Literature DB >> 28454448

GNAQ mutation R183Q as a potential cause of familial Sturge-Weber syndrome: A case report.

Zhengyi Huang1, Yuchi Li2, Zengxia Zhao3, Jun Hu1, Xiaoxin Tong1, Xuhui Chen1, Shuyun Liu3, Xiaonan Xu4, Yongjun Tao5, Tingting Wang6, Xin Cheng7, Yangyang Dai8, Yaoting Gui2, Jun Wu1.   

Abstract

Sturge-Weber syndrome (SWS) is a rare neurocutaneous disorder whose etiology remains unclear. To investigate the genetic contribution underlying this disease, the genetic variants of a 4-generation family with a history of SWS was analyzed in the present study. SWS was diagnosed in 3 of the family members (II-1, III-11 and IV-6). Sanger sequencing was performed to identify mutations in G protein subunit αq (GNAQ) and RAS p21 protein activator 1 exons in the 3 patients with SWS and other unaffected family members. Notably, a non-synonymous single-nucleotide variant at codon 183 on exon 4 of the GNAQ gene was identified as the only pathogenic site. This variant generated a substitution of arginine (R) with glutamine and resulted in a change of function of the encoded protein. Evolutionary conservation analysis revealed that the mutated residue 183 (R) of GNAQ is highly conserved across several vertebrate species. Furthermore, an immunofluorescence staining assay demonstrated that the substitution of arginine with glutamine resulted in a change in the sub-cellular localization of the GNAQ recombinant protein in vitro. These findings may aid in the development of novel diagnostic markers and/or therapeutic targets for the treatment of patients with familial SWS.

Entities:  

Keywords:  G protein subunit αq; Sanger sequencing; localization; substitution

Year:  2017        PMID: 28454448      PMCID: PMC5403265          DOI: 10.3892/ol.2017.5791

Source DB:  PubMed          Journal:  Oncol Lett        ISSN: 1792-1074            Impact factor:   2.967


Introduction

Sturge-Weber syndrome (SWS), also known as encephalofacial angiomatosis, is a congenital neurocutaneous disorder characterized by facial port-wine stains, ipsilateral occipital leptomeningeal angioma and/or abnormal blood vessels in the eyes, which predisposes patients to glaucoma (1). SWS occurs in male and female newborns, in 1/20,000 to 1/50,000 live births (2). Patients with SWS frequently develop migraines, seizures, stroke-like episodes, hemiparesis, visual problems and mental retardation (3). Furthermore, the majority of treatments for the neurological complications associated with SWS are symptomatic instead of radical. The etiology of SWS remains unclear; however, evidence from whole-genome sequencing suggests that somatic mutations in the G protein subunit αq (GNAQ) and RAS p21 protein activator 1 (RASA1) genes are causative factors of SWS and non-syndromic port-wine stains (4). Familial SWS is a rare genetic disorder that is dominantly inherited, which could affect family members with similar congenital deformities. To the best of our knowledge, the genetic factors predisposing to familial SWS have previously been unknown; however, systematic analysis of the genetic and molecular mechanisms underlying familial SWS is warranted.

Case report

In the present study, a 4-generation family with a history of SWS was analyzed and demonstrated dominant inheritance of SWS (Fig. 1). SWS was diagnosed in 3 of the family members (II-1, III-11 and IV-6). The patients' clinicopathological characteristics are illustrated in Table I. The present study was reviewed and approved by the Ethics Committees of Peking University Shenzhen Hospital (Shenzhen, China) and informed consent was obtained from all patients. To systematically screen for candidate mutations associated with SWS, the full range of exons from the GNAQ and RASA1 genes of all family members were sequenced using Sanger sequencing Thermo Fisher Scientific, Inc. (Waltham, MA, USA). The primer sequences of exons from the GNAQ and RASA1 genes are presented in Tables II and III.
Figure 1.

A 4-generation family tree of familial Sturge-Weber syndrome. Black boxes represent the affected individuals. The arrow beside the black box indicates the proband.

Table I.

Clinicopathological characteristics of the 3 patients with SWS from the 4-generation family.

