Literature DB >> 28430105

Switching of metabolic programs in response to light availability is an essential function of the cyanobacterial circadian output pathway.

Anna M Puszynska1,2,3, Erin K O'Shea1,2,3,4.   

Abstract

The transcription factor RpaA is the master regulator of circadian transcription in cyanobacteria, driving genome-wide oscillations in mRNA abundance. Deletion of rpaA has no effect on viability in constant light conditions, but renders cells inviable in cycling conditions when light and dark periods alternate. We investigated the mechanisms underlying this viability defect, and demonstrate that the rpaA- strain cannot maintain appropriate energy status at night, does not accumulate carbon reserves during the day, and is defective in transcription of genes crucial for utilization of carbohydrate stores at night. Reconstruction of carbon utilization pathways combined with provision of an external carbon source restores energy charge and viability of the rpaA- strain in light/dark cycling conditions. Our observations highlight how a circadian output pathway controls and temporally coordinates essential pathways in carbon metabolism to maximize fitness of cells facing periodic energy limitations.

Entities:  

Keywords:  Synechococcus elongatus PCC7942; biochemistry; circadian rhythm; cyanobacteria; fitness; infectious disease; metabolism; microbiology

Mesh:

Substances:

Year:  2017        PMID: 28430105      PMCID: PMC5400509          DOI: 10.7554/eLife.23210

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Organisms across kingdoms of life have evolved circadian clocks to temporally align biological activities with the diurnal changes in the environment. In the cyanobacterium Synechococcus elongatus PCC7942, the core circadian oscillator is comprised of the KaiA, KaiB and KaiC proteins (Nishiwaki et al., 2007; Rust et al., 2007) that generate oscillations in the phosphorylation state of KaiC. Time information encoded in the phosphorylation state of KaiC is transmitted to the transcription factor RpaA (Takai et al., 2006; Taniguchi et al., 2010; Markson et al., 2013) to generate circadian changes in gene expression (Markson et al., 2013). In continuous light, the expression of more than 60% of protein-coding genes in S. elongatus is regulated in a circadian manner (Vijayan et al., 2009) with two main phases of gene expression: genes peaking at subjective dawn or subjective dusk, where the term ‘subjective’ refers to an internal estimate of time in the absence of external cues. Deletion of rpaA disrupts these rhythms in mRNA abundance and arrests cells in a subjective dawn-like transcriptional state, rendering them unable to switch to a subjective dusk-like expression program (Markson et al., 2013). While it is clear that the circadian transcriptional program schedules timing of gene expression when the clock is free-running in the absence of changes in external light, it is unclear how circadian control of gene expression is used under more physiologically relevant conditions when light and dark periods alternate. Exposure to darkness restricts energy availability, creating unique metabolic demands in cyanobacteria which depend on sunlight for energy production through photosynthesis. Strikingly, the rpaA strain exhibits defects in cell growth and viability in cyclic, but not in constant light environments (Takai et al., 2006), suggesting an important role for circadian regulation of gene expression in alternating light/dark cycles. We find that both accumulation and utilization of the carbon reserves required for energy production during periods of darkness are defective in the rpaA strain, and that correction of these defects restores viability. Our results provide insight into the role of the circadian output pathway in enhancing fitness of cyanobacteria through coordination of central carbon metabolism with the metabolic demands imposed by periodic changes in the external environment.

Results

As reported previously (Takai et al., 2006), in constant light wild type and the rpaA cells grow at the same rate (Figure 1A, top panel); however, the rpaA strain is not viable when cultured in alternating light/dark conditions (Figure 1A, bottom panel and Figure 1—figure supplement 1A). The rpaA strain rapidly loses viability when incubated in the dark (Figure 1—figure supplement 1B), suggesting that the defect is induced by darkness and not by repeated light-to-dark and dark-to-light transitions. Complementation of the rpaA strain with rpaA expressed from an ectopic site in the genome fully restores viability (Figure 1—figure supplement 1A and Figure 1—figure supplement 1B). In wild type cells, expression of the kaiBC genes depends on RpaA and thus deletion of rpaA abrogates the function of the KaiABC oscillator, altering the stoichiometry of the core clock proteins and abrogating the rhythms in KaiC phosphorylation (Takai et al., 2006). To establish whether the defect in viability during dark periods results from loss of Kai oscillator function or from loss of RpaA function, we performed viability experiments using the ‘clock rescue’ strain background in which kaiBC expression is made independent of RpaA (Teng et al., 2013). We observed that the rpaA ‘clock rescue’ strain phenocopies the rpaA strain and the isogenic rpaA ‘clock rescue’ strain phenocopies wild type strain, demonstrating that the viability defect stems from the loss of RpaA function and not from loss of Kai oscillator function (Figure 1B and Figure 1—figure supplement 1C).
Figure 1.

The rpaA strain displays a defect in viability in light/dark conditions.

(A) Growth curves of wild type and the rpaA strain in constant light (top) and in 12 hr light/12 hr dark conditions (below) in BG-11 medium. Points represent the mean of three independent experiments with error bars displaying the standard error of the mean. (B) Growth curves of the ‘clock rescue’ and the rpaA ‘clock rescue’ strains in 12 hr light/12 hr dark conditions in BG-11 medium. Points represent the mean of three independent experiments with error bars displaying the standard error of the mean. (C) Growth curves of the rpaA strains containing a Ptrc promoter driving expression of RpaA D53E (OX-D53E) or RpaA D53A (OX-D53A) in 12 hr light/12 hr dark conditions grown in the presence or absence of 20 μM IPTG. Points represent the mean of two biological replicates with error bars displaying the standard error of the mean. (D) Comparison of growth of wild type and the kaiBC mutant in constant light and in light/dark conditions. The experiment was performed three independent times and a representative experiment is shown. (E) Quantification of RpaA phosphorylation levels measured by Phos-tag western blot in wild type and the kaiBC strains in light/dark conditions. Each point represents the mean of two biological replicates with error bars displaying the standard error of the mean. (F) Comparison of growth of the cKaiC strain (subscript ‘c’ denoting constitutive, RpaA-independent expression) and strains expressing phosphomimetic variants of KaiC, cKaiC-EE or cKaiC-AA, in constant light and in light/dark conditions. The experiment was performed three independent times and a representative experiment is shown. (G) Quantification of phosphorylation levels of RpaA measured by Phos-tag western blot in the cKaiC strain or in the strains expressing phosphomimetic variants of KaiC, cKaiC-EE and cKaiC-AA, in light/dark conditions. Each point represents the mean of three biological replicates with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.003

(A) Complementation of the rpaA strain with rpaA expressed from the neutral site NS1 rescues the viability defect in light/dark conditions. The experiment was performed three independent times and a representative experiment is shown. (B) Viability of the indicated strains after prolonged incubation in darkness. The survival of cells was assessed by a colony forming unit assay. Points represent the mean of two experiments with error bars displaying the standard error of the mean. (C) Comparison of growth of the ‘clock rescue’ strain and the rpaA ‘clock rescue’ strain. The experiment was performed three independent times and a representative experiment is shown. (D) Comparison of growth of the cRpaA ‘clock rescue’ strain and the cRpaA D53A ‘clock rescue’ mutant, where cRpaA indicates constitutive expression of RpaA. In wild type strain RpaA activates its own expression. In the cRpaA strains the rpaA promoter was changed to a P0050 promoter allowing for constitutive expression of RpaA D53A. The experiment was performed three independent times and a representative experiment is shown. (E) Comparison of RpaA protein levels expressed from the native promoter and the P0050 clock-independent, constitutive promoter. Each point represents an individual measurement with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.004

(A) Comparison of protein levels of KaiC variants expressed from the native and the P0050 promoters assessed by western blot. Each point represents an individual measurement with error bars displaying the standard error of the mean. (B) Comparison of protein levels of RpaA expressed from the native promoter and the P0050 promoter in the phosphomimetic strains assessed by western blot. Each point represents an individual measurement with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.005

Figure 1—figure supplement 1.

Characterization of growth and viability of the rpaA mutants.

(A) Complementation of the rpaA strain with rpaA expressed from the neutral site NS1 rescues the viability defect in light/dark conditions. The experiment was performed three independent times and a representative experiment is shown. (B) Viability of the indicated strains after prolonged incubation in darkness. The survival of cells was assessed by a colony forming unit assay. Points represent the mean of two experiments with error bars displaying the standard error of the mean. (C) Comparison of growth of the ‘clock rescue’ strain and the rpaA ‘clock rescue’ strain. The experiment was performed three independent times and a representative experiment is shown. (D) Comparison of growth of the cRpaA ‘clock rescue’ strain and the cRpaA D53A ‘clock rescue’ mutant, where cRpaA indicates constitutive expression of RpaA. In wild type strain RpaA activates its own expression. In the cRpaA strains the rpaA promoter was changed to a P0050 promoter allowing for constitutive expression of RpaA D53A. The experiment was performed three independent times and a representative experiment is shown. (E) Comparison of RpaA protein levels expressed from the native promoter and the P0050 clock-independent, constitutive promoter. Each point represents an individual measurement with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.004

The rpaA strain displays a defect in viability in light/dark conditions.

(A) Growth curves of wild type and the rpaA strain in constant light (top) and in 12 hr light/12 hr dark conditions (below) in BG-11 medium. Points represent the mean of three independent experiments with error bars displaying the standard error of the mean. (B) Growth curves of the ‘clock rescue’ and the rpaA ‘clock rescue’ strains in 12 hr light/12 hr dark conditions in BG-11 medium. Points represent the mean of three independent experiments with error bars displaying the standard error of the mean. (C) Growth curves of the rpaA strains containing a Ptrc promoter driving expression of RpaA D53E (OX-D53E) or RpaA D53A (OX-D53A) in 12 hr light/12 hr dark conditions grown in the presence or absence of 20 μM IPTG. Points represent the mean of two biological replicates with error bars displaying the standard error of the mean. (D) Comparison of growth of wild type and the kaiBC mutant in constant light and in light/dark conditions. The experiment was performed three independent times and a representative experiment is shown. (E) Quantification of RpaA phosphorylation levels measured by Phos-tag western blot in wild type and the kaiBC strains in light/dark conditions. Each point represents the mean of two biological replicates with error bars displaying the standard error of the mean. (F) Comparison of growth of the cKaiC strain (subscript ‘c’ denoting constitutive, RpaA-independent expression) and strains expressing phosphomimetic variants of KaiC, cKaiC-EE or cKaiC-AA, in constant light and in light/dark conditions. The experiment was performed three independent times and a representative experiment is shown. (G) Quantification of phosphorylation levels of RpaA measured by Phos-tag western blot in the cKaiC strain or in the strains expressing phosphomimetic variants of KaiC, cKaiC-EE and cKaiC-AA, in light/dark conditions. Each point represents the mean of three biological replicates with error bars displaying the standard error of the mean. DOI: http://dx.doi.org/10.7554/eLife.23210.003

Characterization of growth and viability of the rpaA mutants.

