MicroRNA-497 suppresses renal cell carcinoma by targeting VEGFR-2 in ACHN cells.

Abnormal expression of miRNAs contributed to cancers through regulation of proliferation, apoptosis and drug resistance of cancer cells. The present study was designed to investigate the effect of miR-497 on renal cell carcinoma (RCC) and its possible mechanism. Forty paired clear cell RCC (ccRCC) tissues and adjacent normal kidney tissues were obtained from patients, who were not treated by chemotherapy or radiotherapy. RT-PCR was performed to detect expression of miR-497 in the ccRCC tissues. Effects of miR-497 on cell viability, apoptosis, migration and invasion were detected in ACHN cells. Western blotting (WB) was employed to detect the downstream targets of miR-497 We found that miR-497 in ccRCC tissues was decreased. We treated ACHN cells with miR-497 mimics and inhibitors in vitro and found that miR-497 inhibited viability, migration and invasion of ACHN cells. miR-497 promoted ACHN cells' apoptosis. VEGFR-2 was predicted as a possible target of miR-497 Luciferase reporter assay proved that miR-497 suppressed VEGFR-2 directly by binding to its 3'-UTR. Further studies showed that miR-497 influenced the MEK/ERK and p38 MAPK signalling pathways. Our findings demonstrated that miR-497 could suppress RCC by targeting VEGFR-2.

Introduction

Renal cell carcinoma (RCC) is the most common type of kidney cancers in adults. Clear cell RCC (ccRCC) accounts for more than 80% of all RCC types [1]. RCC is resistant to conventional cancer treatments, such as radiotherapy, chemotherapy and immunotherapy [2,3]. Although surgery is a curative treatment for localized RCC, most patients with advanced or metastatic RCC have poor prognosis [4,5]. For these reasons, accurate and predictive markers and new therapeutic methods are urgently needed.

miRNAs are a class of endogenous small non-coding RNAs, which suppress their target mRNAs expression by binding to the 3′-UTR based on complementary sequence as well as accessibility of the potential target site. MiRNAs negatively regulate gene expression by either translational inhibition or degradation of target mRNAs [6,7]. Ample evidence suggested that the abnormal expression of miRNAs played important roles in many biological processes, including tumorigenesis [8-10].

miR-497 plays important roles in a variety of cancers, including lung cancer, breast carcinoma, colorectal cancer cells, osteosarcoma and prostate cancer [11-15]. Zhao et al. [16] reported that miR-497 was decreased in ccRCC tissues. However, the function and mechansim of miR-497 in ccRCC need to be systematically studied. In the present study, we examined the expression of miR-497 in ccRCC tissues, analysed the association of miR-497 and tumour metastasis and further explored the possible mechanism.

Materials and methods

Tissue samples

Forty paired ccRCC tissues and adjacent normal kidney tissues were obtained from patients who were not treated by chemotherapy or radiotherapy. When the patients underwent radical nephrectomy, the tissues were separated and stored in liquid nitrogen. All the samples were collected from the Department of Urology, the Fourth Affiliated Hospital of Harbin Medicine University (Harbin Heilongjiang, China) after informed consent and the approval of the Ethics Committee of the Fourth Affiliated Hospital of Harbin Medical University.

RNA isolation and qRT-PCR

Total RNA was extracted using TRIzol (Invitrogen, U.S.A.) according to the manufacturer’s instructions. Two micrograms of total RNA from each sample was reverse transcribed into cDNA using the RNA PCR Kit (Takara Biotechnology, Japan). The real-time quantitative PCR was performed on the ABI PRISM 7500 Sequence Detector (Applied Biosystems). Then, qRT-PCR was performed to quantify the expression level of miR-497 with SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. miR-497 expression normalized to U6 was calculated using the comparative Ct method formula: 2−ΔΔt. Primers for amplification of U6 and miR-497 are listed in Table 1.