Family memberGenderAge, yearsPresence of SWSLocationSize, cm
I-1M74No
I-2F68No
I-3M73No
I-4F70No
II-1M52YesRight arm2
II-2F48No
III-1M51No
III-2F55No
III-3M39No
III-4F42No
III-5M36No
III-6F37No
III-7M36No
III-8F38No
III-9M37No
III-10F35No
III-11M37YesLeft arm2
III-12F38No
IV-1M24No
IV-2M12No
IV-3F10No
IV-4F  8No
IV-5M  8No
IV-6M  7YesRight face4

SWS, Sturge-Weber syndrome; M, male; F, female.

Table II.

Primer sequences for reverse transcription-polymerase chain reaction amplification of G protein subunit αq exons.

ExonForward primer sequence (5′-3′)Reverse primer sequence (5′-3′)Size, bp
  1AGACTATCCGCTCCCACCGCGCCTCTGGTCGGAGTGATCTGC694
  2CATAGGTAGTGTTTCCAATTCTAGAATGATACTTACAAACTCTCTCCTTA660
  3AAGGAAGGTGTTACCTGAATTGTATTAGATTTATGAGGTTGGCATAAG420
  4ATGTAATCCATAGATGGATAACCTTTTGTTTTGAAGCCTACACATGATT430
  5GTATTAATTGAATTGACTTGGATGATCAGAACCTCTGCATAGTGTTA514
  6ATGACAGTGTTCCAGATTCACAACACACTGGGGTTTGGAGACAAAAC530
  7TTCATGAGCAATGACACAGTATTTGACGGCAATAAATTAGTATTATGC398
Table III.

Primer sequences for reverse transcription-polymerase chain reaction amplification of RAS p21 protein activator 1 exons.

ExonForward primer sequence (5′-3′)Reverse primer sequence (5′-3′)Size, bp
  1GAGTAGAGCGGGCTTCAACATGAGGAGCCAGCTTCCCAAATTCCTGA600
  2GGCATTTAAAACCTCTAGTAGTATTAAATATATTTGAGGATCAGCACAG480
  3TAGCCCCAAGTAATTTACTGTGATATTTCAGAATCTTGCAGCAAAGTC630
  4GGCACTGGGTATTTATAGTCCAAGGTGAGAGACAGTGGAATAAAACC475
  5ACTCTAATTCCTTACATTTTTCAATTTATAATATGCTAGCCTGATTATGT420
  6TTAAGAGAGGTTTGGAAAGATATTGAGTAAGAGAGAATTGGGATTAAT690
  7AGACCTATAACAGTCTGTTATTATCTCACCTAGTGTTACTTCTGAG590
  8AAGCTGGTAAGATACACCAGAGAGACACTGTCTAAAGAATTCTTGGG539
  9CTTGATGGGTATGGAAAATCAGAAAGGTTGTTCCTGATTACCTAAAATC520
10CTTTGGAAAGCAAAAGATCATTTAATGCTTATATATGGGCTCTAAACAA410
11AGGCATTTTTGTACAGATTTGTTATAAGTGCATCTGCTACTTTTAGAAG449
12ACTGATAACATTTTAATAGTGCTGAGGTCAATTTAAAATGGAGTTTTC527
13TGAGAATAGAAATGGCAGTCTAGTTTCATAAAGAAGTAACGTTTTCCT360
14ATGTCTGAATGTTTTAAGTATGTCGCTATTAGAACACCTGGATATGGTA460
15GAGGTTAAAGATGGTAGGAAAAGTAACAGTGTGTACAGTTGAACCAT500
16CTCTCTACCTATCAGAGTTTAGTGGTGCTACTAAGCTATGAATTACTAT480
17AATGATGCCAGAGATTTTAAACCTTTGTGGCTTCTAGTACTTATCTGC600
18CATTGTAATTAGTACTTTCAACGCAATTTCTGGTGCAACTTGATGG518
19GGCTAATTGGGAATAAATGGTAACACCATGACTTTTTCAGAGTATAATA450
20ATAAAGTTTTCCTTACCCCTTGCTGCCTCATCTTGTAAGGGTTTAA519
21GGTTTAGAGTGAATTTTATGGGTTGGTTTGAGACACAAATAGGGGTA462
22ACATTCTGAGTTCCGAATGGAAGCTTTCATCGCTAAAAATTTCACTGC335
23TGTGTTGCTGCTGCTACACCTAATAAGGCAGACAAAAATTTGCAGGC400
24ATGTGAATACAAAGGTTACAAAGTCAGACTCAAGAGCAAAACCTGAT744
25GAATTGTGGTAATATTTTATGCATCCAGATAGCTTACAAGGTTGCTG395
To identify the candidate mutation, all the genetic variants common to the three patients with SWS were compared with the control data from family member IV-5 (Fig. 2). A total of 8 case-specific genetic variants that coexisted in the 3 patients were identified. The case-specific variants were subsequently compared with genetic polymorphism datasets from the Single Nucleotide Polymorphism database [National Center for Biotechnology Information (NCBI); http://www.ncbi.nlm.nih.gov/projects/SNP/] and the 1000 Genome Project database (http://www.1000genomes.org/). Following these two comparative steps, a novel candidate mutation, potentially associated with familial SWS, was identified.
Figure 2.