(A) Complementation of the rpaA strain with rpaA expressed from the neutral site NS1 rescues the viability defect in light/dark conditions. The experiment was performed three independent times and a representative experiment is shown. (B) Viability of the indicated strains after prolonged incubation in darkness. The survival of cells was assessed by a colony forming unit assay. Points represent the mean of two experiments with error bars displaying the standard error of the mean. (C) Comparison of growth of the ‘clock rescue’ strain and the rpaA ‘clock rescue’ strain. The experiment was performed three independent times and a representative experiment is shown. (D) Comparison of growth of the cRpaA ‘clock rescue’ strain and the cRpaA D53A ‘clock rescue’ mutant, where cRpaA indicates constitutive expression of RpaA. In wild type strain RpaA activates its own expression. In the cRpaA strains the rpaA promoter was changed to a P0050 promoter allowing for constitutive expression of RpaA D53A. The experiment was performed three independent times and a representative experiment is shown. (E) Comparison of RpaA protein levels expressed from the native promoter and the P0050 clock-independent, constitutive promoter. Each point represents an individual measurement with error bars displaying the standard error of the mean. DOI: http://dx.doi.org/10.7554/eLife.23210.004

Characterization of protein levels of KaiC and RpaA in the cKaiC phosphomimetic mutants in comparison to wild type.

(A) Comparison of protein levels of KaiC variants expressed from the native and the P0050 promoters assessed by western blot. Each point represents an individual measurement with error bars displaying the standard error of the mean. (B) Comparison of protein levels of RpaA expressed from the native promoter and the P0050 promoter in the phosphomimetic strains assessed by western blot. Each point represents an individual measurement with error bars displaying the standard error of the mean. DOI: http://dx.doi.org/10.7554/eLife.23210.005 Since phosphorylation of RpaA is required for binding to its target promoters and gene expression (Markson et al., 2013), we asked whether the rpaA deletion phenotype in light/dark conditions can be rescued by a specific phosphorylated form of RpaA: RpaA D53E mimicking the phosphorylated state of RpaA; and RpaA D53A mimicking the unphosphorylated state. We examined the viability of the OX-D53E and OX-D53A strains, which lack both kaiBC and rpaA and contain a phosphomimetic form of RpaA expressed from an IPTG-inducible Ptrc promoter (Markson et al., 2013). In these strains RpaA phosphorylation is not controlled by either the clock activity or by any other potential input factor, isolating RpaA activity from its regulators. We observed that expression of the RpaA D53E phosphomimetic restores viability in light/dark conditions, while expression of the RpaA D53A variant does not (Figure 1C). We also compared growth of the cRpaA strain (subscript ‘c’ denotes constitutive, RpaA-independent expression; see Materials and methods) with the cRpaA D53A strain, each made using the ‘clock rescue’ background, in light/dark cycles. We found that while the control cRpaA strain grows under these conditions despite lower levels of RpaA driven by the constitutive promoter, the cRpaA D53A strain is inviable (Figure 1—figure supplement 1D and E). We conclude that the active DNA-binding form of RpaA is necessary and sufficient for cell viability during exposure to light/dark conditions. We next analyzed the role of the core KaiABC clock in sustaining viability of cyanobacterial cells in light/dark conditions. Deletion of the kaiBC operon leads to only a minor viability defect in light/dark conditions (Boyd et al., 2013 and Figure 1D) and substantial RpaA phosphorylation levels were observed in the kaiBC strain at the subjective dawn (CT = 2 hr) and afternoon (CT = 9 hr) in constant light conditions (Boyd et al., 2013). Since RpaA phosphorylation levels are regulated by the antagonistic activities of two clock-controlled histidine kinases, SasA and CikA, and complexes of KaiB and KaiC proteins activate the phosphatase activity of CikA in vitro (Gutu and O'Shea, 2013), we hypothesized that RpaA would remain highly phosphorylated throughout the light/dark cycle in the kaiBC strain. In agreement with this prediction, when we analyzed RpaA phosphorylation in the kaiBC mutant we detected high levels of RpaA phosphorylation both in light and in the dark (Figure 1E). Thus, the ability of the kaiBC mutant to survive alternating periods of light and dark likely stems from the high levels of phosphorylated RpaA in this strain. While the kaiBC operon is not essential for cell viability in light/dark cycles, specific KaiC phosphoforms, whose relative abundances vary during the circadian cycle (Rust et al., 2007), may have different effects on RpaA phosphorylation and, consequently, affect the ability of cells to survive light/dark cycling conditions. We tested this hypothesis by analyzing cell viability and RpaA phosphorylation in strains expressing KaiC point mutants: KaiC-AA (KaiC S431A T432A), representing the unphosphorylated phosphoform of KaiC, and KaiC-EE (KaiC S431E T432E), representing the hyperphosphorylated KaiC variant. We used the P0050 promoter, which releases KaiC and RpaA expression from circadian feedback, to ensure equal expression of KaiC variants as well as of RpaA between the phosphomimetic strains (Figure 1—figure supplement 2). We observed that while the cKaiC-AA mutant is viable in light/dark conditions, the cKaiC-EE strain is not able to grow (Figure 1F). Strikingly, the cKaiC-AA strain maintains high RpaA phosphorylation levels during the diurnal cycle, while RpaA is phosphorylated in the cKaiC-EE strain only at a low level (Figure 1G). This ability to control RpaA phosphorylation and cell viability through perturbations in KaiC phosphorylation status underscores the primacy of this regulatory axis in the diurnal control of RpaA phosphorylation, and suggests that any hypothetical clock-independent environmental factors play a lesser role in regulating RpaA phosphorylation under the conditions we tested.
Figure 1—figure supplement 2.

Characterization of protein levels of KaiC and RpaA in the cKaiC phosphomimetic mutants in comparison to wild type.

(A) Comparison of protein levels of KaiC variants expressed from the native and the P0050 promoters assessed by western blot. Each point represents an individual measurement with error bars displaying the standard error of the mean. (B) Comparison of protein levels of RpaA expressed from the native promoter and the P0050 promoter in the phosphomimetic strains assessed by western blot. Each point represents an individual measurement with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.005

Circadian clocks and their output synchronize the metabolic activity of cells with diurnal fluctuations (Tu and McKnight, 2006; Green et al., 2008; Graf et al., 2010; Dodd et al., 2015). To understand if the observed viability defect stems from an inability of the rpaA strain (which is arrested in a ‘dawn-like’ transcriptional state [Markson et al., 2013]) to meet the metabolic requirements of darkness, we assessed cellular energy charge in wild type and the rpaA strain over time in constant light conditions and in light/dark cycles. Energy charge describes the relative levels of ATP, ADP and AMP in the intracellular adenine nucleotide pool, and is a tightly controlled parameter that reflects the global metabolic energy status of the cell (Atkinson, 1968). In constant light, there was no difference in energy charge between wild type and the rpaA strain (Figure 2, top panel). Wild type cells subjected to darkness experience only a slight reduction in energy charge (Figure 2, bottom panel, Figure 2—figure supplement 1A). In contrast, rpaA cells experience a reduction in energy charge during the first dark period and an even more dramatic reduction during the second dark period, suggesting that this strain has a defect in energy metabolism affecting energy maintenance during the dark phase of the light/dark cycle (Figure 2, bottom panel, Figure 2—figure supplement 1B). The decrease in energy charge was accompanied by a reduction in the total adenine nucleotide pool size in the rpaA strain (Figure 2—figure supplement 2). A similar trend has been previously observed during starvation in carbon-limited cultures of E. coli (Chapman et al., 1971), prompting us to analyze changes in activity through pathways relevant for carbon metabolism in the strain lacking rpaA.
Figure 2.

The rpaA strain has a defect in maintenance of the cellular energy charge in oscillating light/dark conditions.

Changes in the energy charge, defined as ([ATP] +0.5*[ADP])/([ATP]+[ADP]+[AMP]), during growth of wild type and the rpaA strain in constant light (top) or in 12 hr light/12 hr dark conditions (bottom) in BG-11 medium. Each point represents the mean of three independent experiments with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.006

Quantification of levels of ATP, ADP and AMP in wild type (A) and the rpaA strain (B) grown in light/dark cycles. Points represent the mean of two experiments with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.007

Quantification of relative levels of all adenine nucleotides in wild type and the rpaA strains grown in light/dark cycles. Points represent the mean of four experiments with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.008

Figure 2—figure supplement 1.

Changes in the ATP, ADP and AMP levels in cells grown in light/dark conditions.

Quantification of levels of ATP, ADP and AMP in wild type (A) and the rpaA strain (B) grown in light/dark cycles. Points represent the mean of two experiments with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.007

Figure 2—figure supplement 2.

The rpaA strain displays a defect in levels of adenine nucleotides in light/dark cycles.

Quantification of relative levels of all adenine nucleotides in wild type and the rpaA strains grown in light/dark cycles. Points represent the mean of four experiments with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.008

The rpaA strain has a defect in maintenance of the cellular energy charge in oscillating light/dark conditions.

Changes in the energy charge, defined as ([ATP] +0.5*[ADP])/([ATP]+[ADP]+[AMP]), during growth of wild type and the rpaA strain in constant light (top) or in 12 hr light/12 hr dark conditions (bottom) in BG-11 medium. Each point represents the mean of three independent experiments with error bars displaying the standard error of the mean. DOI: http://dx.doi.org/10.7554/eLife.23210.006

Changes in the ATP, ADP and AMP levels in cells grown in light/dark conditions.

Quantification of levels of ATP, ADP and AMP in wild type (A) and the rpaA strain (B) grown in light/dark cycles. Points represent the mean of two experiments with error bars displaying the standard error of the mean. DOI: http://dx.doi.org/10.7554/eLife.23210.007

The rpaA strain displays a defect in levels of adenine nucleotides in light/dark cycles.