Table 1

Primers used for PCR

Genes	Primer
miR-497 F	ACACTCCAGCTGGGCAGCAGCACACTGTG
miR-497 R	CTCAACTGGTGTCGTGGAGTCG
U6 F	CTCGCTTCGGCAGCACA
U6 R	AACGCTTCACGAATTTGCGT

Cell culture and treatment

The human ccRCC cell line ACHN was purchased from the American Type Culture Collection (A.T.C.C.) and cultured in DMEM medium (Gibco) supplemented with 10% heat-inactivated FBS (Gibco) and 100 mg/ml penicillin-streptomycin. The cells were maintained under a humidified atmosphere of 5% CO2 at 37°C. The miR-497 mimics, miR-497 inhibitor and their corresponding negative controls synthesized and purified by GenePharma Company (Shanghai, China) were transfected into ACHN cells at a final concentration of 50/100 nM using X-treme in serum-free Opti-MEM (Invitrogen, CA, U.S.A.). Transfection efficiency was confirmed by real-time PCR. All miRNA ssequences are listed in Table 2.

Table 2

Sequence for miRNA

Names	Sequence
miR-497 mimics	UAGCAGCACAUAAUGGUUUGUG
Negative control	UUCUCCGAACGUGUCACGUTT
miR-497 inhibitor	CACAAACCAUUAUGUGCUGCUA
Negative control	ACGUGACACGUUCGGAGAATT

Cell counting kit-8 assay

A cell counting kit-8 (CCK-8) assay kit (Beyotime Institute of Biotechnology) was used in this experiment. ACHN cells in the logarithmic phase of growth were seeded separately in a 96-well plate at a cell density of 4 × 104/well. The cells were transfected with miR-497 mimics, miR-497 inhibitor and their corresponding negative controls as mentioned before. After 48 h of transfection treatment, 10 µl CCK-8 was added into each well. The cells were cultured at 37°C in 5% CO2 for another 2 h, and then the absorbance was detected at 450 nm. All experiments were performed in triplicate.

Migration and matrigel invasion assays

Cell Migration Assay Kit containing polycarbonate membrane insert (8 µm, Millipore) was used for the migration assay. Transfected cells (5 × 104) were resuspended in serum-free DMEM and were placed in the upper chamber (Corning, NY, U.S.A.). Migratory cells were able to pass through the pores of the polycarbonate membrane towards the bottom chamber, which contained 10% FBS used as the chemoattractant. After incubation for 24 h, the non-migratory cells were removed from the top of the membrane and the migratory cells were stained with 0.4% Violet Crystal acetate overnight and quantified. The stained cells were viewed under a microscope (×200 magnification) and the number of the cells were counted in five random fields. Similarly, 5 × 104 cells were seeded on a transwell insert which was precoated with ECM Gel (BD Bioscience, San Jose, U.S.A.). After 24-h incubation, cells adherent to the upper surface of the filter were removed from the top of the membrane and the invading cells were stained and quantified. The assays were performed three times.

Terminal deoxynucleotidyl transferase dUTP nick-end labelling staining

ACHN cells were seeded on coverslips (1.0 × 105cells/well) in the 12-well plate. After treatment, the coverslips were fixed with 10% paraformaldehyde. Apoptosis of ACHN cells was detected with the In Situ Cell Death Detection kit (Terminal Deoxynucleotidyl Transferase dUTP Nick-end Labelling Fluorescence FITC Kit, Roche Molecular Biochemicals) according to the manufacturer’s instructions. After TUNEL staining, the coverslips were dropped into DAPI (Sigma–Aldrich) solution to stain nuclei. Fluorescence staining was viewed by laser scanning confocal microscopy (×200 magnification) (FV300, Olympus, Japan). TUNEL-positive cells were counted in five random fields.

Luciferase reporter assay

To evaluate the effect of miR-497 on VEGFR-2 3′-UTR, firefly and Renilla luciferase activity were measured by Dual-Luciferase Reporter Assay System (Promega, U.S.A.). Wild-type and mutated miR-497 target sites in the 3′-UTR of VEGFR-2 were cloned into luciferase reporter vectors.The psi-CHECK2 or psi-CHECK2 vectors containing VEGFR-2 3′-UTR or VEGFR-2 3′-UTR-M were cotransfected with negative control (NC)/miR-497 mimics/inhibitor NC/miR-497 inhibitor into cells using oligofectamine (Invitrogen). Three independent transfection experiments were performed in triplicate for each plasmid construct.

