| Literature DB >> 28439126 |
Esteban Rodriguez Herrero1, Nico Boon2, Martine Pauwels1, Kristel Bernaerts3, Vera Slomka1, Marc Quirynen1,4, Wim Teughels5,6.
Abstract
The oral use of antimicrobial agents embedded in toothpastes and mouth rinses results in an oral microbial massacre with high amounts of dead bacteria in close proximity to few surviving bacteria. It was hypothesized that this provides the surviving pathogenic bacteria a large amount of dead microbial biomass as a nutritional source for growth (necrotrophy). This study demonstrated the necrotrophic growth of periodontal pathogens in the presence of different dead oral species. In addition, the presence of dead bacteria resulted in an outgrowth of several periodontal pathogens in complex multi-species biofilms. Additionally, upon contact with dead oral bacteria, virulence genes of P. intermedia and P. gingivalis were up-regulated (necrovirulence). This resulted in a more pronounced epithelial cytotoxicity (necrotoxicity). These findings indicate that presence of dead bacteria induce necrotrophy, necrovirulence and necrotoxicity in several oral pathogens.Entities:
Mesh:
Substances:
Year: 2017 PMID: 28439126 PMCID: PMC5430626 DOI: 10.1038/s41598-017-01239-9
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.379
Effect of dead bacteria on bacterial growth of periodontal pathogens.
| Living Bacteria | Dead bacteria | Final Log10 (CFU/mL) |
|---|---|---|
|
| 109
| 9.48 ± 0.03* |
| 108
| 8.68 ± 0.04* | |
| 107
| 8.13 ± 0.07* | |
| Control (without dead | 8.02 ± 0.03* | |
| 109
| 9.84 ± 0.18* | |
| 108
| 9.48 ± 0.13* | |
| 107
| 9.22 ± 0.01* | |
| Control (without dead | 8.90 ± 0.04* | |
| 109
| 9.37 ± 0.02* | |
| 108
| 9.28 ± 0.09* | |
| 107
| 9.24 ± 0.07* | |
| Control (without dead | 9.13 ± 0.09* | |
| 109
| 9.46 ± 0.04* | |
| 108
| 9.43 ± 0.02* | |
| 107
| 9.37 ± 0.01* | |
| Control (without dead | 9.34 ± 0.02* | |
| 109
| 9.43 ± 0.05* | |
| 108
| 9.36 ± 0.04* | |
| 107
| 9.35 ± 0.06* | |
| Control (without dead | 9.32 ± 0.04* | |
| 109
| 6.42 ± 0.10* | |
| Control 1 in 10 BHI (without dead | 4.65 ± 0.62* | |
|
| 109
| 9.10 ± 0.08* |
| 108
| 9.06 ± 0.10* | |
| 107
| 8.94 ± 0.05* | |
| Control (without dead | 8.78 ± 0.04* | |
|
| 109
| 8.59 ± 0.03* |
| 108
| 8.48 ± 0.06* | |
| 107
| 8.45 ± 0.08* | |
| Control (without dead | 8.38 ± 0.06* |
Data represent the final cell concentration of living periodontal pathogens (Log10 CFU/mL)after 24 anaerobic incubation starting from 7.7 Log10 CFU/mL and in presence of different concentrations of dead bacteria (mean ± standard deviation, n = 3). Control contains only living bacteria without addition of dead bacteria. *Statistically significant difference of periodontal pathogens concentration in presence of dead bacteria respect to the control (p < 0.05).
Necrotrophic activity of P. intermedia and DNA concentrations of dead P. gingivalis and dead S. oralis (Log (MO/mL) analyzed by qPCR (mean ± standard deviation, n = 3).