Quantification of relative levels of all adenine nucleotides in wild type and the rpaA strains grown in light/dark cycles. Points represent the mean of four experiments with error bars displaying the standard error of the mean. DOI: http://dx.doi.org/10.7554/eLife.23210.008 In constant light conditions, the circadian program directs expression of anabolic and catabolic pathways, with genes relevant for carbon catabolism peaking in mRNA abundance at subjective dusk (Vijayan et al., 2009; Diamond et al., 2015). To investigate the role of RpaA in orchestrating diurnal transcription of metabolic genes, we performed RNA sequencing in the rpaA ‘clock rescue’ strain and an isogenic rpaA strain after exposure to darkness. The expression of circadian dusk-peaking genes was most affected in the rpaA deletion strain exposed to darkness (Figure 3—figure supplement 1A). Specifically, we observed that genes encoding enzymes involved in glycogen breakdown, glycolysis and the oxidative pentose phosphate pathway (Figure 3—figure supplement 1B and Supplementary file 1), which normally peak in expression at dusk, are among the genes with the greatest defect in expression in the rpaA cells (Figure 3A). These pathways are key for carbon utilization and energy production in the dark in cyanobacteria (Figure 3B), and their function is essential for survival of periods of darkness (Doolittle and Singer, 1974). Independent deletion of gnd as well as the glgP_gap1 and fbp_zwf_opcA operons, which exhibit severely reduced expression in the rpaA strain, results in impaired viability in light/dark cycles but not in constant light conditions (Figure 3—figure supplement 1C and Doolittle and Singer, 1974; Scanlan et al., 1995). We also measured expression of the key dusk metabolic genes, gnd, glgP and zwf, in the kaiBC strain at dusk and in the first hours of darkness (Figure 3—figure supplement 2). We observed that these genes are expressed at a high level, further emphasizing the role of phosphorylated RpaA in activation of the dusk transcriptional program and maintenance of cell viability in light/dark conditions. To confirm that the transcriptional defects in the rpaA deletion mutant affect carbon catabolism, we measured the enzymatic activities of glycogen phosphorylase (glgP), glucose-6-phosphate dehydrogenase (zwf) and 6-phosphogluconate dehydrogenase (gnd) in the dark, and observed that activity of each enzyme was strongly reduced in the rpaA strain compared to wild type (Figure 3C). Therefore, the rpaA- strain appears to be unable to activate the carbon catabolic pathways upon the onset of darkness because it cannot induce transcription of the requisite enzymes at dusk.
Figure 3—figure supplement 1.

Expression of genes encoding enzymes involved in alternative sugar catabolism pathways is defective in the rpaA strain in light/dark cycles.

(A) Comparison of the normalized gene expression in the ‘clock rescue’ and the rpaA ‘clock rescue’ strains 1 hr after exposure to darkness. Circadian genes whose expression peaks at dawn in wild type strain are colored yellow, dusk-peaking genes are blue and non-circadian genes are black. Fold changes are displayed graphically as diagonal lines on the plot. (B) Analysis of the functional annotations of the protein coding genes whose expression is defective in the rpaA ‘clock rescue’ strain. We identified 88 protein coding genes whose expression is at least 3-fold lower in the rpaA ‘clock rescue’ strain than in the control strain, as described in the Materials and methods section. The detailed list of genes, whose expression is abrogated in the rpaA ‘clock rescue’ strain, is presented in Supplementary file 1. (C) A representative photograph of a plate viability assay performed using mutants characterized by Doolittle and Singer (1974) and Scanlan et al. (1995). The deletion mutants of indicated genes involved in alternative sugar metabolism pathways were plated as a dilution series on BG-11 agar and grown in continuous light for 7 days or under light/dark conditions for 14 days. The experiment was performed four independent times.

DOI: http://dx.doi.org/10.7554/eLife.23210.010

Figure 3.

Sugar catabolism pathways are abrogated in the rpaA strain.

(A) Temporal expression profiles of genes encoding enzymes involved in sugar metabolism whose expression is abrogated in the rpaA ‘clock rescue’ strain. Relative RNA levels were measured in the light/dark conditions by RNA sequencing. (B) A diagram representing carbon metabolism in S. elongatus PCC7942 in the dark. At night glycogen constitutes the store for energy and carbon skeletons. Glycogen degradation, glycolysis and oxidative pentose phosphate pathways are the key metabolic pathways operating at night. Deletion of operons with genes colored red leads to a strong viability defect specifically in light/dark conditions (Figure 3—figure supplement 1C and Doolittle and Singer 1974; Scanlan et al., 1995). glgP, glycogen phosphorylase; gap1, glyceraldehyde-3-phosphate dehydrogenase; gnd, 6-phosphogluconate dehydrogenase; zwf, glucose-6-phosphate dehydrogenase; opcA, glucose-6-phosphate dehydrogenase assembly protein; fbp, fructose-1,6-bisphosphatase, G6P, glucose-6-phosphate; 6-PGlcA, 6-phosphogluconate; F6P, fructose-6-phosphate; FBP, fructose-1,6-bisphosphate, Ru5-P, ribulose-5-phosphate (C) Enzymatic activities of glycogen phosphorylase, glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase in wild type, the rpaA and negative control strains measured 3 hr after exposure to expected darkness. Error bars represent standard error of the mean of four independent experiments.

DOI: http://dx.doi.org/10.7554/eLife.23210.009

(A) Comparison of the normalized gene expression in the ‘clock rescue’ and the rpaA ‘clock rescue’ strains 1 hr after exposure to darkness. Circadian genes whose expression peaks at dawn in wild type strain are colored yellow, dusk-peaking genes are blue and non-circadian genes are black. Fold changes are displayed graphically as diagonal lines on the plot. (B) Analysis of the functional annotations of the protein coding genes whose expression is defective in the rpaA ‘clock rescue’ strain. We identified 88 protein coding genes whose expression is at least 3-fold lower in the rpaA ‘clock rescue’ strain than in the control strain, as described in the Materials and methods section. The detailed list of genes, whose expression is abrogated in the rpaA ‘clock rescue’ strain, is presented in Supplementary file 1. (C) A representative photograph of a plate viability assay performed using mutants characterized by Doolittle and Singer (1974) and Scanlan et al. (1995). The deletion mutants of indicated genes involved in alternative sugar metabolism pathways were plated as a dilution series on BG-11 agar and grown in continuous light for 7 days or under light/dark conditions for 14 days. The experiment was performed four independent times.

DOI: http://dx.doi.org/10.7554/eLife.23210.010

Expression of metabolic genes gnd, glgP and zwf measured by RT-qPCR in the kaiBC strain relative to wild type at dusk and during the first two hours of darkness. Each point represents an independent measurement.

DOI: http://dx.doi.org/10.7554/eLife.23210.011

Figure 3—figure supplement 2.

Expression of key metabolic dusk genes in the kaiBC strain.

Expression of metabolic genes gnd, glgP and zwf measured by RT-qPCR in the kaiBC strain relative to wild type at dusk and during the first two hours of darkness. Each point represents an independent measurement.

DOI: http://dx.doi.org/10.7554/eLife.23210.011

Sugar catabolism pathways are abrogated in the rpaA strain.

(A) Temporal expression profiles of genes encoding enzymes involved in sugar metabolism whose expression is abrogated in the rpaA ‘clock rescue’ strain. Relative RNA levels were measured in the light/dark conditions by RNA sequencing. (B) A diagram representing carbon metabolism in S. elongatus PCC7942 in the dark. At night glycogen constitutes the store for energy and carbon skeletons. Glycogen degradation, glycolysis and oxidative pentose phosphate pathways are the key metabolic pathways operating at night. Deletion of operons with genes colored red leads to a strong viability defect specifically in light/dark conditions (Figure 3—figure supplement 1C and Doolittle and Singer 1974; Scanlan et al., 1995). glgP, glycogen phosphorylase; gap1, glyceraldehyde-3-phosphate dehydrogenase; gnd, 6-phosphogluconate dehydrogenase; zwf, glucose-6-phosphate dehydrogenase; opcA, glucose-6-phosphate dehydrogenase assembly protein; fbp, fructose-1,6-bisphosphatase, G6P, glucose-6-phosphate; 6-PGlcA, 6-phosphogluconate; F6P, fructose-6-phosphate; FBP, fructose-1,6-bisphosphate, Ru5-P, ribulose-5-phosphate (C) Enzymatic activities of glycogen phosphorylase, glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase in wild type, the rpaA and negative control strains measured 3 hr after exposure to expected darkness. Error bars represent standard error of the mean of four independent experiments. DOI: http://dx.doi.org/10.7554/eLife.23210.009

Expression of genes encoding enzymes involved in alternative sugar catabolism pathways is defective in the rpaA strain in light/dark cycles.

(A) Comparison of the normalized gene expression in the ‘clock rescue’ and the rpaA ‘clock rescue’ strains 1 hr after exposure to darkness. Circadian genes whose expression peaks at dawn in wild type strain are colored yellow, dusk-peaking genes are blue and non-circadian genes are black. Fold changes are displayed graphically as diagonal lines on the plot. (B) Analysis of the functional annotations of the protein coding genes whose expression is defective in the rpaA ‘clock rescue’ strain. We identified 88 protein coding genes whose expression is at least 3-fold lower in the rpaA ‘clock rescue’ strain than in the control strain, as described in the Materials and methods section. The detailed list of genes, whose expression is abrogated in the rpaA ‘clock rescue’ strain, is presented in Supplementary file 1. (C) A representative photograph of a plate viability assay performed using mutants characterized by Doolittle and Singer (1974) and Scanlan et al. (1995). The deletion mutants of indicated genes involved in alternative sugar metabolism pathways were plated as a dilution series on BG-11 agar and grown in continuous light for 7 days or under light/dark conditions for 14 days. The experiment was performed four independent times. DOI: http://dx.doi.org/10.7554/eLife.23210.010

Expression of key metabolic dusk genes in the kaiBC strain.

Expression of metabolic genes gnd, glgP and zwf measured by RT-qPCR in the kaiBC strain relative to wild type at dusk and during the first two hours of darkness. Each point represents an independent measurement. DOI: http://dx.doi.org/10.7554/eLife.23210.011 Glycogen is a crucial metabolic reserve used as a carbon and energy source during periods of darkness (Smith, 1983). In wild type cyanobacteria glycogen accumulates during the afternoon (Cervený and Nedbal, 2009; Knoop et al., 2010; Rügen et al., 2015) through the activity of a glycogen synthesis pathway composed of phosphoglucomutase (pgm1 and pgm2), ADP-glucose pyrophosphorylase (glgC) and glycogen synthase (glgA) (Figure 4A). To analyze whether the dawn-arrested rpaA strain can accumulate glycogen reserves, we measured expression and activity of the glycogen synthesis enzymes and found that neither the expression levels nor activity of the enzymes in the pathway were significantly reduced in the rpaA strain (Figure 4B and C). Surprisingly, we observed that while glycogen content oscillates over a period of 24 hr in wild type cells both in constant light and in light/dark cycles, glycogen is present at a very low level in the rpaA strain regardless of light conditions, despite high levels of the synthetic enzymes in the extracts (Figure 4D). The same glycogen accumulation defect occurs in the rpaA ‘clock rescue’ strain, demonstrating that it is a direct effect of deletion of rpaA (Figure 4E). Like the rpaA strain, glycogen synthesis mutants (glgA and glgC) exhibit reduced viability in alternating light/dark conditions (Gründel et al., 2012), Figure 4—figure supplement 1A, bottom panel) and in constant darkness (Figure 4—figure supplement 1B), but grow somewhat slower than the rpaA strain in constant light conditions (Figure 4—figure supplement 1A, top panel). We conclude that the deficiency in the preparation of a reserve carbon source – which occurs not at the level of transcription of the glycogen synthesis genes or regulation of the activity of the encoded enzymes – may contribute to the impaired viability of the rpaA strain in the dark.
Figure 4.

