| Literature DB >> 28413436 |
Amr Mohamed Mohamed1,2, Mona Abdelfattah Ahmed3,4, Sabah Abdelghany Ahmed4, Sherif Ahmed Al-Semany5,6, Saad Saed Alghamdi1, Dina Abdulla Zaglool7,8.
Abstract
BACKGROUND: Blastocystis, a genetically diverse intestinal parasite with controversial pathogenic potential, has increasingly been incriminated for diarrheal illness in immunocompromised individuals including colorectal cancer (CRC) patients. The aim of the current study was to assess the possible association between Blastocystis infection and CRC condition in Makkah, Saudi Arabia (KSA).Entities:
Keywords: Association risk; Blastocystis hominis; CRC; Genetic diversity; Subtypes-I
Year: 2017 PMID: 28413436 PMCID: PMC5389010 DOI: 10.1186/s13027-017-0131-z
Source DB: PubMed Journal: Infect Agent Cancer ISSN: 1750-9378 Impact factor: 2.965
Different STS primer sets used for differential identification of Blastocystis subtypes along with expected amplified product sizes
| STS primer set | GenBank accession no. | Sequences | Product size | Subtype |
|---|---|---|---|---|
| SB83 | AF166086 | F-GAAGGACTCTCTGACGATGA | 351 | I |
| SB155 | AF166087 | F-ATCAGCCTACAATCTCCTC | 650 | II |
| SB227 | AF166088 | F-ATCAGCCTACAATCTCCTC | 526 | III |
| SB332 | AF166091 | FGCATCCAGACTACTATCAACATT | 338 | IV |
| SB340 | AY048752 | F-TGTTCTTGTGTCTTCTCAGCTC | 704 | V |
| SB336 | AY048751 | F-GTGGGTAGAGGAAGGAAAACA | 317 | VI |
| SB337 | AY048750 | F-GTCTTTCCCTGTCTATTCTGCA | 487 | VII |
Fig. 1Representative 1% agarose gel showing the amplification of the Blastocystis-specific 1.1 kbp target of the SSU of rRNA gene. (Lane L) shows 100 bp DNA ladder; (Lane 1) represents negative control; (Lanes 2,3,4,5,7,8,9,11and 14) represent positive results for Blastocystis; (Lanes 6,10,12 and 13) represent negative results for Blastocystis
Frequency of Blastocystis infection among CP including CRC and COGT groups as well as NC group of investigated patients
| Investigated groups (no.) | Blastocystis infection | ||||
|---|---|---|---|---|---|
| Positive cases | Negative cases | ||||
| CP (138) | CRC (74) | 38 (27.5) | 22 (29.7)b | 100 (72.5) | 52 (70.3) |
| COGT (64) | 16 (25) | 48 (75) | |||
| NC (80) | 12 (15) | 68 (85) | |||
| Total (218) | 50 (22.9) | 168 (77.1) | |||
Cancer patients (CP); Colorectal cancer (CRC); COGT (Cancer outside gastrointestinal tract); Non cancer (NC)
Blastocystis infection in overall cancer group as compared to NC group (P = 0.044)
Blastocystis infection in CRC group as compared to NC group (P = 0.033)
Fig. 2Representative 1% agarose gel showing Blastocystis grouping based on RFLP-PCR of the Blastocystis-specific 1.1 kbp target of the SSU of rRNA gene. (Lane L) shows 1 Kbp. DNA ladder; (Lane 1) shows undigested 1.1 kbp target of Blastocystis. (Lanes 2–5) show 230 bp, 430 bp and 450 bp digestion products corresponding to Blastocystis group A. (Lanes 6 and 7) show 470 bp and 640 bp digestion products corresponding to Blastocystis group C
Fig. 3Representative 1% agarose gel showing Blastocystis subtyping based on PCR-STS analysis. (Lane L) shows 100 bp DNA ladder; (Lane 1) represents negative control. (Lanes 2,5,8 and 12) show 704 bp PCR products and represent Blastocystis subtype-V. (Lanes 3,4,7,11 and 13) show 351 bp PCR products and represent Blastocystis subtype-I. (Lanes 6,9 and 10) show 650 bp PCR products and represent Blastocystis subtype-II
Frequency of different Blastocystis subtypes isolated from CP including CRC and COGT groups and NC group of investigated patients
| Investigated groups (n) | Recovered subtypes of Blastocystis | ||||||
|---|---|---|---|---|---|---|---|
| I | II | V | |||||
| CP (38) | CRC (22) | 17 (44.7) | 12 (54.5) | 13 (34.2) | 6 (27.3) | 8 (21.1) | 4 (18.2) |
| COGT (16) | 5 (31.3) | 7 (43.7) | 4 (25) | ||||
| NC (12) | 2 (16.7) | 7 (58.3) | 3 (25) | ||||
| Total (50) | 19 (38) | 20 (40) | 11 (22) | ||||
Cancer patients (CP); Colorectal cancer (CRC); COGT (Cancer outside gastrointestinal tract); Non cancer (NC)
subtype I in CP group against subtype I in NC group (P = 0.013)
subtype I in CRC group against subtype I in NC group (P = 0.004)
subtype I in CRC group against subtype I in COGT group (P = 0.024)
subtype I in CRC group against subtype II in the same group (P = 0.019)
subtype I in CRC group against subtype V in the same group (P = 0.018)