Literature DB >> 28438192

Chryseobacterium gleum in a man with prostatectomy in Senegal: a case report and review of the literature.

O Arouna1, F Deluca2, M Camara3, B Fall5, B Fall5, A Ba Diallo3, J D Docquier2, S Mboup3.   

Abstract

BACKGROUND: Here we report a rare case of a urinary tract infection due to Chryseobacterium gleum. This widely distributed Gram-negative bacillus is an uncommon human pathogen and is typically associated with health care settings. CASE
PRESENTATION: We describe a case of urinary tract infection caused by Chryseobacterium gleum in a 68-year-old man of Wolof ethnicity (an ethnic group in Senegal, West Africa) who presented to our Department of Urology in a university teaching hospital (Hôpital Aristide Le Dantec) in Dakar, Senegal, 1 month after prostatectomy. The strain isolated from a urine sample was identified as Chryseobacterium gleum by mass spectrometry (Vitek matrix-assisted laser desorption/ionization, time-of-flight, bioMérieux) and confirmed by 16S ribosomal ribonucleic acid sequencing. The organism was resistant to a wide range of antibiotics, including carbapenem, due to a resident metallo-β-lactamase gene that shared 99% of amino-acid identity with Chryseobacterium gleum class B enzym.
CONCLUSIONS: Infection by Chryseobacterium gleum is infrequent, and no such case has been previously reported in Africa. Despite its low virulence, Chryseobacterium gleum should be considered a potential opportunistic and emerging pathogen. Further studies on the epidemiology, pathogenicity, and resistance mechanisms of Chryseobacterium gleum are needed for better diagnosis and management.

Entities:  

Keywords:  CGB-1; Chryseobacterium gleum case report; Metallo-β-lactamase; Urinary tract infection; resistance

Mesh:

Substances:

Year:  2017        PMID: 28438192      PMCID: PMC5402668          DOI: 10.1186/s13256-017-1269-4

Source DB:  PubMed          Journal:  J Med Case Rep        ISSN: 1752-1947


Background

The genus Chryseobacterium (formerly Flavobacterium) [1], whose type species is Chryseobacterium gleum [2] and belongs to the family Flavobacteriaceae (phylum Bacteroidetes), represents a group of Gram-negative, non-fermenting, catalase-positive, and indole-positive aerobic bacilli. Chryseobacterium species are uncommon human pathogens, and most cases are nosocomial and are often associated with immunosuppression or indwelling devices. Chryseobacterium is typically found in soil, water, plants, and food products and can survive in hospital environments, chlorinated water, and wet surfaces, all of which serve as potential reservoirs of infection. A literature search revealed only a few published cases in countries including Hungary, India, Croatia, and Saudi Arabia [3-6]. In Senegal, two cases of meningitis due to Flavobacterium meningosepticum were diagnosed in the late 1970s [7] as well as one case of Chryseobacterium indologenes [8]. However, human C. gleum infection has not been previously reported in Africa. Here, we report the first case of C. gleum infection occurring in Africa and provide a review of similar cases worldwide (Table 1).
Table 1

Case reports of infection by Chryseobacterium gleum

AuthorCountrySexa/bAgeSiteOutcomeFactorsAntibiotic treatment
Virok et al. (2014) [3]HungaryNewbornsStomach contentCuredRespiratory tract involvementCiprofloxacin
Garg et al. (2015) [18]IndiaM/48UrineCuredPyonephrosisTetracycline
Dijana et al. (2015) [5]CroatiaF/35Blood/Tracheal aspirateCuredHepatic lesion/malnutritionPiperacillin/Tazobactam
Ramya et al. (2015) [4]IndiaM/62UrineCuredRenal calculi/HydronephrosisPiperacillin/Tazobactam
Baha et al. (2016) [6]Saudi ArabiaNewbornEndotracheal aspirateCuredNephrotic syndromeLevofloxacin
Our case (2016)SenegalM/68UrineCuredProstatectomyCiprofloxacin

