Literature DB >> 28396568

Tollip Deficiency Alters Atherosclerosis and Steatosis by Disrupting Lipophagy.

Keqiang Chen1, Ruoxi Yuan1, Yao Zhang1, Shuo Geng1, Liwu Li2.   

Abstract

BACKGROUND: Compromised lipophagy with unknown mechanisms may be critically involved in the intracellular accumulation of lipids, contributing to elevated atherosclerosis and liver steatosis. We hypothesize that toll-interacting protein (Tollip), a key innate immune molecule involved in the fusion of autolysosome, may play a significant role in lipophagy and modulate lipid accumulation during the pathogenesis of atherosclerosis and liver steatosis. METHODS AND
RESULTS: By comparing mice fed with either a Western high-fat diet or a regular chow diet, we observed that both atherosclerosis and liver steatosis were aggravated in apolipoprotein E-deficient (ApoE-/-)/Tollip-/- mice as compared with ApoE-/- mice. Through electron microscopy analyses, we observed compromised fusion of lipid droplets with lysosomes within aortic macrophages as well as liver hepatocytes from ApoE-/-/Tollip-/- mice as compared with ApoE-/- mice. As a molecular indicator for disrupted lysosome fusion, the levels of p62 were significantly elevated in aortic and liver tissues from ApoE-/-/Tollip-/- mice. Molecules involved in facilitating lipophagy completion such as Ras-related protein 7 and gamma-aminobutyric acid receptor-associated protein were reduced in ApoE-/-/Tollip-/- mice as compared with ApoE-/- mice. Intriguingly, ApoE-/-/Tollip-/- mice had reduced circulating levels of inflammatory cytokines such as tumor necrosis factor-α and increased levels of transforming growth factor-β. The reduced inflammation due to Tollip deficiency is consistent with a stable atherosclerotic plaque phenotype with increased levels of plaque collagen and smooth muscle cells in ApoE-/-/Tollip-/- mice.
CONCLUSIONS: Tollip deficiency selectively leads to enlarged yet stable atherosclerotic plaques, increased circulating lipids, liver steatosis, and reduced inflammation. Compromised lipophagy and reduced expression of inflammatory mediators due to Tollip deficiency may be the underlying causes. Our data suggest that lipid accumulation and inflammation may be intertwined yet independent processes during the progression of atherosclerosis and steatosis.
© 2017 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

Entities:  

Keywords:  Tollip; animal model cardiovascular disease; atherosclerosis; hyperlipidemia; inflammation; lipophagy

Mesh:

Substances:

Year:  2017        PMID: 28396568      PMCID: PMC5532987          DOI: 10.1161/JAHA.116.004078

Source DB:  PubMed          Journal:  J Am Heart Assoc        ISSN: 2047-9980            Impact factor:   5.501


Introduction

Atherosclerosis and hepatic steatosis are closely associated chronic diseases with significant health concerns worldwide.1 Recent studies suggest that defective clearance of cellular lipids within tissues due to a compromised lipophagy pathway may play a highly important role for the development of liver steatosis and atherosclerosis.2 Through effective lipophagy, triglyceride (TG) and cholesterol are taken up by autophagosomes and delivered to lysosomes for degradation.2, 3 Free fatty acids generated by lipophagy from TG degradation fuel cellular respiration through mitochondrial β‐oxidation. Lipophagy therefore functions to modulate intracellular lipid storage, cellular levels of free lipids, and energy homeostasis. Intracellular lipids themselves may regulate autophagy by unclear mechanisms. Impaired lipophagy may lead to excessive tissue lipid accumulation such as hepatic steatosis and atherosclerosis.2, 4 However, cellular and molecular mechanisms responsible for the modulation of lipophagy are not well understood. Toll‐interacting protein (Tollip) is a unique signaling protein involved in the modulation of innate immunity and inflammatory processes.5 Tollip contains a protein kinase C conserved region 2 domain in the central region that serves to anchor Tollip to endosomes and lysosomes.6, 7 Tollip also contains a coupling of ubiquitin to endoplasmic reticulum degradation domain in the C terminus and functions as an interaction motif for ubiquitinated proteins.8 The N terminus of Tollip contains a Tom1‐binding domain involved in the interaction with Tom1,9 through which Tollip may recruit clathrin onto the sorting endosomes. Potentially through its protein kinase C conserved region 2 domain, Tollip is required for the proper fusion of lysosome with autophagosome.7, 10 The involvements of Tollip during inflammatory processes are complex and highly context dependent. Under acute and strong inflammatory stress, Tollip may impair nuclear factor κB (NFκB) and serves to dampen excessive inflammatory reactions.11, 12 On the other hand, upon chronic low‐grade inflammatory challenges where NFκB may not be potently induced, Tollip can serve as a positive regulator of low‐grade inflammation through the induction of mitochondria reactive oxygen species.13 However, the potential role of Tollip in the process of lipophagy has not been explored. Based on these studies, we hereby tested the hypothesis that Tollip may be critically involved in the process of lipophagy, and the lack of Tollip may compromise the proper clearance of intracellular lipids, thus contributing to the formation of lipid‐laden cells in vital tissues and the development of steatosis and atherosclerosis. Employing the animal models of apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice, we examined the pathologies of liver steatosis and atherosclerosis as well as the underlying mechanisms.