| A | |||
|---|---|---|---|
| Living Bacteria | Dead bacteria | Log (CFU/mL) (Vitality qPCR) | Log (CFU/mL) (Standard qPCR) |
|
| 109
| 10.43 ± 0.04* | 10.76 ± 0.07* |
| 108
| 10.10 ± 0.10* | 10.65 ± 0.03* | |
| 107
| 9.63 ± 0.20 | 9.72 ± 0.13 | |
| Control | 9.36 ± 0.06 | 9.47 ± 0.10 | |
|
| 109
| 10.20 ± 0.09* | 10.20 ± 0.11* |
| 108
| 9.78 ± 0.08 | 10.12 ± 0.08* | |
| 107
| 9.71 ± 0.08 | 9.73 ± 0.11 | |
| Control | 9.88 ± 0.05 | 9.68 ± 0.04 | |
|
| |||
|
|
|
|
|
|
| 109
| 8.29 ± 0.06 | 7.89 ± 0.11# |
| 108
| 7.26 ± 0.14 | 6.48 ± 0.24# | |
| 107
| 6.27 ± 0.07 | 5.89 ± 0.04# | |
| Control (without | 109
| 8.31 ± 0.06 | 8.15 ± 0.13* |
|
| 109
| 7.32 ± 0.22 | 5.87 ± 0.18# |
| 108
| 6.92 ± 0.03 | 6.37 ± 0.35* | |
| 107
| 5.66 ± 0.33 | 3.67 ± 0.19* | |
| Control (without | 109
| 7.73 ± 0.44 | 7.55 ± 0.50* |
(A) Necrotrophic activity of P. intermedia in presence of dead P. gingivalis and dead S. oralis analyzed by standard and vitality qPCR. Control contains only living P. intermedia. *Designates a statistically significant outgrowth of P. intermedia respect to control (p < 0.05). (B) Initial and final concentrations of DNA from dead P. gingivalis and dead S. oralis during the necrotrophic activity of P. intermedia analyzed by standard qPCR. Control contains only DNA of dead bacteria. #Designates a statistically significant decrease of DNA from dead bacteria respect to control (p < 0.05).
Vitality qPCR (Log (MO/mL) of the different species (mean ± standard deviation, n = 3) in the 14 species community in presence of living and dead bacteria in BHI-2 after 24 hours incubation.
| Planktonic | Biofilm | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| BHI-2 | +dead Pi | +Living Pi | +dead Pg | +Living Pg | BHI-2 | +dead Pi | +Living Pi | +dead Pg | +Living Pg | |
|
| 7.27 ± 0.11 | 7.93 ± 0.10* | 6.54 ± 0.07# | 7.69 ± 0.05* | 7.32 ± 0.08 | 6.88 ± 0.03 | 7.56 ± 0.10* | 6.11 ± 0.11# | 6.40 ± 0.11# | 6.99 ± 0.15 |
|
| 7.15 ± 0.14 | 7.70 ± 0.11* | 7.56 ± 0.07* | 8.75 ± 0.06* | 6.89 ± 0.04 | 8.16 ± 0.03 | 8.97 ± 0.19* | 8.65 ± 0.04* | 8.72 ± 0.06* | 7.64 ± 0.07# |
|
| 8.05 ± 0.09 | 8.15 ± 0.09 | 7.98 ± 0.05 | 8.83 ± 0.10* | 10.56 ± 0.03* | 7.81 ± 0.03 | 8.08 ± 0.11* | 8.05 ± 0.05* | 8.41 ± 0.06* | 9.75 ± 0.13* |
|
| 8.08 ± 0.05 | 9.26 ± 0.17* | 8.89 ± 0.08* | 10.08 ± 0.30* | 9.08 ± 0.01* | 8.93 ± 0.12 | 10.19 ± 0.13* | 9.82 ± 0.18* | 9.89 ± 0.11* | 9.56 ± 0.14* |
|
| 4.58 ± 0.09 | 3.28 ± 0.17# | 4.98 ± 0.17 | 4.87 ± 0.15 | 4.52 ± 0.36 | 6.77 ± 0.05 | 3.94 ± 0.37# | 5.95 ± 0.03# | 6.82 ± 0.11 | 6.86 ± 0.16 |
|
| 6.37 ± 0.15 | 2.95 ± 0.12# | 5.75 ± 0.11# | 6.27 ± 0.18 | 6.63 ± 0.17* | 7.77 ± 0.07 | 4.85 ± 0.49# | 7.00 ± 0.01# | 7.67 ± 0.06 | 7.54 ± 0.12 |