a M male, F female

b Y year

Case reports of infection by Chryseobacterium gleum a M male, F female b Y year

Case presentation

A 68-year-old man of Wolof ethnicity (an ethnic group in Senegal, West Africa) presented to our Department of Urology with severe dehydration and general deterioration of condition 1 month after prostatectomy via transurethral resection performed at a regional hospital. At hospital admittance, a clinical examination found a high blood pressure (180/90 mmHg) and a fever of 38.5 °C. Blood tests found leukocytosis with a level of 17,100/mL white blood cells (WBC), anemia with a level of 10 g/dL, and creatinine with a level of 513.3 μmol/L. Serum electrolytes showed hyponatremia with a level of 111 mEq/L, hypokalemia with a level of 3.3 mEq/L, and hypochloremia with a level of 77 mEq/L. At presentation, he had an indwelling urinary catheter draining urine incorrectly that required a urine bacteriology examination. Treatment consisted of fluid and electrolyte replacement, daily dressing of the wound, and empiric antibiotic therapy with amikacin. This drug was chosen because of the severity of the infection and because our patient had previously received treatment with fluoroquinolone. Seven days after hospitalization, the outcome was favorable with a clean surgical wound and normalization of serum potassium and chloride levels. However, hyponatremia persisted at 119 mEq/L, and his serum creatinine level was 150.45 μmol/L. Removal of the urinary catheter was performed on day 7 of hospitalization, and he returned home the same day. The cloudy urine collected for bacteriology examination at hospitalization was inoculated on a cysteine lactose electrolyte deficient (CLED) agar plate according to the usual techniques for medical bacteriology. Direct examination showed a rich bacterial flora, many white cells, and Gram-negative bacilli by Gram staining. The CLED agar grew yellow-colored 1 to 2 mm circular colonies (>106 CFU/mL) with regular margins. After culture, Chryseobacterium species was suspected because of the yellow-colored colonies due to flexirubin production. Identification using the Appareil et Procédés d’Identification 20 NE identification system (bioMérieux, France) gave Myroides species and C. indologenes after, respectively, 24 hours and 48 hours of incubation (Table 2).
Table 2

Identification of the strain using Appareil et Procédés d’Identification 20 NE (V7.0)

%IDT
24 H48H24H48H
Significant taxa
Myroides species61.20.67
Chryseobacterium indologenes 34.299.90.840.42
Next taxon
Bergeyella zoohelcum 4.40.5
Shewanella putrefaciens group0.10.0

24 H 24 hours of incubation, 48 H 48 hours of incubation, %ID identification percentage (proximity relative to the different taxa in the database. It is determined whether the observed profile is closer to a particular taxon), T typicality (the most typical profile is the one that has no tests against the identification compared with percentages in the database for that taxon)

Identification of the strain using Appareil et Procédés d’Identification 20 NE (V7.0) 24 H 24 hours of incubation, 48 H 48 hours of incubation, %ID identification percentage (proximity relative to the different taxa in the database. It is determined whether the observed profile is closer to a particular taxon), T typicality (the most typical profile is the one that has no tests against the identification compared with percentages in the database for that taxon) However, mass spectrometry (Vitek MS matrix-assisted laser desorption/ionization, time-of-flight, bioMérieux) successfully identified C. gleum and the result was confirmed using 16S ribosomal ribonucleic acid (rRNA) sequencing. In this case, C. gleum was confirmed as the causative agent for our patient’s urinary tract infection as evidenced from the culture reports. Confluent growth of the organism in pure form from urine helped to rule out contamination. Antimicrobial susceptibility testing using disc diffusion and E-tests (bioMérieux) for the minimum inhibitory concentration (MIC) using Pseudomonas aeruginosa ATCC 27853 and Escherichia coli ATCC 25922 for internal quality control was completed and interpreted per the Comité d’Antibiogramme de la Société Française de Microbiologie (CA-SFM) recommendations of 2015. The isolated strain was susceptible to piperacillin (MIC = 6 μg/mL), ceftazidime (MIC = 0.75 μg/mL), cefepime (MIC = 0.125 μg/mL), ciprofloxacin (MIC = 0.25 μg/mL), imipenem (MIC = 2 μg/mL), and resistant to meropenem (MIC = 8 μg/mL), aztreonam (MIC ≥256 μg/mL), ticarcillin (MIC ≥256 μg/mL), ticarcillin-clavulanic acid (MIC = 64 μg/mL), and cefotaxime (MIC >32 μg/mL; Table 3).
Table 3

In vitro antimicrobial susceptibilities of the strain, and interpretation according to Comité d’Antibiogramme de la Société Française de Microbiologie 2015 recommendations, using Pseudomonas aeruginosa ATCC 27853 and Escherichia coli ATCC 25922 as quality control

AntibioticsMICIZDBreakpointa SCategorization
(μg/mL)(mm)(μg/mL)(mm)
Ticarcillin≥2560≤16≥18Resistant
Ticarcillin + AC648≤16≥18Resistant
Piperacillin626≤16≥18Susceptible
Ceftazidime0.7522≤8≥16Susceptible
Cefotaxime>328--Resistant
Cefepime0.12537≤8≥19Susceptible
Aztreonam≥2560≤1≥50Resistant
Imipenem225≤4≥20Susceptible
Meropenem815≤2≥18Resistant
Ciprofloxacin0.2530≤0.5≥25Susceptible
Co-trimoxazole0.09428--Susceptible