Materials and Methods

Mice

ApoE−/− and ApoE−/−/Tollip−/− mice were bred and maintained in the animal facility at Virginia Tech with the approved Institutional Animal Care and Use Committee protocol. Male mice were 8 to 9 weeks of age when the experiments were initiated. Mice were fed with either a normal diet (chow) or a Western high‐fat diet (HFD; Harlan Teklad 88137) for 8 weeks. Mice were properly anesthetized and euthanized in accordance with the approved animal protocol before tissue harvest and analyses.

Regents

The HFD was purchased from Harlan Laboratories, Inc (Dublin, VA). OilRed‐O staining kit was from Newcomer Supply (Middleton, WI). Trichrome Stain (Masson) Kit and Cholesterol Quantitation Kit were from Sigma‐Aldrich (Louis, MO). Triglyceride Quantification Colorimetric/Fluorometric Kit and Alanine Aminotransferase (ALT or SGPT) Activity Colorimetric/Fluorometric Assay Kit were from BioVision Incorporated (Milpitas, CA). Mouse LIPA/Lysosomal Acid Lipase Sandwich ELISA Kit was purchased from LSBio Lifespan BioSciences, Inc (Seattle, WA). Mouse tumor necrosis factor‐α (TNF‐α) ELISA Kit, interleukin (IL)–6 ELISA, IL‐1 beta ELISA Kit, MCPT‐1 (mMCP‐1) ELISA Kit, and human/mouse transforming growth factor‐β (TGF‐β) 1 ELISA Kit were purchased from eBioscience (San Diego, CA). Anti‐mouse alpha smooth muscle actin (MSC), anti‐mouse F4/80 and anti‐SQSTM1/62 antibodies were from Abcam (Cambridge, MA). The anti‐mouse Ly6G, anti‐mouse Ly6C, anti‐mouse CD11b, anti‐mouse C‐X‐C motif chemokine receptor 2, and anti‐mouse TNF‐α were from BioLegend (San Diego, CA). Anti‐mouse IL12p40 and anti‐mouse Gr‐1 antibody was from eBioscience (San Diego, CA).

Histology

Parts of liver tissues were fixed in neutrally buffered formalin (10%) and embedded in paraffin. Paraffin‐embedded tissues were sectioned (5 μm) and stained with hematoxylin and eosin. Parts of liver tissues and aorta roots were performed on freshly frozen, optimal cutting temperature compound–embedded tissues of liver and aorta and used for generating frozen sections (10 μm). Slides were fixed in 4% neutral buffered formalin for 5 minutes. For immunohistology, frozen, optimal cutting temperature compound–embedded proximal aortic sections were fixed in 4% neutrally buffered formalin for 5 minutes and stained with Masson staining according to the manufacture's instruction. For smooth muscle cell staining, the sections were stained with an anti‐SMC Ab followed by a biotinylated anti‐Ig secondary Ab and streptavidin‐HRP/DAB with hematoxylin counter staining.