The rpaA strain accumulates little glycogen.

(A) A diagram representing carbon metabolism in S. elongatus PCC7942 in light. During the day S. elongatus cells perform photosynthesis to produce carbon skeletons and energy for growth and for preparation of glycogen stores. The glycogen synthesis pathway is comprised of three enzymatic activities: phosphoglucomutase (PGM), ADP-glucose pyrophosphorylase (AGPase) and glycogen synthase (GS). G6P, glucose-6-phosphate; G1P, glucose-1-phosphate; pgm, phosphoglucomutase; glgC, ADP-glucose pyrophosphorylase; glgA, glycogen synthase. (B) Relative expression of genes encoding enzymes in the glycogen synthesis pathway measured by RT-qPCR in the morning and in the afternoon in wild type and the rpaA strains. Error bars represent the standard error of the mean of three independent experiments. (C) Activities of enzymes in the glycogen synthesis pathway in wild type, the rpaA and negative control strains measured during the day (at time = 10 hr). Error bars represent the standard error of the mean of three independent experiments. (D) Glycogen content in wild type and the rpaA strains grown in light/dark and constant light conditions. Points represent the mean of two experiments with error bars displaying the standard error of the mean. (E) Glycogen content in the ‘clock rescue’ and the rpaA ‘clock rescue’ strains grown in light/dark conditions. Points represent the mean of two experiments with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.012

(A) Comparison of growth curves of wild type, the rpaA strain and the deletion mutants deficient in glycogen synthesis (glgA and glgC in constant light (top) and in light/dark cycles (below). Points represent the mean of two experiments with error bars displaying the standard error of the mean. (B) Viability of wild type, the rpaA strain and strains defective in glycogen synthesis after incubation in prolonged darkness. The survival of cells was assessed by a colony forming unit assay. Points represent the mean of two experiments with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.013

Figure 4—figure supplement 1.

Comparison of growth and viability of the rpaA strain and glycogen synthesis mutants.

(A) Comparison of growth curves of wild type, the rpaA strain and the deletion mutants deficient in glycogen synthesis (glgA and glgC in constant light (top) and in light/dark cycles (below). Points represent the mean of two experiments with error bars displaying the standard error of the mean. (B) Viability of wild type, the rpaA strain and strains defective in glycogen synthesis after incubation in prolonged darkness. The survival of cells was assessed by a colony forming unit assay. Points represent the mean of two experiments with error bars displaying the standard error of the mean.

DOI: http://dx.doi.org/10.7554/eLife.23210.013

The rpaA strain accumulates little glycogen.

(A) A diagram representing carbon metabolism in S. elongatus PCC7942 in light. During the day S. elongatus cells perform photosynthesis to produce carbon skeletons and energy for growth and for preparation of glycogen stores. The glycogen synthesis pathway is comprised of three enzymatic activities: phosphoglucomutase (PGM), ADP-glucose pyrophosphorylase (AGPase) and glycogen synthase (GS). G6P, glucose-6-phosphate; G1P, glucose-1-phosphate; pgm, phosphoglucomutase; glgC, ADP-glucose pyrophosphorylase; glgA, glycogen synthase. (B) Relative expression of genes encoding enzymes in the glycogen synthesis pathway measured by RT-qPCR in the morning and in the afternoon in wild type and the rpaA strains. Error bars represent the standard error of the mean of three independent experiments. (C) Activities of enzymes in the glycogen synthesis pathway in wild type, the rpaA and negative control strains measured during the day (at time = 10 hr). Error bars represent the standard error of the mean of three independent experiments. (D) Glycogen content in wild type and the rpaA strains grown in light/dark and constant light conditions. Points represent the mean of two experiments with error bars displaying the standard error of the mean. (E) Glycogen content in the ‘clock rescue’ and the rpaA ‘clock rescue’ strains grown in light/dark conditions. Points represent the mean of two experiments with error bars displaying the standard error of the mean. DOI: http://dx.doi.org/10.7554/eLife.23210.012

Comparison of growth and viability of the rpaA strain and glycogen synthesis mutants.

(A) Comparison of growth curves of wild type, the rpaA strain and the deletion mutants deficient in glycogen synthesis (glgA and glgC in constant light (top) and in light/dark cycles (below). Points represent the mean of two experiments with error bars displaying the standard error of the mean. (B) Viability of wild type, the rpaA strain and strains defective in glycogen synthesis after incubation in prolonged darkness. The survival of cells was assessed by a colony forming unit assay. Points represent the mean of two experiments with error bars displaying the standard error of the mean. DOI: http://dx.doi.org/10.7554/eLife.23210.013 We hypothesized that the inability of the rpaA strain to maintain appropriate energy levels and cell viability in the dark stems from the defects in accumulation of carbon/energy stores during the day and their utilization at night. To assess whether restoration of the correct carbon catabolic route in darkness is sufficient to rescue the energy charge and viability of the rpaA strain in light/dark conditions, we reconstituted the activities of the carbon utilization pathways and provided a transporter for uptake of external carbon. We restored expression of the carbon utilization enzymes in the rpaA strain by placing their expression under an IPTG-inducible ectopic Ptrc promoter, and confirmed that induction with IPTG restored enzyme activity in cell extracts (Figure 5—figure supplement 1). To counterbalance the inability of the rpaA cells to accumulate internal carbon reserves, we expressed the GalP transporter to allow glucose uptake from the medium. Expression of either the missing enzymes or the GalP transporter alone with supplementation of glucose in the rpaA background was not sufficient to restore viability of this strain (Figure 5A and B). However, restoration of the carbon utilization pathways combined with the introduction of the glucose transporter in the presence of glucose rescued the viability defect of the rpaA strain (Figure 5A and B). Glucose feeding does not increase accumulation of internal carbon stores in this engineered strain (Figure 5C), nor in wild type expressing the GalP transporter (Figure 5—figure supplement 2). However, it is sufficient to restore high energy charge in the rpaA strain expressing both the key catabolic enzymes and GalP (Figure 5D). Our results strongly suggest that functional circadian output mediated by the activity of RpaA is required for the anticipatory accumulation of carbon reserves during the day, as well as metabolic switching to carbon catabolism at dusk. These metabolic adaptations allow cells to stimulate energy production and sustain cell viability during periods of darkness that challenge and constrain resources for cyanobacterial growth.
Figure 5—figure supplement 1.

Characterization of strains used for the reconstitution experiments.

Enzyme activities of glycogen phosphorylase, glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase in wild type, the rpaA and the rpaA strains. Strains were incubated in BG-11 with 100 μM IPTG for 12 hr in light and harvested for the assay 3 hr after exposure to darkness. Error bars display the standard error of the mean of two experiments.

DOI: http://dx.doi.org/10.7554/eLife.23210.015

Figure 5.

Restoration of sugar catabolism pathways and glucose feeding rescue the viability defect of the rpaA strain.

(A) Growth curves of the indicated engineered strains in 12 hr light/12 hr dark conditions in BG-11 medium with 100 μM IPTG and with (right) or without (left) 0.4% glucose supplementation. Wild type (top) and the rpaA (below) strains were engineered to express a sugar transporter GalP and/or sugar utilization enzymes using an IPTG-inducible promoter. Points represent the mean of two experiments with error bars displaying the standard error of the mean. (B) Representative cell cultures of the engineered strains photographed at the end of the growth experiment in light/dark conditions with or without 0.4% glucose supplementation. S. elongatus cells are blue-green in color. The darker the color of the culture, the higher is its optical density at 750 nm. (C) Glycogen content in in the rpaA strain ±0.4% glucose in light/dark conditions. Points represent the mean of two experiments with error bars displaying the standard error of the mean. (D) Energy charge measurement in the rpaA strain with or without 0.4% glucose supplementation in light/dark conditions. Points represent the mean of two experiments with error bars displaying the standard error of the mean. Data representing the energy charge in wild type and the rpaA strain are reproduced from Figure 2 to facilitate comparison. (E) A model representing physiological processes in S. elongatus regulated by the activity of the circadian program that contribute to cell fitness. The circadian clock schedules periods of activity of RpaA to coordinate anticipatory carbon reserve formation during the day with carbon utilizing metabolic pathways activated at dusk to fuel cell integrity and viability in an environment in which light and dark periods alternate. Defects present in the rpaA deficient cells, indicated by red symbols on the diagram, lead to a low energy charge and reduced viability during periods of darkness.

DOI: http://dx.doi.org/10.7554/eLife.23210.014

Enzyme activities of glycogen phosphorylase, glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase in wild type, the rpaA and the rpaA strains. Strains were incubated in BG-11 with 100 μM IPTG for 12 hr in light and harvested for the assay 3 hr after exposure to darkness. Error bars display the standard error of the mean of two experiments.

DOI: http://dx.doi.org/10.7554/eLife.23210.015

Glycogen content in wild type +galP strain grown in the presence of 100 μM IPTG with or without supplementation of the medium with 0.4% glucose. Error bars display the standard error of the mean of two independent experiments.

DOI: http://dx.doi.org/10.7554/eLife.23210.016

Figure 5—figure supplement 2.

Glucose supplementation does not increase glycogen accumulation in wild type cells.

Glycogen content in wild type +galP strain grown in the presence of 100 μM IPTG with or without supplementation of the medium with 0.4% glucose. Error bars display the standard error of the mean of two independent experiments.

DOI: http://dx.doi.org/10.7554/eLife.23210.016

Restoration of sugar catabolism pathways and glucose feeding rescue the viability defect of the rpaA strain.

