP, where it received medical treatment and is currently housed. Young wild animals are prized as exotic pets and are subject to animal trafficking. When these animals grow up into adults they can become dangerous and are often abandoned. Sivuca had his canine teeth filed down by the owners and his tail cut off, probably in a trap. Due to his albinism and history we cannot ascertain where he came from and he cannot be reintroduced into nature. However, Sivuca has adapted well to the captive housing conditions and provides us with an extremely valuable opportunity to identify albinism gene alteration in a species closely related to humans. Studies on different aspects of the albinism in other species, especially in primates, give us important insights into the mechanisms and development of albinism in humans. The description of the tyrosinase gene mutation may contribute to elucidate the underlying machinery of cell pigmentation and its influence on visual system development and the functioning of other systems affected by albinism. Thus, Sivuca represents a good model for a better understanding of this complex disorder.
Fig. 1

The albino capuchin monkey Sivuca (left) and a normal phenotype capuchin monkey Smeagol (right), with the expected pelage pattern of Sapajus apella, at the Experimental School for Primates (EEP), Universidade Federal do Pará (UFPA), Belém, Brazil

The albino capuchin monkey Sivuca (left) and a normal phenotype capuchin monkey Smeagol (right), with the expected pelage pattern of Sapajus apella, at the Experimental School for Primates (EEP), Universidade Federal do Pará (UFPA), Belém, Brazil Capuchin monkeys are divided in two genera, the gracile (Cebus) and the robust capuchin (Sapajus) [25]. Species identification for capuchins demands careful morphological evaluation, information about provenance and molecular phylogenetic analysis [26]. The absence of regular fur coloration and lack of information on capture location makes it impossible to identify the species to which Sivuca belongs without molecular phylogenetic analysis. Thus, the objectives of this study were to identify the mutation responsible for the albino phenotype in the capuchin monkey Sivuca, and to describe the tyrosinase gene sequence of normal phenotype subjects from the same species. In addition we used molecular phylogenetic analysis for dentification of the subject’s species,

Methods

Samples

We analyzed the TYR coding region from genomic DNA using blood samples collected from the albino capuchin monkey (Fig. 1) and from six normal phenotype adult capuchin monkeys (five males and one female), held in the EEP and provisionally identified as Sapajus apella (see below). The animal procedures were in accordance with ethical principles of animal management and experimentation established by the Brazilian Animal Experiment College (COBAE), and the study was approved by the Ethical Committee of the UFPA (CEPAE/UFPA/#040–2015).

DNA extraction and PCR amplification for genetic sequencing

DNA extraction was performed using the Gentra Puregene Blood kit (Gentra Systems, Inc., Minneapolis, Minn., USA), according to the protocol supplied by the manufacturer. Each of the five exons of the TYR gene was amplified using the primers described in Table 1. Primers for exons 1 and 2 were obtained from Preising et al. [27], for amplifying human TYR gene. Primers for exons 3, 4 and 5 were designed on Primer 3 (v. 0.4.0) [28], based on the TYR sequence of the black-capped squirrel monkey Saimiri boliviensis (GenBank accession number XM_003935082.1). Polymerase Chain Reactions (PCRs) were carried out using High Fidelity Platinum Taq Polymerase, 10x High Fidelity Buffer, MgCl2 (Invitrogen), 10 mM GeneAmp dNTPs (Applied Biosystems, Inc.) and 20 mM primers in 50 μl reactions. The PCR conditions were an initial denaturation at 94 °C for 1 min; 37 cycles of 15 s at 94 °C, 30 s at the annealing temperature (Table 1) and 30 s at 72 °C; and a final extension at 72 °C for 7 min. PCR products were visualized by electrophoresis on agarose gel (1%) and purified with Illustra GFXTM PCR DNA and Gel Band Purification Kit (GE Healthcare, Little Chalfont, Buckinghamshire, UK). The PCR products were directly sequenced in both directions with BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Inc.) and the 3500 Applied Biosystems Sequencer. Nucleotide sequences were analyzed and aligned in BioEdit v7.0.9.0 [29], using ClustalW, and the alignment was visually confirmed.
Table 1