Immunofluorescence

Immunofluorescence analyses were performed on freshly frozen, optimal cutting temperature compound–embedded tissues. Slides were fixed in 4% neutrally buffered formalin for 5 minutes, and subsequently stained with anti‐mouse primary antibodies (anti mouse Gr‐1, F4/80, P62 antibodies) followed by a biotinylated anti‐Ig secondary antibody and Streptavidin‐PE or fluorescein isothiocyanate. DAPI was used to stain the nucleus.

Transmission Electron Microscopy

Tissues (1 mm3) were fixed in 2.5% glutaraldehyde in 100 mmol/L sodium cacodylate, pH7.4, and postfixed in 1% osmium tetroxide followed by 1% uranyl acetate. After ethanol dehydration, the tissues were embedded in LX112 resin (LADD Research Industries). Ultrathin sections were stained with uranyl acetate followed by lead citrate. All grids were viewed on a JEOL 100CX II transmission electron microscope at 80 kV.

ELISA of Cytokines and Chemokines

The levels of plasma TNF‐α, IL‐6, IL‐1β, TGF‐β, and C‐C motif chemokine ligand 2 were determined with ELISA Kit according to the manufacturer's instruction.

Flow Cytometry

Splenic cells were separated as previously described.14 Briefly, single‐cell suspensions were prepared from spleens. Prior to intracellular staining for cytokines, cells were cultured in vitro for 4 hours in RPMI‐completed medium with GolgiStop (BD Biosciences, San Jose, CA). Then, cells were fixed after surface marker staining, permeabilized, and stained with anti–TNF‐α and anti–IL‐12, according to the manufacturer's instructions (BD Biosciences). Samples were analyzed with a FACSCanto II (BD Biosciences). Fluorescence‐activated cell sorter plots shown were analyzed with FlowJo (Ashland, OR).

Real‐Time Polymerase Chain Reaction

RNA was extracted using RNeasy Mini Kit (QIAGEN), and 1.5 μg of RNA was reverse‐transcribed using a High‐Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific 4368813). Real‐time polymerase chain reaction was performed on a Bio‐Rad CFX96 machine using SsoAdvanced Universal SYBR Green Supermix (Bio‐Rad 1725271). Primers for mouse GAPDH (F 5′‐AACTTTGGCATTGTGGAAGGGCTC, R 5′‐TGGAAGAGTGGGAGTTGCTGTTGA), autophagocytosis‐associated protein 3 (F 5′‐TGTCTCTCCCTACTCCATTC, R 5′‐TGGCATACAGTTAGCACTTC), gamma‐aminobutyric acid receptor‐associated protein (F 5′‐GAAAGCGTCTATGGTCTGTG, R 5′‐TGAAGGAGGAACTGGATGT), autophagy‐related 9a (F 5′‐GGCTCTCTTATCACCATCCT, R 5′‐GAAGGAGTGGATCTCCCAATA), autophagy‐related protein 12 (F 5′‐GAGAGATTGACGTTAGAGTGTG, R 5′‐GAGACCTGCAATCCACATAC), and Ras‐related protein 7 (F 5′‐GGACTCTGGTGTTGGAAAG, R 5′‐CAGAAAGTCCGCTCCTATTG) were purchased from Integrated DNA Technologies, Inc (Coralville, IA). Readouts were analyzed by the ΔΔCQ method.

Immunoblotting

Tissues (≈100 mg) were harvested, immediately soaked in liquid nitrogen, and smashed into powder. Tissue powder was dissolved with sodium dodecyl sulfate lysis buffer containing the protease inhibitor mixture, and subjected to SDS‐PAGE. The protein bands were transferred onto an Immuno‐Blot PVDF membrane (Bio‐Rad). Western blot analyses were performed with the specified antibodies as previously described.7

Statistical Analysis

All experiments were performed at least 3 times. Representative and reproducible results were shown. Statistical analysis was performed with Prism software (GraphPad Software, La Jolla, CA). Values were expressed as means±SEM. Student t test was used for parametric analyses between the 2 groups. For nonparametric analyses between the 2 groups, the significance of the differences was assessed by Mann–Whitney U test. P<0.05 was considered statistically significant.