(A) Growth curves of the indicated engineered strains in 12 hr light/12 hr dark conditions in BG-11 medium with 100 μM IPTG and with (right) or without (left) 0.4% glucose supplementation. Wild type (top) and the rpaA (below) strains were engineered to express a sugar transporter GalP and/or sugar utilization enzymes using an IPTG-inducible promoter. Points represent the mean of two experiments with error bars displaying the standard error of the mean. (B) Representative cell cultures of the engineered strains photographed at the end of the growth experiment in light/dark conditions with or without 0.4% glucose supplementation. S. elongatus cells are blue-green in color. The darker the color of the culture, the higher is its optical density at 750 nm. (C) Glycogen content in in the rpaA strain ±0.4% glucose in light/dark conditions. Points represent the mean of two experiments with error bars displaying the standard error of the mean. (D) Energy charge measurement in the rpaA strain with or without 0.4% glucose supplementation in light/dark conditions. Points represent the mean of two experiments with error bars displaying the standard error of the mean. Data representing the energy charge in wild type and the rpaA strain are reproduced from Figure 2 to facilitate comparison. (E) A model representing physiological processes in S. elongatus regulated by the activity of the circadian program that contribute to cell fitness. The circadian clock schedules periods of activity of RpaA to coordinate anticipatory carbon reserve formation during the day with carbon utilizing metabolic pathways activated at dusk to fuel cell integrity and viability in an environment in which light and dark periods alternate. Defects present in the rpaA deficient cells, indicated by red symbols on the diagram, lead to a low energy charge and reduced viability during periods of darkness. DOI: http://dx.doi.org/10.7554/eLife.23210.014

Characterization of strains used for the reconstitution experiments.

Enzyme activities of glycogen phosphorylase, glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase in wild type, the rpaA and the rpaA strains. Strains were incubated in BG-11 with 100 μM IPTG for 12 hr in light and harvested for the assay 3 hr after exposure to darkness. Error bars display the standard error of the mean of two experiments. DOI: http://dx.doi.org/10.7554/eLife.23210.015

Glucose supplementation does not increase glycogen accumulation in wild type cells.

Glycogen content in wild type +galP strain grown in the presence of 100 μM IPTG with or without supplementation of the medium with 0.4% glucose. Error bars display the standard error of the mean of two independent experiments. DOI: http://dx.doi.org/10.7554/eLife.23210.016

Discussion

Daily environmental changes in light availability give rise to periodic demand for metabolism of alternate energy sources in photosynthetic organisms (Doolittle, 1979). To maximize fitness, photosynthetic organisms need to accurately allocate resources by carrying out carbon assimilation during the day and utilizing stored carbohydrate reserves at night (Smith, 1983). Here we show that the phosphorylated form of the transcription factor RpaA, regulated by the circadian clock, is critical for the coordination of carbon anabolism and catabolism and thus cell viability in light/dark cycles. Deletion of rpaA prevents glycogen accumulation in light and renders cells unable to utilize existing glycogen at dusk (Figure 5E) – this leads to alterations in cellular energy charge and, as previously observed, to a severe reduction in fitness. It is yet to be determined whether RpaA is rewiring carbon metabolism solely through transcriptional control or through other mechanisms. The mechanism underlying perturbed carbon accumulation in the rpaA strain is unclear. The activities of glycogen synthesizing enzymes in the rpaA strain are high in vitro, however they could be affected in vivo by the redox state of the cell or by metabolite levels. It is also possible that an RpaA-dependent transcript expressed in the afternoon is required to funnel assimilated carbon into glycogen synthesis. Alternatively, additional metabolic flux changes may occur in the rpaA strain that prevent formation of glycogen stores. Finally, it is formally possible that the rpaA cells perform a futile cycle, simultaneously synthesizing and breaking glycogen down. However, since the activity of the glycogen phosphorylase involved in glycogen degradation is low in the rpaA strain, we find this scenario less likely. Our data support a model in which anticipation of periodic dark-induced resource limitation is one essential role of the cyanobacterial circadian system. The output of the core oscillator, through regulation of RpaA activity, temporally coordinates metabolism to prepare cells for the metabolic demands of periods of darkness. Correct scheduling of central carbon metabolic activities allows cells to survive the night. Recently, Lambert et al. observed that the circadian clock orchestrates a trade-off between rapid cell growth in the morning and robustness to starvation in the afternoon, suggesting preparation for the night as a plausible role for the circadian clock (Lambert et al., 2016). Our findings are consistent with this model and provide novel mechanistic insight into circadian regulation of cyanobacterial energy metabolism. It remains to be investigated whether the circadian-driven preparation for darkness is a shared strategy employed by other photosynthetic organisms. Further, our results suggest a molecular explanation for the observed selective advantage of circadian resonance. When the periods of the endogenous circadian system and periods of the environmental fluctuations are equal, organisms show a fitness advantage and outcompete mutants whose clocks have an altered periodicity in the same environment (Ouyang et al., 1998; Woelfle et al., 2004). The mechanistic basis for this observation has been lacking. Based on our findings, we expect that the fitness defects in the strains with core oscillator periods unequal to the period of environmental variation result from mistiming of RpaA activation. The resultant mistiming of accumulation and mobilization of glycogen stores with the onset of the nightfall would lead to a carbon deficit at night, and impact growth as in the rpaA mutant during dark periods. One role of the KaiABC clock in our model, therefore, is to correctly phase the activity of RpaA and downstream carbon metabolism with the external environment, maximizing fitness and growth. Though we show that RpaA activity is crucial for regulation of key aspects of carbohydrate metabolism, we identify ~90 genes whose expression is abrogated at dusk and throughout darkness in the rpaA strain and it is possible that additional physiological processes are defective in the absence of rpaA. Moreover, although our results indicate that the KaiABC clock is the main regulator of diurnal RpaA phosphorylation, other factors may influence the activity of RpaA or its regulon under fluctuating environmental conditions. RpaA is known to cooperate with RpaB (Espinosa et al., 2015), a transcription factor crucial for responses to high light conditions. CikA, the clock-controlled regulator of RpaA phosphorylation, has been proposed to directly sense redox state of the cell (Ivleva et al., 2006). Finally, additional RpaA regulators, LabA and CikB, have been proposed (Taniguchi et al., 2010; Boyd et al., 2016). Hence, it is possible that in a rapidly changing environment RpaA integrates circadian cues with environmental inputs important for viability. It will be interesting to analyze how deletion of rpaA affects the ability of cells to respond to other environmental challenges that cyanobacteria routinely face. Finally, our data together with a recent study by Diamond and colleagues (Diamond et al., 2015) emphasize the role of the circadian output pathway in driving oscillations in metabolism. On the other hand, it has been demonstrated that metabolic processes provide feedback to the circadian clock by regulating its resetting, indicating an important role of the fluctuating metabolic status of a cell in driving circadian oscillations (Rust et al., 2011; Pattanayak et al., 2014, 2015). Together, a complex bidirectional relationship between the circadian program and metabolism emerges in which the circadian system both controls and is controlled by the metabolic rhythms to set and tune cell physiology with the environmental cycles. This tight coupling between circadian machinery and metabolism is coming to light as a universal feature across kingdoms of life (Green et al., 2008; Dodd et al., 2015).

Materials and methods

Cyanobacterial strains

Wild type Synechococcus elongatus PCC7942 was acquired from ATCC (RRID:SCR_001672) catalog no. 33912. Strains were constructed using standard protocols for genomic integration by homologous recombination (Clerico et al., 2007) and are listed in Supplementary file 2. All plasmids for strain construction were generated using Gibson assembly (Gibson et al., 2009) and verified by Sanger sequencing. All strains were analyzed using colony PCR to verify target integration into the genome. Strains with point mutations introduced in the kaiC or rpaA open reading frames were additionally verified by PCR amplifying and Sanger sequencing of the relevant gene. The rpaA strain was constructed by transforming wild type cells with pΔrpaA(Gmr) that was a gift from Joe Markson. The ‘clock rescue’ strain was constructed following Teng et al. (2013) by replacing the native PkaiBC promoter between base pairs 1240468 and 1240554 on S. elongatus chromosome with a P0050 promoter encompassing 508 base pairs upstream of the translation start of synpcc7942_0050. We used a kanamycin resistance cassette upstream of the promoter as a selection marker. The rpaA ‘clock rescue’ strain was made by transforming pΔrpaA(Gmr) plasmid into the ‘clock rescue’ strain background. The rpaA strain was made by transforming wild type S. elongatus simultaneously with pΔrpaA(Gmr) and an NS1 targeting vector pAM1303 carrying the rpaA gene with its native promoter encompassing 400 base pairs upstream of the translation start. The pAM1303 plasmid was a gift from Susan Golden. The rpaA was created by transforming wild type cells with a pΔrpaA(Gmr) plasmid and an empty NS1 targeting vector pAM1303. The cRpaA ‘clock rescue’ and cRpaA D53A ‘clock rescue’ strains were both made using the ‘clock rescue’ strain background. In these strains the rpaA promoter was changed to a P0050 promoter allowing for continuous expression of RpaA and RpaA D53A. A gentamycin resistance cassette was placed upstream of the P0050 promoter for selection. The D53A mutation was introduced following Markson et al. (2013). The kaiBC strain was constructed by transforming wild type cells with pΔkaiBC(Cmr) that was a gift from Joe Markson. To construct strains expressing phosphomimetic mutants of KaiC we transformed kaiBC cells with an NS1 targeting vector pAM1303 carrying kaiBC S431E T432E, kaiBC S431A T432A or kaiBC expressed from the P0050 promoter allowing for constitutive expression of kaiBC variants. Because RpaA regulates its own expression, we replaced the rpaA promoter with the P0050 promoter free of circadian feedback, ensuring equal and unperturbed expression of RpaA in the KaiC phosphomimetic mutants. The strain lacking the glgP_gap1 (synpcc7942_0244–0245) operon was made using the pBR322 plasmid carrying the kanamycin resistance cassette flanked by 1000 nucleotides of DNA from upstream and downstream of glgP_gap1 locus. In the zwf strain the zwf_fbp_opcA operon (synpcc7942_2333–2335) was replaced with a kanamycin resistance cassette. In the gnd strain the gnd gene (synpcc7942_0039) was replaced with a kanamycin resistance cassette. The strain lacking glgA (synpcc7942_2518) and the strain lacking glgC (synpcc7942_0603) were made by using the pBR322 plasmids carrying the kanamycin resistance cassette flanked by 1000 nucleotides of DNA from upstream and downstream of respectively glgA and glgC locus. The wild type +galP strain was made by transforming wild type cells with Ptrc::galP construct in a modified NS1 targeting vector pAM1303 in which the cassette providing resistance to spectinomycin and streptomycin was replaced with a nourseothricin resistance cassette (Taton et al., 2014). The gene galP was amplified from the E. coli genomic DNA. The wild type +enzymes strain was made by sequentially replacing Pgnd, Pglg_gap1 and Pzwf_fbp_opcA with the Ptrc promoter making expression of gnd, glgP_gap1 and zwf_fbp_opcA transcripts IPTG-inducible. The wild type +enzymes +galP strain was made by transforming the wild type +enzymes strain with Ptrc::galP construct in a modified NS1 targeting vector pAM1303 that carried a nourseothricin resistance cassette. The rpaA, rpaA and rpaA strains were made by transforming pΔrpaA(Gmr) plasmid respectively into wild type +galP, wild type +enzymes and wild type +enzymes +galP strains.