- cefotaxime breakpoint not given, AC clavulanic acid, IZD inhibition zone diameter, MIC minimum inhibitory concentration, S Susceptibility

aAntimicrobial susceptibilities interpretation was done according to Comité d’Antibiogramme de la Société Française de Microbiologie 2015 recommendations using Pseudomonas species as reference

In vitro antimicrobial susceptibilities of the strain, and interpretation according to Comité d’Antibiogramme de la Société Française de Microbiologie 2015 recommendations, using Pseudomonas aeruginosa ATCC 27853 and Escherichia coli ATCC 25922 as quality control - cefotaxime breakpoint not given, AC clavulanic acid, IZD inhibition zone diameter, MIC minimum inhibitory concentration, S Susceptibility aAntimicrobial susceptibilities interpretation was done according to Comité d’Antibiogramme de la Société Française de Microbiologie 2015 recommendations using Pseudomonas species as reference Due to the decreased susceptibility to carbapenem, a combined test with imipenem and ethylenediaminetetraacetic acid (EDTA) was positive, indicating the production of metallo-β-lactamase (MBL). To characterize the gene encoding MBL, polymerase chain reaction (PCR) was performed using genomic deoxyribonucleic acid (DNA) obtained by phenolchloroform extraction, using the template primers CGB1_exp/fw (5′-GGGAATTCCATATGAAAAAAAGCATTCCGTTTTTTA) and CGB1_exp/rv (CGCGGATCCTTATTTTTTATTTAAAAGATCAAG) as described previously by Bellais and colleagues [9]. DNA sequence analysis of the 726-base pairs (bp) amplified fragments encoding a 242-amino acid preprotein showed 99% similarity with CGB-1 (Fig. 1).
Fig. 1

Comparison of the amino acid sequence of β-lactamase CGB-1 with our strain. Broken lines indicate identical amino acid residues. The vertical arrow indicates the putative cleavage site for the leader peptide of CGB-1. Amino acids that may be involved in the binding of Zinc (Zn2+) or/and water are indicated with a star. Shading corresponds to the single amino-acid mutation occurring in the gene of our strain

Comparison of the amino acid sequence of β-lactamase CGB-1 with our strain. Broken lines indicate identical amino acid residues. The vertical arrow indicates the putative cleavage site for the leader peptide of CGB-1. Amino acids that may be involved in the binding of Zinc (Zn2+) or/and water are indicated with a star. Shading corresponds to the single amino-acid mutation occurring in the gene of our strain