Results

Tollip Deficiency Promotes the Development of Atherosclerosis

We used the well‐established ApoE−/− mouse model for the systems analyses of atherosclerosis. Following 2 months of feeding with an HFD, compared with ApoE−/− mice, ApoE−/−/Tollip−/− mice developed aggravated atherosclerosis as measured by hematoxylin and eosin staining of the aorta area (Figure 1A and 1B). In addition, we observed increased lipid deposition within the atherosclerotic lesion areas of ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice, as measured by the OilRed‐O staining within the cross sections of the aorta (Figure 1C through 1E). We further examined the composition of aortic plaques through staining for smooth muscle cells and collagen content. Through immunohistochemical staining analyses of smooth muscle actin, we observed elevated levels of smooth muscle cells within the plaques in the aorta of ApoE−/−/Tollip−/− mice as compared with ApoE−/−/mice (Figure 1F). We also noted an increase in the collagen content as measured through Masson staining within the aorta of ApoE−/−/Tollip−/− mice as compared with ApoE−/−/mice (Figure 1F). Our results suggest that although Tollip deficiency may give rise to enlarged aortic plaques with increased lipid deposition, the formed plaques are more stable with increased collagen and smooth muscle cells. Enlarged atherosclerotic plaques were similarly observed in ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice fed with regular chow (Figure S1).
Figure 1

Toll‐interacting protein (Tollip) deficiency promotes the development of stable atherosclerotic plaques. A and B, Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. A, Representative hematoxylin and eosin (H&E) staining images within the aortic roots of ApoE−/− and ApoE−/−/Tollip−/− mice. B, Representative Oil‐Red‐O staining images within the aortic roots. C, Quantification of Oil‐Red‐O staining–positive area (mm2) of aortic roots. D, Relative ratios of Oil‐Red‐O–positive areas over total plaque areas. E, Representative smooth muscle cell (SMC) staining of aorta areas from ApoE−/− and ApoE−/−/Tollip−/− mice. F, Representative Masson staining of aorta areas from ApoE−/− and ApoE−/−/Tollip−/− mice. Error bars represent SEM. *P<0.05; **P<0.01; ***P<0.001. Mann–Whitney U test.

Toll‐interacting protein (Tollip) deficiency promotes the development of stable atherosclerotic plaques. A and B, Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. A, Representative hematoxylin and eosin (H&E) staining images within the aortic roots of ApoE−/− and ApoE−/−/Tollip−/− mice. B, Representative OilRed‐O staining images within the aortic roots. C, Quantification of OilRed‐O staining–positive area (mm2) of aortic roots. D, Relative ratios of OilRed‐O–positive areas over total plaque areas. E, Representative smooth muscle cell (SMC) staining of aorta areas from ApoE−/− and ApoE−/−/Tollip−/− mice. F, Representative Masson staining of aorta areas from ApoE−/− and ApoE−/−/Tollip−/− mice. Error bars represent SEM. *P<0.05; **P<0.01; ***P<0.001. Mann–Whitney U test.

Tollip Deficiency Results in the Disruption of Lipophagy in the Aorta

Mechanistically, studies from our laboratory and others reveal that Tollip is critically involved in the completion of lysosome fusion with autophagosome.7, 10 Since the proper fusion of lysosome with autophagosome also plays a key role during the lipophagy process, we tested the hypothesis that increased lipid deposition due to Tollip deficiency may be due to defective lipophagy. To test this, we performed transmission electron microscopy analyses of aorta tissues from ApoE−/− mice and ApoE−/−/Tollip−/− mice fed with an HFD. Consistent with the conclusion drawn through the OilRed‐O staining, we observed higher numbers of lipid droplets within aortic cells from ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice (Figure 2A). The process of lysosome fusion with lipid droplet could be readily seen in aorta tissues from ApoE−/− mice but was absent within the aorta cells from ApoE−/−/Tollip−/− mice (Figure 2B).
Figure 2

Toll‐interacting protein (Tollip) deficiency results in the disruption of lipophagy in aorta. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. A, Representative transmission electron microscopy (TEM) images of aortic sections from Apo−/− mice and ApoE−/−/Tollip−/− mice. B, Representative TEM images that demonstrate the lack of lysosome fusion with lipid droplets within aortic sections from ApoE−/−/Tollip−/− mice. LD indicates lipid droplet; Ly, lysosome.