A missense mutation in the G protein subunit αq gene identified in patients with familial SWS. Trace chromatograms were developed using Sanger sequencing and revealed a validated missense mutation (p.R183Q). The three upper panels illustrate the sequencing chromatograms of the patients with familial, SWS II-1, III-11 and IV-6, while the lower panel illustrates the sequencing chromatogram of the control group, IV-5. SWS, Sturge-Weber syndrome.

According to the NCBI (http://www.ncbi.nlm.nih.gov/), the human GNAQ gene is located on chromosome 9q21, and contains 7 exons and 8 introns, encoding guanine nucleotide-binding protein (G protein), q polypeptide (Gαq). As illustrated in Fig. 2, one non-synonymous single-nucleotide variation (nsSNV) was present exclusively in the 3 patients with SWS. The variation was predicted to be located on the fourth exon of GNAQ and resulted in the substitution of amino acid p.Arg183Gln (p.R183Q). Evolutionary conservation analysis was performed using MegAlign software version 5 (DNASTAR®, Inc., Madison, WI, USA). Multiple protein alignments revealed that the Arg183 residue on the GNAQ gene is highly conserved across several vertebrate species (Fig. 3), which indicates that the p.R183Q mutation is likely to disrupt the normal functions of Gαq. In addition, the functional significance of the SWS-associated mutation was predicted using several complementary nsSNV scoring algorithms, including SIFT (5), PolyPhen2 (6), PhastCons (7) and GERP scores (8). As hypothesized, the p.R183Q mutation results in a change to the function of the encoded protein Gαq.
Figure 3.

Evolutionary conservation analysis of amino acids affected by the missense mutation. The identification numbers of guanine nucleotide-binding protein (G protein), q polypeptide were as follows: Human (NP_0,02063.2), Chimpanzee (XP_0,033,12167.1), Rhesus (XP_0,011,00833.1), Bovine (NP_0,011,03472.1), Rat (NP_112,298.1) and Mouse (NP_03,2165.3). The mutant alleles are boxed, and the asterisk (*) shows the conserved residue.

To detect the sub-cellular localization of Gαq, the mutant (R183Q) and wild-type (WT) genotypes of the human GNAQ gene were overexpressed in 293T cells. The cells were obtained from the American Type Culture Collection (Manassas, VA, USA). The coding sequence of human GNAQ (WT) was amplified using reverse transcription-polymerase chain reaction (RT-PCR) analysis with the following primers: Forward, 5′-CCGGAATTCTATGACTCTGGAGTCCATCATGGCGT-3 and reverse,5′-CGCGGATCCACGCCATGATGGACTCCAGAGTCAT-3′. Reverse transcription was performed using a PrimeScript™ Reverse Transcription Reagent kit (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's protocol. The thermocycling conditions were as follows: 37°C for 60 min; 95°C for 5 min; and then held at 4°C. PCR was performed using the Takara EmeraldAmp PCR Master mix (Takara Biotechnology Co., Ltd.). The PCR thermocycling conditions were as follows: 98°C for 2 min, 98°C for 20 sec, 60°C for 30 sec and 72°C for 2 min for 36 cycles, with a final step at 72°C for 5 min. Subsequently, the PCR products were double-digested at 37°C for 60 min using the restriction endonucleases EcoRI and BamHI (Takara Bio, Inc., Otsu, Japan), and the digested products were sub-cloned into the plasmid enhanced green fluorescent protein (EGFP)-C1 vector (Thermo Fisher Scientific, Inc.) to produce a pEGFP-C1-GNAQ fusion protein-expressing vector. The coding sequence of EGFP-GNAQ was confirmed through DNA sequencing by Thermo Fisher Scientific, Inc. The GNAQ mutant was synthesized by Thermo Fisher Scientific, Inc. The nuclei of 293T cells were labeled using Hoechst 33258 and normal 293T cells transfected with the empty vector (pEGFP-C1) were used as controls. Immunofluorescence analysis was performed as described previously (9). The data showed that the GNAQ (WT) recombinant protein was predominantly detected in the cytoplasm, whereas the GNAQ (R183Q) was mainly detected in the nuclei of the 293T cells (Fig. 4). This result suggests that the change of subcellular localization contributes to the generation of a loss-of-function Gαq protein. The results of the present study demonstrated that the mutation p.R183Q may be a risk factor that contributes to the pathogenesis of familial SWS.
Figure 4.