Primers used to amplify the TYR gene, the D-loop and Cytochrome b

GenePrimerAnnealing temperatureNucleotide sequence
1TYR Exon 1 TYR11Fw 595' CCAATTAGCCAGTTCCTGCAGA 3'
TYR11Rv 5' CACAGTTGAATCCCATGAAGTTGC 3'
TYR12Fw 575' TATAATAGGACCTGCCAGTGCTCTG 3'
Tyr12Rv 5' AATGTCTCTCAAGATTTCAGATCCC 3'
Tyr13Fw 605' TGTGTCAATGGATGCACTGCTT 3'
Tyr13Rv 5' AGAAGTGATTGTTAAGGTTCCTCCC 3'
1TYR Exon 2 Tyr2Fw 605' TTGTTTAACATGAGGGTGTTTTGTACAG 3'
Tyr2Rv 5' GGACTTTGGATAAGAGACTGTAAATATG 3'
TYR Exon 3 Tyr3SbFw 595' TCCATTTACTGGGATAGCAGATG 3'
Tyr3SbRv 5' GTGAAGAAGGAAGATGGGATCAT 3'
TYR Exon 4 Tyr4SbFw 595' GAAGGCATCGCCCTCTTCTA 3'
Tyr4SbRv 5' AGGTAGCTATAGTCATAGCCCAGA 3'
TYR Exon 5 Tyr5SbFw 605' CCCAGACTCTTTTCAAGACTAACATT 3'
Tyr5SbRv 5' AATAAAGATGGGGCCAATAAAAA 3'
2D-loop L 605' GGCCTTGTAAACCGGAAAAGG 3'
R 5' GAAAGGCTAGGACCAAACCTG 3'
3CytBL14724585' CGAAGCTTGATATGAAAAACCATCGTTG 3'
CIT-REV5' GAATATCAGCTTTGG 3'

1Preising et al. [27]; 2Schneider et al. [40]; 3Irwin et al. [41]

Primers used to amplify the TYR gene, the D-loop and Cytochrome b 1Preising et al. [27]; 2Schneider et al. [40]; 3Irwin et al. [41]

Phylogenetic approach for species classification

The capuchin monkey group includes two distinct genera, Sapajus and Cebus, [30], and species classification within each genus demands more than a simple morphological evaluation because of the highly polymorphic nature of within-species variation in capuchin monkeys [31, 32]. As the captive animals in the study are of unknown provenance, their species affiliation is uncertain. In order to determine the most likely geographic and species affiliation we amplified and sequenced the Cytochrome b and D-loop (GenBank accession numbers KY971495 and KY971496, respectively) regions of the mitochondrial DNA (as described above), using primers described in Table 1. We created an alignment using sequences from Lima et al. [33] that included samples from all currently recognized Sapajus species [32] and geographic subclades within species groups [33]. We aligned the sequences from these 63 samples of known species designation with Cytochrome b and D-loop sequences from the albino capuchin Sivuca and six other non-albino captive capuchins captured by IBAMA from nearby localities and housed at EEP, for a total of 70 capuchin samples. We aligned and concatenated the data set in Geneious Pro 5.3.4. In our D-loop alignment, we removed a small number of base pairs (bp) that were ambiguously aligned. Our final alignment consisted of a total of 586 bp of Cytochrome b and 585 bp of D-loop. We ran the dataset on Partition Finder v.1.1.1 [34] with linked branch lengths, all models, BIC for model selection, and greedy search parameters to determine the best-fit model of gene evolution for each partition. We recovered the best partitioning scheme as follows: CYTB 1st and 2nd codon positions as HKY + I, CYTB 3rd position as HKY, and D-loop as HKY + I + G. We subsequently ran a MrBayes 3.2 [35] Markov chain Monte Carlo (MCMC) analysis for 1,000,000 generations, with trees sampled every 1,000 generations. We discarded the first 25% of the data as burnin, and used ‘sumt’ to calculate the Bayesian consensus tree, visualized in Figtree v.1.4.0 (available from: http://tree.bio.ed.ac.uk/software/figtree/). GenBank Accession numbers for all sequences are available in Additional file 1. For final species classification the phylogenetic analysis results were compared with an evaluation of the pelage patterns of non-albino individuals [33].

Results and discussion

Species identification

The albino capuchin monkey Sivuca and five non-albino ‘normal’ phenotype captive individuals clustered in a clade with Sapajus apella and Sapajus libidinosus individuals (Fig. 2), with high posterior probability (pp = 1). This clade corresponds to “Sapajus CLADE 4, Subclade 2” in the extensive capuchin-wide phylogeny by Lima et al. [33]. This subclade includes both Sapajus libidinosus individuals from throughout the Caatinga and Cerrado habitats, as well as Eastern Sapajus apella from Tocantins and Tucuruí. Based on the genetic data, the pelage patterns for the non-albino individuals (Fig. 1) and the observation from EEP staff that the monkeys may have originated from the right bank of the Tocantins River, that marks the far eastern end of the distribution for Sapajus apella, we classify the genus and species [36, 37] of the albino and normal phenotype capuchin monkeys analyzed in this study as eastern Brazilian Sapajus apella. The exception is one individual (Tadinho), whose mtDNA sequence formed a clade instead with S. macrocephalus and S. apella individuals from “Sapajus CLADE 4, Subclade 5” [33], with high support (pp = 1) (Fig. 2). This is a northern clade of Amazonian Sapajus that spans the Amazon River and extends from northern Brazil to the Guianas.
Fig. 2