Protein extraction and Western blot analysis

The proteins were extracted from the transfected cells. Briefly, the cells were washed with PBS and suspended in RIPA lysis buffer (Thermo Scientific). The lysates were collected and stored at –20°C. Supernatant protein concentration was determined using the Bio–Rad protein assay system (Bio–Rad). Equal amounts of protein samples (100 μg) were fractionated by SDS/PAGE (8–15% polyacrylamide gels) and transferred to a nitrocellulose membrane. The blots were blocked for 2 h with 5% non-fat milk at room temperature, then immunoblotted with primary antibodies including Bax (1:200 dilution, Cell Signaling Technology), Bcl-2 (1:200 dilution, Cell Signaling Technology), caspase-3 (1:200 dilution, Cell Signaling), VEGFR-2 (1:200 dilution, Abcam), MEK (1:500 dilution, Cell Signaling), p-MEK (1:500 dilution, Cell Signaling), ERK (1:500 dilution, Cell Signaling), p-ERK1/2 (p44/p42) (1:500 dilution, Cell Signaling), p38 (1:200 dilution, Santa Cruz Biotechnology), p-p38 (1:500 dilution, Cell Signaling) in PBS and incubated at 4°C overnight. The membranes were washed with PBS-T and then incubated with secondary antibodies: Alexa Fluor 800 goat anti-mouse or anti-rabbit IgG (Invitrogen) and detected by the Odyssey v1.2 software by measuring the band intensity (area × OD) for each group. GAPDH was used as a loading control.

Statistical analysis

Data are presented as the mean ± S.E.M. The data were analysed using the SPSS 14.0 and GraphPad Prism 5.0. Statistical analyses were performed by ANOVA using Dunnett’s multiple comparison test or Students t test or Chi-squared test. P-value <0.05 was considered statistically significant.

Results

miR-497 was down-regulated in ccRCC tissues

In the present study, we quantified the expression levels of miR-497 in 40 pairs of human ccRCC tissues and adjacent normal tissues by qRT-PCR. We found that the expression level of miR-497 in tumour tissues was generally lower than the matched normal kidney tissues (Figure 1, P<0.01). Further analysis showed that low miR-497 expression was correlated with tumour size and lymph node metastases (P<0.05, Table 3). There was no significant correlation between the expression of miR-497 and the other clinicopathological parameters, including the patients’ age, gender, location and histological stage.

Figure 1

Expression of miR-497 in vivo

Level of miR-497 that was detected in ccRCC tissues was significantly lower than the level of miR-497 detected in the corresponding adjacent normal kidney tissues (**, P<0.01).

Table 3

Correlation between miR-497 expression and clinicopathologic characteristics

Variables	Patient	Low expression	High expression	P
Age (years)
<60	15	10	5	0.864
≥60	25	16	9
Gender
Male	27	14	6	0.507
Female	13	12	8
Size
>3 cm	26	20	6	0.032
≤3 cm	14	6	8
Location
Right	23	13	10	0.185
Left	17	13	4
Histological
I, II	28	16	12	0.098
III, IV	12	10	2
Metastasis
Yes	13	12	1	0.007
No	27	14	13

miR-497 inhibited ACHN cell viability

To examine the influence of miR-497 on ccRCC cells, we cultured ACHN cells in vitro and treated the cells with miR-497 mimics and miR-497 inhibitors. Firstly, we checked the effect of miR-497 mimics and miR-497 inhibitors. We found that miR-497 mimics (50 nM) and miR-497 inhibitors (100 nM) successfully increased and decreased miR-497 expression respectively (Supplementary Figure S1). CCK-8 assay was used to evaluate cell viability [17,18]. We found that miR-497 mimics significantly reduced cell viability compared with the control group. However, the inhibitor of miR-497 did not affect cell viability (Figure 2, P<0.01).

Figure 2

miR-497 inhibits viability in ACHN cells

Cell viability was determined by CCK-8 assay after transfection. Data represent mean ± S.E.M. from three independent experiments (**, P<0.01).

miR-497 inhibited migratory and invasive behaviour of ACHN cells

We also examined the influence of miR-497 on ACHN cells’ migratory and invasive behaviour. Transwell migration and matrigel invasion assays were employed. We found that miR-497 mimics decreased cell migration (Figure 3A,C) and invasion (Figure 3B,D) compared with the control group; while the inhibitor did not increase the invasion and migration of ACHN cells.

Figure 3

(A,C) Exogenous expression of miR-497 reduces the migration of ACHN cells. Photographs represented the cells travelled through the membrane by Transwell assay (×200 magnification). (B,D) Photographs represented the cells passing through the matrigel by Matrigel invasion assay (×200 magnification).