Immunolocalization analysis of GNAQ (WT) and GNAQ (R183Q) in transfected 293T cells. Green represents the anti-GNAQ staining, nuclei were stained with Hoechst 33,258. Cells were transfected with plasmid DNA (pEGFP-C1 vector) encoding the GNAQ (WT) or GNAQ (R183Q). Normal 293T cells transfected with the empty vector (pEGFP-C1) served as controls. Cells transfected with GNAQ (WT) illustrated GNAQ recombinant protein expression predominantly in the cytoplasm, whereas expression of the GNAQ recombinant protein from the GNAQ (R183Q) transfected cells was mainly detected as patches distributed across the entire nucleus. Scale bar, 10 µm. GNAQ, G protein subunit αq; WT, wild-type; R183Q, p.Arg183Gln; EGFP, enhanced green fluorescent protein; NC, normal control.

Discussion

Gαq is a member of the q class of G-protein α subunits that mediates signals between G protein-coupled receptors (GPCRs) and downstream effectors. GPCRs are involved in RAS-associated signaling pathways. Gαq Arg183 is conserved in the GTP-binding pocket of all human Gα subunits, which serves an essential role in the hydrolysis of GTP. Results from previous studies have demonstrated that substituting Arg183 with a cysteine residue reduces the intrinsic GTPase activity and increases the signaling activity (10–12). The p.R183Q mutation identified in the present study is located in the GTP-binding domain of GNAQ. Therefore, it was hypothesized that the substitution of arginine with glutamine affects the functions of Gαq by changing its subcellular localization. Previous studies have established that activating mutations in genes that encode Gα subunits are associated with various diseases, including McCune-Albright syndrome, which exhibits characteristic skeletal abnormalities and abnormal skin pigmentation (13). Activating GNAQ mutations have been found in patients with blue nevi and nevi of Ota (14). In addition, GNAQ mutations were previously identified in a chemical mutagenesis screen for a dark-skin phenotype in laboratory mice (15). An activating GNAQ mutation may have oncogenic functions (16). The results of several studies revealed that mutations in the Q209 and R183 residues of the GNAQ gene, including the Q209L substitution located in the Ras-like domain, are likely to exhibit involvement in the process of tumorigenesis via the upregulation of the mitogen-activated protein kinase pathway (16). R183 is located in the GTP-binding pocket of the Gα subunit and has an important role in GTP hydrolysis; however, a markedly lower potential to activate signal transmission was found for the R183 mutant compared with the Q209 mutant (17,18). In the current study, the R183Q mutation of the GNAQ gene was identified as a potential cause for familial SWS through the sequencing of all of the exons of the GNAQ and RASA1 genes in 3 patients with familial SWS. The functional study confirmed that the genetic mutation R183Q affected the functions of the encoded protein, Gαq. To the best of our knowledge, this is the first genetic mutation to be associated with the pathogenesis of familial SWS. The results of the present study, in addition to data from previous studies, suggest that an imbalance in the hydrolysis of GTP is the common cause of certain congenital neurocutaneous disorders, such as SWS. These findings may aid in the development of novel diagnostic markers and/or therapeutic targets for the treatment of patients with familial SWS.
  18 in total