Phylogenetic tree obtained from Bayesian analysis for Sapajus species, based on concatenated alignment of Cytochrome b and D-loop region of the mitochondrial DNA, of seven individuals housed at the Experimental School for Primates (EEP), at the Universidade Federal do Pará (UFPA), Belém, Brazil, including the albino Sivuca and 63 samples from currently recognized Sapajus species [42] and the geographic subclades within species groups [33]. Numbers at nodes represent Bayesian posterior probability. The scale bar represents the number of nucleotide substitutions per site

Phylogenetic tree obtained from Bayesian analysis for Sapajus species, based on concatenated alignment of Cytochrome b and D-loop region of the mitochondrial DNA, of seven individuals housed at the Experimental School for Primates (EEP), at the Universidade Federal do Pará (UFPA), Belém, Brazil, including the albino Sivuca and 63 samples from currently recognized Sapajus species [42] and the geographic subclades within species groups [33]. Numbers at nodes represent Bayesian posterior probability. The scale bar represents the number of nucleotide substitutions per site

Capuchin monkey tyrosinase gene

Most studied cases of albinism in human and other mammals are associated with mutations in the TYR gene and therefore, we focused our investigation on this gene in the albino capuchin monkey. This is the first study to describe the tyrosine gene in capuchin monkeys. The TYR coding sequence in mammals consists of five exons. We were able to partially amplify and sequence the five exons of the albino and the non-albino capuchin monkeys, with some gaps between the exon junctions (Additional file 2). No variation was observed among the TYR coding sequences analyzed of the six normal phenotype capuchins. The estimated TYR coding sequence had a total length of 1590 bp that together encode a 530 amino acid TYR protein. The length of the TYR coding sequence varies slightly among species, with 529 amino acids in humans and 530 in the rhesus monkey and the black-capped squirrel monkey (GenBank accession numbers: NM000372.4, XM_001105033.3 and XM_003935082.1, respectively). The TYR coding sequence of normal phenotype Sapajus apella capuchin monkey was deposited in GenBank database (KY990734).

Tyrosinase gene mutation

The TYR gene sequences from the albino and normal phenotype capuchin monkeys were aligned and analyzed to determine if there were polymorphisms in the gene sequences. We found no polymorphisms, except a homozygous C-to-T transition at position +64 within the first exon (Fig. 3), which leads to the conversion of an arginine codon (CGA) into a stop codon (TGA) in the albino primate only. This premature stop codon (R22X) produces a truncated TYR protein with only 22 amino acids and has not been described in other species. Notwithstanding, nonsense mutations in exon 1 have been described in human (W128X) [38], rhesus monkey (S184X) [23] and mink (C46X) [39], and all resulted in the OCA type 1 phenotype. Albinism was also associated with frameshift mutations in codon 316 in cattle [17] and at codon 325 in cats, which caused a premature stop codon nine codons downstream of the deletion [19].
Fig. 3

Normal and mutant sequences of the TYR gene in the region of the R22X nonsense mutation of capuchin monkeys Sapajus apella

Normal and mutant sequences of the TYR gene in the region of the R22X nonsense mutation of capuchin monkeys Sapajus apella

Conclusions

We detected a nonsense mutation (C64T) in exon 1, which generated a premature stop codon (R22X) in the TYR gene of the albino capuchin monkey Sivuca. This mutation generates a truncated TYR protein, which is responsible for the OCA1 phenotype in this individual. Sivuca was classified as Sapajus apella, based on the phylogenetic reconstruction of the D-loop and Cytochrome b regions of mitochondrial DNA. Thus, this study provides the identification and description of a new nonsense mutation causing OCA1 albinism and describes the tyrosinase gene in normal phenotype capuchin monkeys, Sapajus apella. GenBank accession numbers and geographic coordinates for robust capuchin samples from GenBank used in this study. (PDF 95 kb) Alignment of the amino acid sequences of the TYR proteins of human (XM_011542970.2), rhesus monkey (XM001105033.3), marmoset (XM_002754705.2), squirrel monkey (XM_003935082.1) and the capuchin monkey. Identical residues are indicated by dots. The position of the nonsense mutation in the albino capuchin monkey, Sivuca, is shown by a star. (TIF 1166 kb)
  31 in total

1.  Tyrosinase gene variants in different rabbit strains.

Authors:  B Aigner; U Besenfelder; M Müller; G Brem
Journal:  Mamm Genome       Date:  2000-08       Impact factor: 2.957

2.  Variation in the tyrosinase gene associated with a white humpback whale (Megaptera novaeangliae).

Authors:  Andrea M Polanowski; Sarah M Robinson-Laverick; David Paton; Simon N Jarman
Journal:  J Hered       Date:  2011-12-02       Impact factor: 2.645

3.  Griscelli syndrome - a case report.

Authors:  Mamta Manglani; Kaitav Adhvaryu; Bageshree Seth
Journal:  Indian Pediatr       Date:  2004-07       Impact factor: 1.411

Review 4.  How different are robust and gracile capuchin monkeys? An argument for the use of sapajus and cebus.