Cell culture

Cell cultures of wild type and mutant cells were grown under illumination with cool fluorescent light at 40 μE m−2 s−1 (μmoles photons m−2 s−1) in BG11 medium at 30°C. For the light/dark experiments, cultures were incubated under alternating 12 hr light/12 hr dark conditions with the same light intensity of 40 μE m−2 s−1 during light periods. For the experiment performed in Figure 1C cells were grown in the presence or in the absence of 20 μM IPTG. For the experiments performed in Figure 5 strains were grown in BG-11 medium with 100 μM IPTG with or without supplementation with 0.4% (w/v) glucose. For the experiments described in Figure 2 and Figure 2—figure supplements 1 and 2, Figure 3, Figure 4, Figure 5—figure supplement 1 and Figure 5—figure supplement 2 wild type or ‘clock rescue’ strains were entrained by exposure to 12 hr of darkness, followed by 12 hr of light, followed by another 12 hr of darkness. The rpaA or rpaA ‘clock rescue’ strains in these experiments were entrained by one pulse of 12 hr of darkness, followed by incubation in light to allow cell growth to resume. For the experiments described in Figure 1E, Figure 1G, Figure 3—figure supplement 2 cells were entrained by two pulses of 12 hr of darkness. For the experiments described in Figure 5C and D the strains were entrained by one pulse of 12 hr of darkness and then incubated in light until the start of the experiment.

Growth and viability assays

For the liquid growth assays, liquid cultures of wild type and mutant cells were pre-grown in continuous light in a medium lacking antibiotics. Cultures were diluted to OD750 = 0.02 and grown either in constant light or in 12 hr light/ 12 hr dark cycling conditions at 30°C. Optical density of cells was monitored at 750 nm. Experiments were performed in duplicate (Figure 1C, Figure 4—figure supplement 1A, Figure 5A and B) or in triplicate (Figure 1A and B). For the spot plate growth assays, liquid cultures of wild type and mutant cells were pre-grown in continuous light in a medium lacking antibiotics. Cells were diluted to OD750 = 0.25 and a dilution series was performed from 100 to 10−4. Then, 10 μl of each dilution step were spotted onto BG11 agar plates with no antibiotics. Plates were incubated in constant light at 30°C for 7 days or under 12 hr light/ 12 hr dark alternating conditions for 14 days. Viability after prolonged dark treatment was assessed by a colony forming unit assay. Light-grown cultures were diluted to OD750 = 0.025, transferred to darkness and sampled every 24 hr. Each aliquot removed from the culture was diluted in BG11 medium 1000 fold by serial dilution. 100 μl of the diluted culture were plated onto a BG11 plate. Plates were incubated for 7 days at 30°C under constant illumination and colonies on each plate were counted. Viability was expressed as: % viability = N/N0 × 100%, where N0 is the colony count before exposure of cultures to darkness. Each experiment was performed in duplicate.

Western blot analysis

Cells were harvested for western blotting by filtration and frozen in liquid nitrogen. To prepare protein samples, cells were resuspended in ice-cold lysis buffer (8 M urea, 20 mM HEPES, pH 8.0 and 1 mM β-mercaptoethanol) and ruptured by bead-beating with 0.1 mm glass beads for total of 5 min with periodic cooling on ice. Cell lysates were centrifuged for 12 min at 20,000 g at 4°C. Protein concentration of each sample was determined by Bradford assay (Bio-Rad). For experiment performed in Figure 1—figure supplement 1E and Figure 1—figure supplement 2 lysates were loaded on 4–20% Tris-Glycine Gel (Novex). Proteins were transferred to a nitrocellulose membrane using a semi-dry transfer apparatus (Bio-Rad). The membrane was blocked in TBST +2.5% milk and then incubated with an affinity-purified rabbit polyclonal antibody against RpaA or against KaiC (Cocalico Biologicals). To quantify phosphorylated RpaA in experiments presented in Figure 1E and Figure 1G, we performed Phos-tag western blots as described in Markson et al. (2013). Quantification of western blots was performed using ImageJ software (RRID:SCR_003070).

Adenine nucleotide analysis

Nucleotides were extracted following the method used by Rust et al. (2011) with modifications. 2 ml of the cyanobacterial culture were added to 0.5 ml of ice-cold 3 M perchloric acid with 77 mM EDTA, vortexed briefly and incubated on ice for 5 min. The mixture was neutralized with 1.34 ml of 1 M KOH, 0.5 M Tris, 0.5 M KCl and then centrifuged at 4000 rpm for 20 min at 4°C. The supernatant was then filtered through Amicon Ultra-4 filters (Millipore) and stored at –80°C. To measure adenine nucleotides, extracts were thawed and diluted 2.6X. For ATP measurement, extracts were diluted in a buffer containing 25 mM KCl, 50 mM MgSO4 and 100 mM HEPES, pH 7.4 (L buffer) with 1 mM phosphoenolpyruvate. To measure ADP + ATP, extracts were diluted in the above buffer containing also 3 U ml−1 type II pyruvate kinase from rabbit muscle (Sigma-Aldrich). To measure AMP + ADP + ATP, extracts were diluted in the L buffer containing 1 mM phosphoenolpyruvate, 3 U ml−1 type II pyruvate kinase from rabbit muscle and 75 U ml−1 myokinase from rabbit muscle (Sigma-Aldrich). Diluted extracts were incubated for 30 min in a 37°C water bath followed by 10 min of heat treatment at 90°C to inactivate enzymes. Extracts were assayed in triplicate in a black 96-well plate. 30 μl of the L buffer containing 35 μg ml−1 firefly luciferase (Sigma-Aldrich) and 1 mM luciferin (Sigma-Aldrich) were added to 260 μl of the extract. The luminescence signal was measured from each well in a TopCount luminescence counter (Perkin-Elmer).

RNA-Seq

For the RNA-sequencing experiment the ‘clock rescue’ and the rpaA ‘clock rescue’ strains were entrained and harvested by filtering and freezing in liquid-nitrogen at following time points: dusk (ZT = 12 hr); 5 min, 15 min, 30 min, 1 hr, 2 hr, 4 hr, 8 hr and 11 hr 50 min after exposure to darkness; and 5 min, 15 min and 30 min after re-exposure to light at dawn. RNA purification and library preparation were performed as described in Markson et al. (2013). NCBI reference sequences NC_007604.1, NC_004073.2, and NC_004990.1 were used to align sequencing reads to the S. elongatus chromosome and the endogenous plasmids with Bowtie (RRID:SCR_005476). Uniquely mappable reads with maximum of three mismatches per read were allowed to map to the genome. To quantify gene expression we counted the number of coding reads between the start and stop positions of open reading frames. We performed RPKM normalization and searched for differentially expressed genes that are at least 3-fold lower in the rpaA ‘clock rescue’ strain than in the control in at least 5 of the 12 measured time points. We performed an analysis of the functional annotations of the protein coding genes whose expression is defective in the rpaA ‘clock rescue’ strain using gene functions available in the Cyanobase (RRID:SCR_007615). The sequencing data reported in this article can be found in the NCBI GEO DataSets (RRID:SCR_005012) under the accession number: GSE89999.

RT-qPCR for gene expression

Following entrainment (two cycles of entrainment for wild type and the kaiBC strain and one cycle for the rpaA strain) equal ODs of wild type, the kaiBC and the rpaA cells were harvested by filtering and freezing in liquid nitrogen. For the experiment described in Figure 3—figure supplement 2 cells were harvested at dusk (ZT = 12 hr) and 5 min, 15 min, 30 min, 1 hr and 2 hr following exposure to darkness. For the experiment described in Figure 4B cells were harvested in the morning (ZT = 3 hr) and in the afternoon (ZT = 9 hr). RNA extraction was performed as above. RT-qPCR was carried out using SYBRGreen PCR Master Mix (Applied Biosystems), Superscipt III Reverse Transcriptase (Invtrogen), and the following primers: The abundance of transcripts was normalized by an external spike-in bub2 transcript from S. cerevisiae. bub2 was in vitro transcribed, added to the RNA AE extraction buffer and extracted together with S. elongatus RNA.