1.  Pasteurella multocida toxin activation of heterotrimeric G proteins by deamidation.

Authors:  Joachim H C Orth; Inga Preuss; Ines Fester; Andreas Schlosser; Brenda A Wilson; Klaus Aktories
Journal:  Proc Natl Acad Sci U S A       Date:  2009-04-15       Impact factor: 11.205

2.  Sturge-Weber syndrome and port-wine stains caused by somatic mutation in GNAQ.

Authors:  Matthew D Shirley; Hao Tang; Carol J Gallione; Joseph D Baugher; Laurence P Frelin; Bernard Cohen; Paula E North; Douglas A Marchuk; Anne M Comi; Jonathan Pevsner
Journal:  N Engl J Med       Date:  2013-05-08       Impact factor: 91.245

3.  Single-nucleotide evolutionary constraint scores highlight disease-causing mutations.

Authors:  Gregory M Cooper; David L Goode; Sarah B Ng; Arend Sidow; Michael J Bamshad; Jay Shendure; Deborah A Nickerson
Journal:  Nat Methods       Date:  2010-04       Impact factor: 28.547

4.  The somatic GNAQ mutation c.548G>A (p.R183Q) is consistently found in Sturge-Weber syndrome.

Authors:  Mitsuko Nakashima; Masakazu Miyajima; Hidenori Sugano; Yasushi Iimura; Mitsuhiro Kato; Yoshinori Tsurusaki; Noriko Miyake; Hirotomo Saitsu; Hajime Arai; Naomichi Matsumoto
Journal:  J Hum Genet       Date:  2014-11-06       Impact factor: 3.172

5.  Effects of G-protein mutations on skin color.

Authors:  Catherine D Van Raamsdonk; Karen R Fitch; Helmut Fuchs; Martin Hrabé de Angelis; Gregory S Barsh
Journal:  Nat Genet       Date:  2004-08-22       Impact factor: 38.330

6.  A method and server for predicting damaging missense mutations.

Authors:  Ivan A Adzhubei; Steffen Schmidt; Leonid Peshkin; Vasily E Ramensky; Anna Gerasimova; Peer Bork; Alexey S Kondrashov; Shamil R Sunyaev
Journal:  Nat Methods       Date:  2010-04       Impact factor: 28.547

7.  Activating mutations of the stimulatory G protein in the McCune-Albright syndrome.

Authors:  L S Weinstein; A Shenker; P V Gejman; M J Merino; E Friedman; A M Spiegel
Journal:  N Engl J Med       Date:  1991-12-12       Impact factor: 91.245

8.  Recombinant Gq alpha. Mutational activation and coupling to receptors and phospholipase C.

Authors:  B R Conklin; O Chabre; Y H Wong; A D Federman; H R Bourne
Journal:  J Biol Chem       Date:  1992-01-05       Impact factor: 5.157

Review 9.  Update on Sturge-Weber syndrome: diagnosis, treatment, quantitative measures, and controversies.

Authors:  Anne M Comi
Journal:  Lymphat Res Biol       Date:  2007       Impact factor: 2.589

10.  Structures of active conformations of Gi alpha 1 and the mechanism of GTP hydrolysis.

Authors:  D E Coleman; A M Berghuis; E Lee; M E Linder; A G Gilman; S R Sprang
Journal:  Science       Date:  1994-09-02       Impact factor: 47.728

View more
  2 in total

1.  Progressive retinal vessel malformation in a premature infant with Sturge-Weber syndrome: a case report and a literature review of ocular manifestations in Sturge-Weber syndrome.

Authors:  Zhengping Hu; Jian Cao; Eun Young Choi; Yun Li
Journal:  BMC Ophthalmol       Date:  2021-01-22       Impact factor: 2.209

2.  Genetic syndromes with vascular malformations - update on molecular background and diagnostics.

Authors:  Adam Ustaszewski; Joanna Janowska-Głowacka; Katarzyna Wołyńska; Anna Pietrzak; Magdalena Badura-Stronka
Journal:  Arch Med Sci       Date:  2020-02-25       Impact factor: 3.318

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.