Toll‐interacting protein (Tollip) deficiency results in the disruption of lipophagy in aorta. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. A, Representative transmission electron microscopy (TEM) images of aortic sections from Apo−/− mice and ApoE−/−/Tollip−/− mice. B, Representative TEM images that demonstrate the lack of lysosome fusion with lipid droplets within aortic sections from ApoE−/−/Tollip−/− mice. LD indicates lipid droplet; Ly, lysosome. At the molecular level, the disruption of lysosome fusion with autophagosomes and/or lipid droplets was associated with the elevated levels of p62.15 Thus, we subsequently stained for p62 levels within the aorta from ApoE−/− and ApoE−/−/Tollip−/− mice. We observed significantly elevated levels of p62 within plaque macrophages from ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice (Figure 3A and 3B), further supporting the notion that lysosome fusion was disrupted in the aorta macrophages due to Tollip deficiency. The overall numbers of aortic macrophages within the plaque areas of ApoE−/−/Tollip−/− mice were not significantly elevated as compared with ApoE−/− mice (Figure S2). Together, our data reveal that the disruption of Tollip contributes to reduced levels of lysosome fusion, elevated accumulation of p62, and enhanced lipid deposition within aorta macrophages.
Figure 3

Toll‐interacting protein (Tollip) deficiency results in compromised lysosome fusion within aorta. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. A, Representative images of p62 staining within plaque macrophages. B, Quantification of p62‐positive macrophages within aorta sections. Error bars represent SEM. *P<0.05. Mann–Whitney U test.

Toll‐interacting protein (Tollip) deficiency results in compromised lysosome fusion within aorta. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. A, Representative images of p62 staining within plaque macrophages. B, Quantification of p62‐positive macrophages within aorta sections. Error bars represent SEM. *P<0.05. Mann–Whitney U test.

Tollip Deficiency Exacerbates Liver Steatosis

Next, we examined the liver pathology of ApoE−/−/Tollip−/− mice. OilRed‐O staining revealed a significant elevation of lipid droplets within hepatocytes from Tollip−/−/ApoE−/− mice as compared with ApoE−/− mice (Figure 4A). Hematoxylin and eosin staining analyses also revealed fatty degeneration of hepatocytes, without apparent fibrosis (Figure 4B). The plasma lipid levels were also significantly elevated in ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice (Figure S3).
Figure 4

Toll‐interacting protein (Tollip) deficiency promotes liver steatosis. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. A, Representative Oil‐Red‐O staining images of liver sections. B, Representative hematoxylin and eosin staining images of liver sections. C, Representative transmission electron microscopy (TEM) images. D, Western blot analyses of liver lipoprotein lipase (LPL) protein levels. E, Immunohistochemical staining of neutrophils. Error bars represent SEM. ***P<0.001. Mann–Whitney U test.

Toll‐interacting protein (Tollip) deficiency promotes liver steatosis. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. A, Representative OilRed‐O staining images of liver sections. B, Representative hematoxylin and eosin staining images of liver sections. C, Representative transmission electron microscopy (TEM) images. D, Western blot analyses of liver lipoprotein lipase (LPL) protein levels. E, Immunohistochemical staining of neutrophils. Error bars represent SEM. ***P<0.001. Mann–Whitney U test. Through the transmission electron microscopy analyses, we further confirmed that the numbers of lipid droplets within individual liver hepatocytes of ApoE−/−/Tollip−/− mice were higher than that of ApoE−/− mice (Figure 4C). Our data reveal that Tollip deficiency also contributes to excessive lipid accumulation in liver tissues. Lipoprotein lipase (LPL) is the key enzyme responsible for the modulation of circulating lipid levels, and a decrease in LPL activity was shown to be responsible for many cases of hyperlipidemia.16 We then tested the levels of LPL by Western blot analyses, and observed a significant increase of LPL protein levels in the liver tissues of ApoE−/−/Tollip−/− as compared with ApoE−/− mice fed with an HFD (Figure 4D). Since Tollip deficiency caused an elevation of plasma lipid as well as liver lipid deposition, we next tested whether Tollip deficiency may also lead to elevated infiltration of inflammatory cells within liver tissues. Intriguingly, we observed that the number of infiltrated neutrophils were significantly lower in the liver tissues of ApoE−/−/Tollip−/− mice fed with an HFD as compared with ApoE−/− mice (Figure 4E). These data suggest that Tollip deficiency selectively affects lipid accumulation while decreasing the infiltration of inflammatory cells.