Enzyme activity assays

All enzyme assays were performed using fresh cultures harvested immediately before the assay. Cells were collected by centrifugation. To prepare lysates cells were resuspended in an appropriate assay buffer as described below with Complete EDTA-Free Protease Inhibitors (Roche), transferred to 2 ml screw-cap tubes containing 0.1 mm glass beads (Research Products International Corp) and lysed by ten 30 s long cycles of bead-beating at 4°C with periodic cooling on ice. Protein concentration of each sample was determined by Bradford assay (Bio-Rad). Assays were performed in 96-well plate in the reaction volume of 200 μl. Glycogen phosphorylase activity was assayed in a buffer containing 18 mM KH2PO4, 27 mM Na2HPO4, 15 mM MgCl2 and 100 μM EDTA with 340 μM Na2NADP+, 4 μM glucose-1,6-bisphosphate (Sigma-Aldrich), 0.8 U ml−1phosphoglucomutase (Sigma-Aldrich), 6 U ml−1 glucose-6-phosphate dehydrogenase (Sigma-Aldrich) and 2 mg ml−1 glycogen from bovine liver (Sigma-Aldrich) as substrate (Fu and Xu, 2006). Glucose-6-phosphate dehydrogenase was assayed in 10 mM MgCl2 and 50 mM Tris maleate, pH 7.5 with 2 mM NADP+ and 4 mM glucose-6-phosphate (Sigma-Aldrich) as substrate (Schaeffer and Stanier, 1978). 6-phosphogluconate dehydrogenase was assayed in 10 mM MgCl2 and 50 mM Tris maleate, pH 7.5 with 2 mM NADP+ and 2 mM 6-phosphogluconate (Sigma-Aldrich) as substrate (Schaeffer and Stanier, 1978). Phosphoglucomutase was assayed in 50 mM Tris-HCl, pH 8.0 and 10 mM DTT with 2 mM MgCl2, 10 μM glucose-1,6-bisphosphate, 1 mM NADP+, 0.2 U ml−1 glucose-6-phosphate dehydrogenase and 2 mM glucose-1-phosphate (Sigma-Aldrich) as substrate (Liu et al., 2013). Glycogen synthase was assayed in a three-step reaction following Suzuki et al. (2010). First, ADP was generated from ADP-glucose in a reaction consisting of 50 mM Tris-HCl, pH 8.0, 20 mM DTT, 2 mM ADP-glucose (Sigma-Aldrich), 2 mg ml−1 oyster glycogen (Sigma-Aldrich) as substrate and the cell extract. The reaction was incubated for 20 min at 30°C and then stopped by heat treatment at 100°C for 2 min. Then, ATP was generated from ADP by mixing the solution 3:1 with a buffer containing 50 mM HEPES-NaOH, pH 7.5, 10 mM phosphocreatine (Sigma-Aldrich), 200 mM KCl, 10 mM MgCl2, and 0.5 mg ml−1 creatine phosphokinase (Sigma-Aldrich), and incubated for 30 min at 30°C. The reaction was stopped by heat treatment in a 100°C metal block for 2 min. Finally, the amount of ATP was measured by mixing the solution 3:2 with a buffer comprising of 125 mM HEPES-NaOH, pH 7.5, 10 mM glucose, 20 mM MgCl2, and 1 mM NADP+ and 5 U ml−1 each of hexokinase (Sigma-Aldrich) and glucose-6-phosphate dehydrogenase. All above assays were measured spectrophotometrically by monitoring the increase in absorbance at 340 nm over time using Spectramax i3 plate reader. ADP-glucose pyrophosphorylase was assayed in 50 mM HEPES, pH 8.0, 10 mM MgCl2 with 2 mM ATP, 2 mM 3-phosphoglycerate (Santa Cruz Biotechnology), 1 U ml−1 yeast inorganic pyrophosphatase (Sigma-Aldrich) and 1 mM glucose-1-phosphate (Sigma-Aldrich) as substrate (Díaz-Troya et al., 2014). Production of phosphate was monitored using EnzCheck Assay (Molecular Probes) by reading absorbance at 360 nm over time in Spectramax i3 plate reader. To determine background control assays for each enzymatic activity were performed without addition of the relevant substrate.

Glycogen measurements

Glycogen measurements were performed following Pattanayak et al. (2015) with modifications. Briefly, for each time point 10 ml of cultures were collected by filtering and freezing in liquid nitrogen. Cells were resuspended from the filter in 1 ml ice-cold methanol. Filters were discarded and cells were centrifuged at 14000 rpm for 7 min. The chlorophyll content was determined spectrophotometrically at 665 nm using the equation CChl = A665×13.9 μg ml−1 (de Marsac and Houmard, 1988). Glycogen content was normalized by chlorophyll content in each sample. The pellets were resuspended in 300 μl of 40% KOH and incubated for 90 min at 95°C. 200 proof ethanol was added to each extract and extracts were incubated at −20°C overnight. Samples were centrifuged at 14000 rpm for 1 hr at 4°C, the supernatants were discarded and the pellets were washed twice with ice-cold ethanol. The pellets were resuspended in 100 μl of 2 N HCL and placed in a 95°C heat block for 30 min to break glycogen down. Samples were neutralized with 100 μl of 2 N NaOH and 50 μl of 1 M phosphate buffer, pH 7. Glycogen content was then assayed enzymatically using glucose hexokinase assay (Sigma-Aldrich) in 96-well plate at 340 nm in the Spectramax i3 plate reader. Glycogen from bovine liver (Sigma-Aldrich) was used to generate a standard curve. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "Switching of metabolic programs in response to light availability is an essential role of cyanobacterial circadian clock" for consideration by eLife. Your article has been favorably evaluated by Naama Barkai (Senior Editor) and three reviewers, one of whom, Michael Laub, is a member of our Board of Reviewing Editors. The following individuals involved in review of your submission have agreed to reveal their identity: Michael J Rust (Reviewer #2); Andy LiWang (Reviewer #3). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Summary: The reviewers and editor all agreed that this paper presents an important advance in the study of cyanobacterial circadian rhythms. Of the many genes and pathways that are circadian regulated, it has been unclear which are required for viability in conditions of cycling light and dark. These authors have now nicely pinpointed glycogen storage and carbon metabolism as a critical target. The reviewers and editor discussed the manuscript and have only a few issues that should be addressed in a revised version of the manuscript, summarized below. Essential revisions: The presentation in the title and abstract focuses largely on clock regulation of metabolism and a general audience that skims the paper might come away with the impression that the study shows an essential function for the clock in LD cycles. The authors show that the transcription factor RpaA is essential in light-dark cycles and have carried out a thorough analysis of its essential role. But it is important to logically separate the essential need for phosphorylated RpaA from the clock control of RpaA phosphorylation. There may well be other, clock-independent factors that influence RpaA activity or the RpaA regulon (e.g. direct redox sensing, a role for RpaB, the histidine kinase CikB recently described by the Golden lab), and it may be that the loss of these other inputs is more important for viability than the circadian clock per se. It is worth noting along these lines that kai gene mutants typically have much less severe phenotypes than rpaA-null. Also, the original screen by Ashby & Mullineaux identified rpaA (regulator of phycobilisome association) not through a defect in cycling conditions, but as a mutant with constitutively abnormal photosynthetic properties. So, I think the Discussion should be tempered along these lines. The following three experimental suggestions may be worth considering to resolve the above two points, though they are not strictly required for a revised manuscript to be reconsidered: 1) Does the RpaD53E phosphomimic previously reported by this lab show growth defects (presumably this mutant lacks both clock control of transcription and any other hypothetical control of RpaA by histidine kinases/phosphatases)? 2) Does the rpaA-dependent induction of key metabolic genes such as glgP and gap1 in the hours immediately following lights-off still occur in a clock-null strain? That is, is a signal from the clock needed to express metabolic genes at dusk? 3) Determine whether the phosphorylation status of RpaA changes during light-dark cycles in a kai-null mutant. The mechanism by which RpaA regulates glycogen metabolism remains mysterious, because 1) levels and activities of glycogen-synthetic enzymes in rpaA- strains were commensurate to those in wild type cyanobacteria, and 2) in rpaA- strains with IPTG-inducible enzymes and the ability to import exogenous glucose, glycogen stores remained low even with high cellular energy charge. Perhaps rpaA- cells breakdown glycogen too rapidly? Ideally the authors would experimentally address this possibility and other alternatives that would provide a mechanistic understanding of the observations reported. At a minimum, the authors should discuss these alternatives in the paper. Essential revisions: The presentation in the title and abstract focuses largely on clock regulation of metabolism and a general audience that skims the paper might come away with the impression that the study shows an essential function for the clock in LD cycles. The authors show that the transcription factor RpaA is essential in light-dark cycles and have carried out a thorough analysis of its essential role. But it is important to logically separate the essential need for phosphorylated RpaA from the clock control of RpaA phosphorylation. There may well be other, clock-independent factors that influence RpaA activity or the RpaA regulon (e.g. direct redox sensing, a role for RpaB, the histidine kinase CikB recently described by the Golden lab), and it may be that the loss of these other inputs is more important for viability than the circadian clock per se. It is worth noting along these lines that kai gene mutants typically have much less severe phenotypes than rpaA-null. Also, the original screen by Ashby & Mullineaux identified rpaA (regulator of phycobilisome association) not through a defect in cycling conditions, but as a mutant with constitutively abnormal photosynthetic properties. So, I think the Discussion should be tempered along these lines. The following three experimental suggestions may be worth considering to resolve the above two points, though they are not strictly required for a revised manuscript to be reconsidered: 1) Does the RpaD53E phosphomimic previously reported by this lab show growth defects (presumably this mutant lacks both clock control of transcription and any other hypothetical control of RpaA by histidine kinases/phosphatases)? We thank the reviewers for bringing to our attention this logical incoherence. Based on the results of our new experiments, we propose that the phosphorylated species of RpaA is crucial for surviving light/dark cycles, and that main regulation of the phosphorylation state of RpaA in light/dark cycling conditions is clock-phosphorylation dependent. We conclude that any additional non-circadian pathways that may modulate RpaA activity (and, by extension, cell viability) do not play a significant role under these conditions. We first investigated which phosphorylated form of RpaA was important for surviving light/dark conditions and find that RpaA D53E, mimicking the phosphorylated state, is sufficient to rescue growth, whereas RpaA D53A that mimics the unphosphorylated state, is not (Figure 1C). While this result confirms the key role of RpaA phosphorylation for cell viability under light/dark conditions, it does not dissect the contributions of the core clock and the potential non-circadian factors to regulation of RpaA activity. To address this issue, we analyzed RpaA phosphorylation and cell viability in mutants expressing phosphomimetic variants of KaiC, KaiC-AA (KaiC S431A T432A) and KaiC-EE (KaiC S431E T432E), corresponding to the unphosphorylated and the hyperphosphorylated states of KaiC, respectively (Figure 1F and G). We hypothesized that these KaiC variants would have different effects on the activity of the downstream histidine kinases, CikA and SasA and, hence, on RpaA phosphorylation. To ensure unperturbed expression of KaiC phosphomimetics, we replaced the kaiBC promoter with an RpaA-independent promoter. We observed that the cKaiC-AA strain (subscript “c” denoting constitutive, RpaA-independent expression), which exhibits an elevated RpaA phosphorylation level, is able to grow in light/dark conditions whereas the cKaiC-EE strain, in which RpaA phosphorylation is low, is inviable in these conditions. Assuming that the alternative factors influencing RpaA activity (direct redox sensing, RpaB, CikB) act independently of the clock and that their function is unaffected by point mutations in KaiC, this result suggests that regulation of RpaA phosphorylation state in diurnal conditions is dependent on the clock phosphorylation state. While we propose that circadian control of RpaA activity fully accounts for the loss of fitness of the rpaAstrain in the light/dark conditions we studied, it is possible that alternative regulators of RpaA (direct redox sensing, RpaB, CikB) play a significant role in preserving cell viability under other conditions. For example, it is possible that in an environment in which light intensity fluctuates during the day, the hypothetical ability of RpaA to integrate environmental signals through the action of additional factors is key for cell fitness. We have added this point to our Discussion. 2) Does the rpaA-dependent induction of key metabolic genes such as glgP and gap1 in the hours immediately following lights-off still occur in a clock-null strain? That is, is a signal from the clock needed to express metabolic genes at dusk? We measured expression of the key metabolic genes in the kaiBCstrain (Figure 3—figure supplement 2) and we observe that they are expressed at a similar level in wild type cells and in the kaiBCstrain. In the kaiBCstrain, RpaA phosphorylation is maintained at a high level throughout the light/dark cycle allowing for expression of dusk-specific genes in this strain. Interestingly, Hosokawa et al. demonstrated that expression profiles of a small subset of dark-induced genes are changed in the kaiBCstrain compared to wild type during darkness (Hosokawa et al., 2011). These changes may be due to the fact that in the kaiBCstrain RpaA phosphorylation state is kept at a constant level lacking diurnal dynamics, and is also somewhat lower than the maximum level of RpaA phosphorylation observed in wild type. 3) Determine whether the phosphorylation status of RpaA changes during light-dark cycles in a kai-null mutant. Complexes of KaiB and KaiC are required in vitro to stimulate the phosphatase activity of CikA (Gutu and O’Shea, 2013). Therefore, we expected that the kaiBCstrain grown in light/dark conditions would maintain RpaA phosphorylation at an elevated level due to the loss of stimulation of CikA activity by KaiB-KaiC complexes. We performed Phos-tag westerns in the kaiBCstrain and we indeed observed that RpaA phosphorylation remains high and constant throughout the light/dark cycle (Figure 1E). The presence of high levels of phosphorylated RpaA in the kaiBC strain provides an explanation for this strain’s lack of a significant growth defect in light/dark conditions. This result and our observation that the phosphomimetic version of RpaA (RpaA D53E) can complement the viability defect of the rpaAstrain are consistent with the model that phosphorylated RpaA is the species of RpaA required to survive light/dark cycles. The mechanism by which RpaA regulates glycogen metabolism remains mysterious, because 1) levels and activities of glycogen-synthetic enzymes in rpaA- strains were commensurate to those in wild type cyanobacteria, and 2) in rpaA- strains with IPTG-inducible enzymes and the ability to import exogenous glucose, glycogen stores remained low even with high cellular energy charge. Perhaps rpaA We thank the reviewers for this suggestion and we have included it in our Discussion. While we agree that it is formally possible that the rpaAcells perform a futile cycle synthesizing and degrading glycogen simultaneously, we think that this scenario is not likely given that the expression level and activity of glycogen phosphorylase required for glycogen breakdown are very low in the rpaAstrain. Additionally, we analyzed the expression of glycogen debranching enzymes present in S. elongatus (synpcc7942_0086 and synpcc7942_1575) using our RNA-seq expression data, and we found that expression of each of them is lower in the rpaA‘clock rescue’ strain than in the control (data not shown). We propose that the ability to degrade glycogen is defective in the rpaAstrain. Since glucose supplementation does not increase glycogen stores in wild type cells expressing GalP (we added the data as Figure 5—figure supplement 2), we did not expect glucose treatment to increase glycogen synthesis in the rpaAstrains with IPTG-inducible enzymes and the ability to import exogenous glucose. Instead, we believe that supplementation with glucose provides an external carbon source supplanting the need for formation of internal carbon stores in the form of glycogen.
TargetPrimer sequences
gndF: TAGGTGAACTGGCGCGGATT
R: GGGTGCCAGCAACAGATTCG
glgPF: TGATAGTCCGCCATCAACAT
R: GATCGCTTTAGCAGTGGTCA
zwfF: CACCGCAGACAAACTGAGAT
R: TGACGGTATCCGTAACGAAA
pgm1 (synpcc7942_0156)F: CTCGATCGACTCGGTAGTCA
R: AATGCGATCGAAGTCAAACA
pgm2 (synpcc7942_1268)F: GCAGCTGATTTCACCTTTGA
R: TGCTGGCAAATTCTTCTGAC
glgAF: TAATCACTTCGCGGTTTACG
R: GCCAGTCTTCGTCTTCTCCT
glgCF: AATTGCATCAACGCTGACAT
R: CTAGCACCTCAACAAAGCCA
bub2 (S. cerevisiae)F: CCTTCCACAACCATTTACCA
R: AAGCAAAGCACGACAGACAC
  40 in total