Data represent mean ± S.E.M. from three independent experiments (**, P<0.01).

miR-497 induced apoptosis in ACHN cells

We used TUNEL to detect apoptosis. A statistical graph of apoptosis rate showed that miR-497 caused an increase in apoptotic cells compared with the control group (Figure 4A,B, P<0.01). Western blot also showed that apoptosis-related proteins Bax, Bcl-2 and caspase-3 levels changed compared with the control group. miR-497 mimics increased the expression of Bax. On the contrary, Bcl-2 expression was depressed. miR-497 mimics also increased relative caspase-3 protein level. (Figure 4C–E, P<0.01).

Figure 4

The appearance of apoptosis characteristics in each treated group of ACHN cells

(A,B) Detection of apoptotic ACHN cells by TUNEL and DAPI staining assay. Nuclear TUNEL staining (green) is superimposed on the phase contrast image of the cells to show the contour of the cells. The mean percentage of TUNEL-positive cells (n≥3 batches of cells for each column) were counted from five fields for each group. Original magnification: ×200. Data represent mean ± S.E.M. (**, P<0.01). (C,D,E) Expression levels of Bax, Bcl-2 and caspase-3 proteins in transfected cells. Cell lysates were prepared and used for Western blot of Bax, Bcl-2 and cleaved caspase-3 in different groups. Data are expressed as mean ± S.E.M. from three independent experiments (**, P<0.01, ***, P<0.001).

VEGFR-2 was a direct target of miR-497

VEGFR-2 is a putative target of miR-497, which was identified by TargetScan. To confirm it, we examined the expression of VEGFR-2 after treatment with miR-497 mimics and miR-497 inhibitors. We found that VEGFR-2 was significantly decreased after transfection of miR-497 mimics (Figure 5A, P<0.01). Dual luciferase reporter gene assay was employed to confirm whether miR-497 could directly bind to 3′-UTR of VEGFR-2. Compared with the NC, miR-497 up-regulation significantly suppressed the relative luciferase activity of the wild-type reporter plasmid, but that of the mutant reporter plasmid was unaffected. (Figure 5B,C).

Figure 5

miR-497 modulates VEGFR-2 directly

(A) The expression of VEGFR-2 was significantly decreased in protein level after restoration of miR-497 by miR-497 mimics. (B) Schematic diagram showed the predicted region where miR-497 is expected to bind VEGFR-2 3′-UTR and the mutated version lacking the binding site for miR-497. Wild-type and mutated miR-497 target sites in the 3′-UTR of VEGFR-2 were cloned into luciferase reporter vectors. (C) Wild-type and mutated miR-497 target sites in the 3′-UTR of VEGFR-2 were cloned into luciferase reporter vectors. Dual-luciferase reporter assay was performed in ACHN cells. Values are presented as relative luciferase activity after normalization to Renilla luciferase activity. The luciferase experiments were repeated three times.

miR-497 inhibited MEK/ERK and activated p38 MAPK signalling

To further explore the possible mechanism, we examined the MEK/ERK and p38 MAPK signalling pathway. We found that miR-497 mimics significantly increased p38 signalling pathway. Meanwhile, transfection of miR-497 mimics inhibited activation of MEK. The expression of p-ERK was decreased but there was no change in total ERK as compared with NC (Figure 6, P<0.01).

Figure 6

miR-497 inhibited MEK/ERK and activated p38 MAPK signalling.

(A) The p38 (B) p-p38 (C) MEK (D) p-MEK (E) ERK and (F) p-ERK were measured by Western blot. Data are expressed as mean ± S.E.M. from three independent experiments (**, P<0.01).

Discussion

Accumulating data showed that miR-497 was a significantly down-regulated in various cancers and was associated with cancer development [11-15]. However, the roles of miR-497 in ccRCC remain elusive. In the present study, we found that miR-497 was lowly expressed in ccRCC tissues and was associated with lymph node metastasis. In vitro studies showed that miR-497 inhibited ACHN cell viability, promoted ACHN cell apoptosis through influencing the balance of apoptosis-related proteins and inhibited migratory and invasive behaviour of ACHN cells. Further studies showed that VEGFR-2 was one direct target of miR-497 and miR-497 also influenced the MEK/ERK and p38 MAPK signalling pathways.