|
| 7.01 ± 0.22 | 5.78 ± 0.12# | 7.08 ± 0.21 | 7.27 ± 0.18* | 6.09 ± 0.17# | 8.09 ± 0.04 | 6.22 ± 0.30# | 8.21 ± 0.10 | 7.78 ± 0.07# | 7.82 ± 0.14 |
|
| 6.06 ± 0.15 | 5.66 ± 0.20# | 6.07 ± 0.08 | 6.40 ± 0.11* | 4.95 ± 0.21# | 6.65 ± 0.03 | 6.94 ± 0.16 | 7.10 ± 0.13* | 6.39 ± 0.08# | 6.90 ± 0.25 |
|
| 7.78 ± 0.13 | 4.41 ± 0.15# | 6.39 ± 0.05# | 7.84 ± 0.05 | 6.47 ± 0.10# | 8.21 ± 0.02 | 6.55 ± 0.37# | 7.37 ± 0.07# | 7.67 ± 0.07# | 8.64 ± 0.14 |
|
| 9.39 ± 0.16 | 8.67 ± 0.12# | 7.28 ± 0.19# | 9.44 ± 0.18 | 8.65 ± 0.06# | 10.38 ± 0.05 | 9.17 ± 0.28# | 9.43 ± 0.08# | 10.06 ± 0.12# | 10.33 ± 0.17 |
|
| 7.78 ± 0.07 | 3.93 ± 0.16# | 5.61 ± 0.15# | 7.35 ± 0.23 | 8.03 ± 0.05* | 7.99 ± 0.01 | 5.60 ± 0.29# | 6.58 ± 0.02# | 7.64 ± 0.05# | 8.25 ± 0.18 |
|
| 5.98 ± 0.12 | 5.47 ± 0.20# | 4.61 ± 0.20# | 6.34 ± 0.23* | 6.00 ± 0.19 | 7.39 ± 0.05 | 6.66 ± 0.35 | 6.02 ± 0.07# | 6.76 ± 0.08# | 6.90 ± 0.21 |
|
| 8.01 ± 0.07 | 8.65 ± 0.15* | 8.51 ± 0.06* | 8.26 ± 0.06* | 9.01 ± 0.07* | 10.33 ± 0.06 | 10.60 ± 0.08* | 10.06 ± 0.10# | 10.45 ± 0.07 | 10.16 ± 0.14 |
|
| 5.99 ± 0.15 | 2.80 ± 0.27# | 4.81 ± 0.16# | 6.16 ± 0.10* | 5.19 ± 0.14# | 6.77 ± 0.27 | 4.05 ± 0.21# | 5.11 ± 0.06# | 6.25 ± 0.03# | 6.64 ± 0.08 |
BHI-2 condition refers to a 14 species community without the addition of dead bacteria. *Designates a statistically significant increase of the bacterial concentration with respect to BHI (p < 0.05). #Designates a statistically significant decrease of the bacterial concentration in respect to BHI (p < 0.05).
Figure 1Expression of virulence genes from P. intermedia and P. gingivalis in presence of dead oral bacteria. (A) Relative fold change of virulence genes from P. intermedia after exposure to dead P. gingivalis. (B) Relative fold change of virulence genes from P. gingivalis after exposure to dead P. intermedia. *Designates a statistically significant up-regulation of virulence genes respect to house-keeping genes (p < 0.05).
Figure 2Percentages of cell viability after exposure to dead and living bacteria. (A) Percentages of cell viability in presence of living P. intermedia, dead P. gingivalis, living P. gingivalis and the combination living P. intermedia plus dead P. gingivalis. (B) Percentages of cell viability exposed to living P. gingivalis, dead P. intermedia, living P. intermedia and the combination living P. gingivalis plus dead P. intermedia. Control contains only cells without bacteria. *Designates a statistically significant decrease in cell viability respect to control (p < 0.05). #Designates a statistically significant decrease of cell viability respect to all conditions (p < 0.05).