Tollip Deficiency Results in the Disruption of Lipophagy in Liver

To test whether Tollip deficiency may similarly contribute to the disruption of lipophagy completion in the liver, we performed transmission electron microscopy analyses of liver hepatocytes from ApoE−/− mice and ApoE−/−/Tollip−/− mice. We observed effective fusion between lysosome and lipid droplets in hepatocytes from ApoE−/− mice (Figure 5). In sharp contrast, despite close proximity of lysosomes with lipid droplets in hepatocytes from ApoE−/−/Tollip−/− mice, there was clear separation of membrane structures of lysosomes and lipid droplets, without any noticeable fusion (Figure 5). Intriguingly, there were significantly elevated numbers of lysosomes within hepatocytes from ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice, perhaps due to the lack of lysosome fusion and/or a compensatory mechanism for elevated lysosome biogenesis (Figure 5B and 5C). Our results corroborate with the phenotypic data that Tollip is required for the process of lipophagy, and Tollip deficiency may cause a systemic compromise in the intracellular clearance of lipids.
Figure 5

Toll‐interacting protein (Tollip) deficiency compromises liver lipophagy. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. A, Representative transmission electron microscopy (TEM) images of lipid droplets within liver hepatocytes. B, Representative TEM images of liver hepatocytes. C, The numbers of lysosomes within liver hepatocytes are quantified and shown in the graph. Error bars represent SEM. **P<0.01. Student t test. LD indicates lipid droplet; Ly, lysosome.

Toll‐interacting protein (Tollip) deficiency compromises liver lipophagy. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. A, Representative transmission electron microscopy (TEM) images of lipid droplets within liver hepatocytes. B, Representative TEM images of liver hepatocytes. C, The numbers of lysosomes within liver hepatocytes are quantified and shown in the graph. Error bars represent SEM. **P<0.01. Student t test. LD indicates lipid droplet; Ly, lysosome. Next, we examined critical genes responsible for the fusion of autophagosome with lysosome from the liver tissues of ApoE−/− and ApoE−/−/Tollip−/− mice. As measured by real‐time reverse transcription polymerase chain reaction analyses, the expression levels of autophagocytosis‐associated protein 3, gamma‐aminobutyric acid receptor‐associated protein, autophagy‐related 9a, autophagy‐related protein 12, and Ras‐related protein 7 were significantly reduced in the liver tissues of ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice (Figure 6A through 6E).
Figure 6

Toll‐interacting protein (Tollip) deficiency reduces the expression of key genes involved in lysosome fusion. Apolipoprotein E–deficient (ApoE−/−)and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for additional 8 weeks. A through E, Real‐time reverse transcription polymerase chain reaction data are shown for liver tissue expression of (A) autophagocytosis‐associated protein 3 (ATG3), (B) gamma‐aminobutyric acid receptor‐associated protein (GABARAP), (C) autophagy‐related 9a (ATG9a), (D) autophagy‐related protein 12 (ATG12), and (E) Ras‐related protein 7 (RAB7). Error bars represent SEM. *P<0.05. Student t test.