Discussion

C. gleum is an unusual human pathogen that has been reported as the cause of early neonatal respiratory infection in three neonates [3]. The most common species causing human disease is F. meningosepticum followed by C. indologenes and C. gleum [10]. Typically thought of as an organism of low virulence, C. gleum may cause serious infections, particularly among immunocompromised patients. Colonization of this organism in patients can occur via contaminated medical devices involving fluids, such as intubation tubes, respirators, humidifiers, and incubators for newborns, as previously reported [11]. Almost, all publications available in the literature refer to long hospital stays with prolonged antibiotic treatment (>14 days), oncological disease, and most of the patients had immunosuppression or indwelling devices [8-11]. A recent case published in 2016 from Saudi Arabia, reported C. gleum pneumonia in a 6-month-old baby with nephrotic syndrome [6]. The patient, intubated, was previously on multiple courses of antibiotics including meropenem, ceftriaxone, and vancomycin. Virok et al. reported in 2014 a case of early neonatal respiratory infection due to C. gleum in Hungary [3]. In Croatia, Dijana et al. published in 2015 a case of C. gleum infection in a patient with malnutrition and hepatic lesion [5]. The patient with respiratory insufficiency had developed septic shock, which necessitated intubation and mechanical ventilation. Our patient underwent a prostatectomy in a regional hospital with indwelling catheter; he had a urinary tract infection due to C. gleum, similar to an Indian case reported by Ramya et al. in 2015 [4]. Little is known about the virulence factor(s) of the members of Chryseobacterium, although reports have indicated that biofilm and protease production are important mechanisms involved in the virulence of Elizabethkingia meningoseptica (formerly Chryseobacterium meningosepticum) and C. indologenes [11]. Biofilm production by C. indologenes in central venous catheter-related bloodstream infection was recently noted [12]. E. meningoseptica isolates demonstrated 100% biofilm-forming ability in Luria-Bertani (LB) media, and increasing biofilm production is associated with the mortality rates of infected patients [13]. Lo and Chang performed a focused study on 14 C. gleum isolates [14], and the strains were epidemiologically unrelated and originated primarily from urine and sputum. Their study demonstrated that 40% of C. gleum isolates could form a biofilm. The biofilm-forming potential of C. gleum appeared to be much lower than that of E. meningoseptica. Therefore, it was suggested that C. gleum might be less virulent than E. meningoseptica and C. indologenes. In fact, we previously reported a fatal case of urinary tract infection due to C. indologenes in a woman with acute leukemia [8]. This outcome is in contrast to the present case, where the patient survived despite an advanced state of malnutrition. Only 0.27% (50 of 18,569) of all processed non-fermenting Gram-negative bacilli (NFGNBs) and 0.03% (50 of 15,5811) of isolates collected by the SENTRY Antimicrobial Surveillance Program during the 5-year period from 1997 to 2001 were members of the genera Chryseobacterium or Elizabethkingia (formerly Chryseobacterium), with the most frequent organisms being E. meningoseptica, C. indologenes, and C. gleum [15]. All 50 isolates were obtained from hospitalized patients, among which only two isolates (4%) were identified as C. gleum. The present case is the first reported case of a urinary tract infection in Africa by C. gleum, although C. indologenes was previously reported in Burkina Faso in 2007 [16], in Senegal in 2014 [8], and in Tunisia in 2015 [17]. However, in Senegal, two cases of meningitis due to F. meningosepticum were diagnosed in the late 1970s [7]. There are few data available on antimicrobial susceptibility and no standardized breakpoints for Chryseobacterium species in CA-SFM guidelines due to the small number of clinical isolates. Thus, selecting an antimicrobial agent for the treatment of Chryseobacterium species infections remains difficult, especially because of chromosomal resistance to many antibiotics used for Gram-negative bacteria. According to the SENTRY Antimicrobial Surveillance Program, the antimicrobials most active against Chryseobacterium species are quinolones and sulfamethoxazole-trimethoprim (≥95% susceptibility) followed by piperacillin-tazobactam (90% susceptibility). Ciprofloxacin, cefepime, ceftazidime, piperacillin, and rifampicin showed reasonable activity (85% susceptibility), whereas aminoglycosides, other β-lactams, chloramphenicol, linezolid, and glycopeptides are not appropriate for treating infections caused by this organism [15]. This conclusion is in concordance with the drug susceptibility pattern of the strain isolated in Senegal. In fact, most C. gleum infections have been preferentially treated by newer generations of quinolones than by the combination of piperacillin-tazobactam (Table 1). However, the strain isolated in Saudi Arabia was resistant to piperacillin-tazobactam. In addition, it was previously published that C. gleum CIP 103039 carried at least two likely chromosome-encoded β-lactamases, Amber class A CGA-1 and Amber class B CGB-1, and was resistant to penicillins, cephalosporins, cefotaxime, and aztreonam, intermediate to carbapenems, and susceptible to piperacillin. Our strain showed the same drug susceptibility pattern as C. gleum CIP 103039 (Table 4). In contrast, the focused study of 14 C. gleum isolates conducted in Taiwan by Lo and Chang revealed that all isolates were resistant to piperacillin and imipenem [14].
Table 4

Minimum inhibitory concentrations of β-lactams for Chryseobacterium gleum CIP 103039, in comparison with our strain

MIC (μg/mL) for:
AntibioticsOur strain Chryseobacterium gleum CIP 103039
Ticarcillin≥256256
Ticarcillin + AC64256
Piperacillin62
Ceftazidime0.754
Cefotaxime>3232
Cefepime0.1251
Aztreonam≥256>512
Imipenem22
Meropenem88

AC clavulanic acid, MIC minimum inhibitory concentration

Minimum inhibitory concentrations of β-lactams for Chryseobacterium gleum CIP 103039, in comparison with our strain AC clavulanic acid, MIC minimum inhibitory concentration

Conclusions

To the best of our knowledge, this is the first case of a C. gleum infection reported in Africa. Despite their low virulence, Chryseobacterium species should be considered a potential opportunistic pathogen that can cause infection in hospitalized patients. This report highlights the emergence of Chryseobacterium infections in Africa and emphasizes the importance of strengthening hospital hygiene measures as well as the necessity to survey environmental bacteria that could cause hospital-acquired infections.
  13 in total

1.  [Chryseobacterium indologenes in ventilator-associated pneumonia: First reported case in Tunisia].