The differential expression of miRNAs between cancer tissues and adjacent normal tissues indicated these specific miRNAs were involved in occurrence and development of cancer and could be the potential targets for cancer treatment. RCC also exhibited alterations in the abundance of specific miRNAs [19-21]. The imbalance of substantial miRNAs in RCC tissues have been proposed to be potential biomarkers for prognosis [22]. In the present study, we found that the expression of miR-497 was lower in ccRCC tissues compared with adjacent normal tissues, suggesting miR-497 may serve as a tumour suppressor. In addition, we found the low expression of miR-497 was correlated with tumour size and lymph node metastases. Zhao et al. [16] showed that decreased miR-497 expression was significantly associated with tumour stage, histological grade and lymph node metastases, which were consistent with our findings.

To explore the possible mechanism of miR-497 on ccRCC, we employed ACHN cell model. miR-497 mimics significantly reduced cell viability and increased the apoptosis in ACHN cells. The decrease in cell viability may be the result of apoptosis. We also found that apoptosis-related proteins were also changed. miR-497 mimics increased the expression of Bax. Contrarily, Bcl-2 expression was depressed. miR-497 mimics also increased relative caspase-3 protein level. So the imbalance of these proteins contributed to the apoptosis. For the behaviour examination, miR-497 mimics also decreased cell migration and invasion compared with control group; while their inhibitors did not increase the invasion and migration of ACHN cells. These in vitro results suggested that miR-497 may also serve as a tumour suppressor in ccRCC.

miRNAs is a cluster of non-encoding RNAs combining with specific target genes to play a certain biological function in the cells. To explore the possible target of miR-497, we searched the gene prediction database (http://www.targetscan.org/) and found that VEGFR-2 was a potential target of miR-497. To confirm the prediction, we introduced exogenous miR-497 into ACHN cells and found that miR-497 mimics indeed down-regulated VEGFR-2 expression. Luciferase reporter assay proved that miR-497 up-regulation significantly suppressed the relative luciferase activity of the wild-type reporter plasmid, but the mutant reporter plasmid was unaffected. These results suggested that VEGFR-2 is one direct target of miR-497. Whether VEGFR-2 mediated the phenotype of miR-497, we did not offer direct evidence. Previous studies showed that VEGFA/VEGFR-2-mediated signalling pathways played an important role in the development and maintenance of ccRCC [23,24]. So, we inferred that VEGFR-2 may mediate the effect of miR-497 on ccRCC.

Human VEGFR-2 is also known as kinase domain receptor (KDR), which plays important role in angiogenesis and tumour growth [25,26]. As the most effective vascular growth factor, VEGF exerts its biological function on the endothelial cells mainly through the activation of VEGFR-2, including the stimulation of endothelial cell proliferation, increased vascular permeability and the chemotaxis of endothelial cells [27,28]. Studies showed that MEK/ERK and p38 MAPK signalling mediated by VEGFR-2 regulated cell proliferation, migration, invasion, survival and so on. We also observed the change in MEK/ERK and p38 MAPK. We found that miR-497 mimics significantly increased p38 signalling pathway, however, miR-497 mimics inhibited the activation of MEK. These results suggested that restoration of the expression of miR-497 suppressed VEGFR-2, which may modulate MEK/ERK and p38 MAPK signalling in ccRCC.

The above data and discussion showed that miR-497 is greatly related to the ccRCC. However, is the decreased expression of miR-497 a cause or an effect of the malignant phenotype of ccRCC? We found that miR-497 inhibitors had no effect on viability, invasion and migration of ACHN cells. In fact, inhibition of miR-497 activity might conbribute to the transformation of normal cells, but ACHN cells are presumably already transformed. So ACHN cells may not response to the miR-497 inhibitors. In contrast, the elevated expression of miR-497 does impair the transformed phenotype of these cells. So, we inferred that the decreased expression of miR-497 may contribute to the malignant phenotype of ccRCC.

In conclusion, we found that miR-497 was lowly expressed in ccRCC tissues and low expression of miR-497 was associated with lymph node metastasis. VEGFR-2, working as one possible target of miR-497 may contribute to the process. miR-497 is expected to be a potential maker for prognosis and one possible target for therapy.