1.  A sequential program of dual phosphorylation of KaiC as a basis for circadian rhythm in cyanobacteria.

Authors:  Taeko Nishiwaki; Yoshinori Satomi; Yohko Kitayama; Kazuki Terauchi; Reiko Kiyohara; Toshifumi Takao; Takao Kondo
Journal:  EMBO J       Date:  2007-08-23       Impact factor: 11.598

2.  Oscillations in supercoiling drive circadian gene expression in cyanobacteria.

Authors:  Vikram Vijayan; Rick Zuzow; Erin K O'Shea
Journal:  Proc Natl Acad Sci U S A       Date:  2009-12-14       Impact factor: 11.205

3.  Redox regulation of glycogen biosynthesis in the cyanobacterium Synechocystis sp. PCC 6803: analysis of the AGP and glycogen synthases.

Authors:  Sandra Díaz-Troya; Luis López-Maury; Ana María Sánchez-Riego; Miguel Roldán; Francisco J Florencio
Journal:  Mol Plant       Date:  2013-10-11       Impact factor: 13.164

4.  Resonating circadian clocks enhance fitness in cyanobacteria.

Authors:  Y Ouyang; C R Andersson; T Kondo; S S Golden; C H Johnson
Journal:  Proc Natl Acad Sci U S A       Date:  1998-07-21       Impact factor: 11.205

5.  Three major output pathways from the KaiABC-based oscillator cooperate to generate robust circadian kaiBC expression in cyanobacteria.

Authors:  Yasuhito Taniguchi; Naoki Takai; Mitsunori Katayama; Takao Kondo; Tokitaka Oyama
Journal:  Proc Natl Acad Sci U S A       Date:  2010-01-28       Impact factor: 11.205

6.  Two antagonistic clock-regulated histidine kinases time the activation of circadian gene expression.

Authors:  Andrian Gutu; Erin K O'Shea
Journal:  Mol Cell       Date:  2013-03-28       Impact factor: 17.970

7.  Mutational analysis of dark endogenous metabolism in the blue-green bacterium Anacystis nidulans.

Authors:  W F Doolittle; R A Singer
Journal:  J Bacteriol       Date:  1974-09       Impact factor: 3.490

8.  Quinone sensing by the circadian input kinase of the cyanobacterial circadian clock.

Authors:  Natalia B Ivleva; Tiyu Gao; Andy C LiWang; Susan S Golden
Journal:  Proc Natl Acad Sci U S A       Date:  2006-11-06       Impact factor: 11.205

9.  Interactions between circadian clocks and photosynthesis for the temporal and spatial coordination of metabolism.

Authors:  Antony N Dodd; Fiona E Belbin; Alexander Frank; Alex A R Webb
Journal:  Front Plant Sci       Date:  2015-04-09       Impact factor: 5.753

10.  Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria.

Authors:  Arnaud Taton; Federico Unglaub; Nicole E Wright; Wei Yue Zeng; Javier Paz-Yepes; Bianca Brahamsha; Brian Palenik; Todd C Peterson; Farzad Haerizadeh; Susan S Golden; James W Golden
Journal:  Nucleic Acids Res       Date:  2014-07-29       Impact factor: 16.971

View more
  10 in total

1.  Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973.

Authors:  Justin Ungerer; Kristen E Wendt; John I Hendry; Costas D Maranas; Himadri B Pakrasi
Journal:  Proc Natl Acad Sci U S A       Date:  2018-11-08       Impact factor: 11.205

2.  Genome-wide fitness assessment during diurnal growth reveals an expanded role of the cyanobacterial circadian clock protein KaiA.

Authors:  David G Welkie; Benjamin E Rubin; Yong-Gang Chang; Spencer Diamond; Scott A Rifkin; Andy LiWang; Susan S Golden
Journal:  Proc Natl Acad Sci U S A       Date:  2018-07-10       Impact factor: 11.205

3.  Natural changes in light interact with circadian regulation at promoters to control gene expression in cyanobacteria.

Authors:  Joseph Robert Piechura; Kapil Amarnath; Erin K O'Shea
Journal:  Elife       Date:  2017-12-14       Impact factor: 8.140

4.  Glycogen Metabolism Supports Photosynthesis Start through the Oxidative Pentose Phosphate Pathway in Cyanobacteria.

Authors:  Shrameeta Shinde; Xiaohui Zhang; Sonali P Singapuri; Isha Kalra; Xianhua Liu; Rachael M Morgan-Kiss; Xin Wang
Journal:  Plant Physiol       Date:  2019-10-24       Impact factor: 8.340

5.  Single molecules can operate as primitive biological sensors, switches and oscillators.

Authors:  Rosa D Hernansaiz-Ballesteros; Luca Cardelli; Attila Csikász-Nagy
Journal:  BMC Syst Biol       Date:  2018-06-18

Review 6.  The Circadian Clock-A Molecular Tool for Survival in Cyanobacteria.

Authors:  Pyonghwa Kim; Manpreet Kaur; Hye-In Jang; Yong-Ick Kim
Journal:  Life (Basel)       Date:  2020-12-20

7.  Involvement of glycogen metabolism in circadian control of UV resistance in cyanobacteria.

Authors:  Koji Kawasaki; Hideo Iwasaki
Journal:  PLoS Genet       Date:  2020-11-30       Impact factor: 5.917

8.  The Dark Side of Microbial Processes: Accumulation of Nitrate During Storage of Surface Water in the Dark and the Underlying Mechanism.

Authors:  Amit Kumar; Daphne H P Ng; Sakcham Bairoliya; Bin Cao
Journal:  Microbiol Spectr       Date:  2022-01-05

9.  Generation of miniploid cells and improved natural transformation procedure for a model cyanobacterium Synechococcus elongatus PCC 7942.

Authors:  Sadaf Riaz; Ying Jiang; Meng Xiao; Dawei You; Anna Klepacz-Smółka; Faiz Rasul; Maurycy Daroch
Journal:  Front Microbiol       Date:  2022-07-26       Impact factor: 6.064

10.  High-throughput interaction screens illuminate the role of c-di-AMP in cyanobacterial nighttime survival.

Authors:  Benjamin E Rubin; TuAnh Ngoc Huynh; David G Welkie; Spencer Diamond; Ryan Simkovsky; Emily C Pierce; Arnaud Taton; Laura C Lowe; Jenny J Lee; Scott A Rifkin; Joshua J Woodward; Susan S Golden
Journal:  PLoS Genet       Date:  2018-04-02       Impact factor: 5.917

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.