Authors:  I Ben Salah; M Fekih Hassen; A Ben Haj Khalifa; H Ben Sik Ali; N Tilouche; M Kheder; S Elatrous
Journal:  Rev Pneumol Clin       Date:  2015-07-22

2.  [Flavobacterium meningosepticum meningitis. Clinical and bacteriological study of 2 cases treated in Senegal].

Authors:  A Samb; J P Chiron; F Denis; A Sow; I Diop Mar
Journal:  Bull Soc Med Afr Noire Lang Fr       Date:  1977

3.  Chryseobacterium gleum - a novel bacterium species detected in neonatal respiratory tract infections.

Authors:  Dezső Péter Virok; Mariann Ábrók; Borbála Szél; Zsanett Tajti; Krisztina Mader; Edit Urbán; Gyula Tálosi
Journal:  J Matern Fetal Neonatal Med       Date:  2014-02-03

4.  Identification, characterization, and biofilm formation of clinical Chryseobacterium gleum isolates.

Authors:  Hsueh-Hsia Lo; Shan-Min Chang
Journal:  Diagn Microbiol Infect Dis       Date:  2014-02-20       Impact factor: 2.803

5.  Biofilm production, use of intravascular indwelling catheters and inappropriate antimicrobial therapy as predictors of fatality in Chryseobacterium meningosepticum bacteraemia.

Authors:  Pen-Yi Lin; Hsiu-Ling Chen; Chung-Tsui Huang; Lin-Hui Su; Cheng-Hsun Chiu
Journal:  Int J Antimicrob Agents       Date:  2010-11       Impact factor: 5.283

6.  IND-6, a highly divergent IND-type metallo-beta-lactamase from Chryseobacterium indologenes strain 597 isolated in Burkina Faso.

Authors:  Boukaré Zeba; Filomena De Luca; Alain Dubus; Michael Delmarcelle; Jacques Simporé; Odile G Nacoulma; Gian Maria Rossolini; Jean-Marie Frère; Jean-Denis Docquier
Journal:  Antimicrob Agents Chemother       Date:  2009-08-03       Impact factor: 5.191

7.  Antimicrobial susceptibility and epidemiology of a worldwide collection of Chryseobacterium spp: report from the SENTRY Antimicrobial Surveillance Program (1997-2001).

Authors:  Jeffrey T Kirby; Helio S Sader; Timothy R Walsh; Ronald N Jones
Journal:  J Clin Microbiol       Date:  2004-01       Impact factor: 5.948

8.  Genetic and biochemical characterization of CGB-1, an Ambler class B carbapenem-hydrolyzing beta-lactamase from Chryseobacterium gleum.

Authors:  Samuel Bellais; Thierry Naas; Patrice Nordmann
Journal:  Antimicrob Agents Chemother       Date:  2002-09       Impact factor: 5.191

9.  Chryseobacterium gleum pneumonia in an infant with nephrotic syndrome.

Authors:  Baha Abdalhamid; Nasreldin Elhadi; Khaldoon Alsamman; Reem Aljindan
Journal:  IDCases       Date:  2016-06-30

10.  Chryseobacterium indologenes in a woman with acute leukemia in Senegal: a case report.

Authors:  Arouna Omar; Makhtar Camara; Seynabou Fall; Safietou Ngom-Cisse; Becaye Fall; Awa Ba-Diallo; Halimatou Diop-Ndiaye; Coumba Toure-Kane; Souleymane Mboup; Aissatou Gaye-Diallo
Journal:  J Med Case Rep       Date:  2014-05-06
View more
  2 in total

1.  The Mexican giant maize of Jala landrace harbour plant-growth-promoting rhizospheric and endophytic bacteria.

Authors:  Bibiana Rios-Galicia; Catalina Villagómez-Garfias; Esaú De la Vega-Camarillo; Jairo Eder Guerra-Camacho; Nora Medina-Jaritz; Ramón Ignacio Arteaga-Garibay; Lourdes Villa-Tanaca; César Hernández-Rodríguez
Journal:  3 Biotech       Date:  2021-09-24       Impact factor: 2.893

2.  Comparison of four automated microbiology systems with 16S rRNA gene sequencing for identification of Chryseobacterium and Elizabethkingia species.

Authors:  Jiun-Nong Lin; Chung-Hsu Lai; Chih-Hui Yang; Yi-Han Huang; Hsiu-Fang Lin; Hsi-Hsun Lin
Journal:  Sci Rep       Date:  2017-10-23       Impact factor: 4.379

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.