Authors:  Jessica W Lynch Alfaro; José D E Sousa E Silva; Anthony B Rylands
Journal:  Am J Primatol       Date:  2012-02-10       Impact factor: 2.371

5.  [Griscelli-Prunieras syndrome: report of two cases].

Authors:  P González Carretero; A Noguera Julian; S Ricart Campos; C Fortuny Guasch; L Martorell Sampol
Journal:  An Pediatr (Barc)       Date:  2008-12-06       Impact factor: 1.500

6.  A Tyrosinase missense mutation causes albinism in the Wistar rat.

Authors:  Wanda M Blaszczyk; Larissa Arning; Klaus-Peter Hoffmann; Joerg T Epplen
Journal:  Pigment Cell Res       Date:  2005-04

7.  Vision defects in albinism.

Authors:  J Pérez-Carpinell; P Capilla; C Illueca; J Morales
Journal:  Optom Vis Sci       Date:  1992-08       Impact factor: 1.973

8.  Melanin precursors prevent premature age-related and noise-induced hearing loss in albino mice.

Authors:  Silvia Murillo-Cuesta; Julio Contreras; Esther Zurita; Rafael Cediel; Marta Cantero; Isabel Varela-Nieto; Lluís Montoliu
Journal:  Pigment Cell Melanoma Res       Date:  2009-10-19       Impact factor: 4.693

9.  MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space.

Authors:  Fredrik Ronquist; Maxim Teslenko; Paul van der Mark; Daniel L Ayres; Aaron Darling; Sebastian Höhna; Bret Larget; Liang Liu; Marc A Suchard; John P Huelsenbeck
Journal:  Syst Biol       Date:  2012-02-22       Impact factor: 15.683

10.  The genome sequencing of an albino Western lowland gorilla reveals inbreeding in the wild.

Authors:  Javier Prado-Martinez; Irene Hernando-Herraez; Belen Lorente-Galdos; Marc Dabad; Oscar Ramirez; Carlos Baeza-Delgado; Carlos Morcillo-Suarez; Can Alkan; Fereydoun Hormozdiari; Emanuele Raineri; Jordi Estellé; Marcos Fernandez-Callejo; Mònica Valles; Lars Ritscher; Torsten Schöneberg; Elisa de la Calle-Mustienes; Sònia Casillas; Raquel Rubio-Acero; Marta Melé; Johannes Engelken; Mario Caceres; Jose Luis Gomez-Skarmeta; Marta Gut; Jaume Bertranpetit; Ivo G Gut; Teresa Abello; Evan E Eichler; Ismael Mingarro; Carles Lalueza-Fox; Arcadi Navarro; Tomas Marques-Bonet
Journal:  BMC Genomics       Date:  2013-05-31       Impact factor: 3.969

View more
  4 in total

1.  Behavioral and genetic color vision evaluation of an albino male capuchin monkey (Sapajus apella).

Authors:  Leonardo Dutra Henriques; J C P Oliveira; D M O Bonci; R C Leão; G S Souza; L C L Silveira; O F Galvão; P R K Goulart; D F Ventura
Journal:  J Comp Physiol A Neuroethol Sens Neural Behav Physiol       Date:  2019-05-20       Impact factor: 1.836

2.  A community-science approach identifies genetic variants associated with three color morphs in ball pythons (Python regius).

Authors:  Autumn R Brown; Kaylee Comai; Dominic Mannino; Haily McCullough; Yamini Donekal; Hunter C Meyers; Chiron W Graves; Hannah S Seidel
Journal:  PLoS One       Date:  2022-10-19       Impact factor: 3.752

3.  Pigmentation formation and expression analysis of tyrosinase in Siniperca chuatsi.

Authors:  Minglin Wu; Xiaowu Chen; Kai Cui; Haiyang Li; Yangyang Jiang
Journal:  Fish Physiol Biochem       Date:  2020-03-17       Impact factor: 2.794

4.  Comparative transcriptomics of albino and warningly-coloured caterpillars.

Authors:  Juan A Galarza
Journal:  Ecol Evol       Date:  2021-05-02       Impact factor: 2.912

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.