Primers of virulence and house-keeping genes from P. gingivalis (Pg) and P. intermedia (Pi).
| Genes | Sequence | Length |
|---|---|---|
| 16 S rRNA (Pi) house-keeping | F: CGGTCTGTTAAGCGTGTTGTG R: CACCATGAATTCCGCATACG | 99 pb[ |
| Hemagglutinin gene | F: TTGCAAGTATTGGTTCGGC R: TCAGGCTGTAAGCGTAGACG | 438 pb gb|AF017417.1|:154-1083 GenBank: AF017417.1 protein_id = “AAB70257.1” |
| Heat shock protein 90 | F: TGAACGTAAGCCGCAGTTAC R: TTGTTCTTGGCGCAAAGCAG | 860 pb gi|965694490:724387-726444 GenBank: AP014598.1 protein_id = “BAU19169.1” |
| Chaperone | F: ACGGTGTTGAGGTTGTTGGT R: CTCCGCTGACACTCGGTATC | 598 pb gi|965692493:1150302-1152203 GenBank: AP014597.1 protein_id = “BAU17563.1” |
| Chaperone | F: CGAACATTGTCACGGAACAG R: GCAGGAAGTCCTTTGCCTCT | 519 pb gi|965692493:412565-413722 GenBank: AP014597.1 protein_id = “BAU16891.1” |
| Chaperone | F: TGAAGATTTGCGCTGTCAAG R: TAGCTGGAGTTTCTTCAGGT | 780 pb gi|965692493:260345-261970 GenBank: AP014597.1 protein_id = “BAU16749.1” |
| Chaperone | F: AGCGGAGCAGAAAGTAGGTG R: CAACAGCAAGAACGTCGCTT | 215 pb gi|965692493:259953-260222 GenBank: AP014597.1 protein_id = “BAU16748.1” |
| Chaperone | F: CGCTCCATACGAAGCTTTGC R: ATTATCCGTGGCGACGTACC | 548 pb gi|965692493:10024-12612 GenBank: AP014597.1 protein_id = “BAU16518.1” |
| Polysialic acid transport | F: CGGCAGCTTTAAGTTGTGCC R: GGGTATGACCGATACGCAGG | 422 pb gi|877799833:1064644-1065294 GenBank: AP014925.1 protein_id = “BAR95643.1” |
| RNA polymerase ECF-type sigma factor | F: ATGGAAGCCTCGCAATTCAA R: TCCGTAAGTCCTGTTTCGGC | 428 pb gi|965692493:1634435-1634935 GenBank: AP014597.1 protein_id = “BAU17984.1” |
| Interpain A | F: GAAGGACAACTACAGCGGAAA R: TCCTTTCGTTAGTTCGCTGA | 250 pb[ |
| Invasin | F: CTGTGTTCTTCAGTTGCACGC R: TATTGCGCCCGCCTTCACCTC | 900 pb[ |
| 16 S rRNA (Pg) house-keeping | F: GCGCTCAACGTTCAGCC R: CACGAATTCCGCCTGC | 68 pb[ |
| Collagenase | F: TTCTTTGTAGCAGCGGCAGA R: CGTATGCCAACGAGATCGGA | 506 pb gi|333802964:798156-799409GenBank: AP012203.1 protein_id = “BAK24920.1” |
| Arginine-specific cysteine proteinase | F: CACAACCTTGGCTTCGTTGG R: CAATGGCGCCAAACCTCAAA | 508 pb gi|333802964:315477-320528 GenBank: AP012203.1 protein_id = “BAK24470.1” |
| Arginine-specific cysteine proteinase | F: GGAGGAATCTCGTTGGCCAA R: TGCCGACCATATCACCATCG | 571 pb gi|333802964:1685747-1687957 GenBank: AP012203.1 protein_id = “BAK25772.1” |
| Lysine specific cysteine protease | F: TGGCTTTGGTTGGTGACACT R: AGCCCCTTTCTCCTTAACGC | 581 pb gb|AF017059.1|:738-5936 GenBank: AF017059.1 protein_id = “AAC26523.1” |
| FimA type II fimbrilin | F: TTGCAGGGGTATAAGCACCG R: TTGGAGTTGGCGATGACGAA | 567 pb gi|333802964:1331121-1332290 GenBank: AP012203.1 protein_id = “BAK25445.1” |