Toll‐interacting protein (Tollip) deficiency reduces the expression of key genes involved in lysosome fusion. Apolipoprotein E–deficient (ApoE−/−)and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for additional 8 weeks. A through E, Real‐time reverse transcription polymerase chain reaction data are shown for liver tissue expression of (A) autophagocytosis‐associated protein 3 (ATG3), (B) gamma‐aminobutyric acid receptor‐associated protein (GABARAP), (C) autophagy‐related 9a (ATG9a), (D) autophagy‐related protein 12 (ATG12), and (E) Ras‐related protein 7 (RAB7). Error bars represent SEM. *P<0.05. Student t test.

Tollip Deficiency Elicits Reduced Plasma Levels of Inflammatory Mediators

Tollip is involved not only in autophagy, but also in the modulation of inflammatory gene expressions.12, 13 However, previous studies on the exact function of Tollip during the expression of inflammatory mediators were inconclusive. Our previous data with in vitro cultured macrophages suggest that Tollip is involved in the generation of mitochondria reactive oxygen species and the expression of selected proinflammatory mediators under low‐grade inflammatory conditions.13 Based on these findings, we tested the expression levels of key inflammatory mediators in ApoE−/−/Tollip−/− mice. Consistent with our previous in vitro observation, we observed that the levels of plasma TNF‐α and IL‐6 were significantly lower in ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice fed with an HFD (Figure 7). On the other hand, we observed elevated plasma levels of TGF‐β in ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice fed with an HFD (Figure 7). The TGF‐β levels within the atherosclerotic plaque areas were also significantly higher in ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice (Figure S4).
Figure 7

Toll‐interacting protein (Tollip) deficiency reduces the plasma levels of selected inflammatory cytokines. A through E, Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. Plasma levels of (A) tumor necrosis factor‐α (TNF‐α), (B) interleukin (IL)–6, (C) transforming growth factor‐β (TGF‐β), (D) IL‐1β, and (E) C‐C motif chemokine ligand 2 (CCL2) were measured. Error bars represent SEM. *P<0.05; **P<0.01. Mann–Whitney U test.

Toll‐interacting protein (Tollip) deficiency reduces the plasma levels of selected inflammatory cytokines. A through E, Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. Plasma levels of (A) tumor necrosis factor‐α (TNF‐α), (B) interleukin (IL)–6, (C) transforming growth factor‐β (TGF‐β), (D) IL‐1β, and (E) C‐C motif chemokine ligand 2 (CCL2) were measured. Error bars represent SEM. *P<0.05; **P<0.01. Mann–Whitney U test. To test the potential sources of TNF‐α expression, we examined the cellular levels of TNF‐α in splenic monocytes and neutrophils harvested from ApoE−/− and ApoE−/−/Tollip−/− mice through flow cytometry. As shown in Figure 8A and 8B, we observed significantly reduced intracellular levels of TNF‐α and IL‐12 in both splenic monocytes and neutrophils from ApoE−/−/Tollip−/− mice. In addition, the surface levels of C‐X‐C motif chemokine receptor 2 on splenic neutrophils as well as bone marrow neutrophils were significantly lower in ApoE−/−/Tollip−/− mice (Figure 8C and 8D). These data suggest that Tollip deficiency selectively increases intracellular lipid accumulation while reducing systemic proinflammatory response.
Figure 8

Toll‐interacting protein (Tollip) deficiency reduces the expression of inflammatory mediators from monocytes and neutrophils. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. Flow cytometry analyses of intracellular tumor necrosis factor‐α (TNF‐α) and interleukin (IL)–12 in splenic neutrophils (A) and monocytes (B). Flow analyses of C‐X‐C motif chemokine receptor 2 (CXCR2) levels on splenic (C) and bone marrow (D) neutrophils. Error bars represent SEM. N=4, *P<0.05, **P<0.01. Student t test.

Toll‐interacting protein (Tollip) deficiency reduces the expression of inflammatory mediators from monocytes and neutrophils. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. Flow cytometry analyses of intracellular tumor necrosis factor‐α (TNF‐α) and interleukin (IL)–12 in splenic neutrophils (A) and monocytes (B). Flow analyses of C‐X‐C motif chemokine receptor 2 (CXCR2) levels on splenic (C) and bone marrow (D) neutrophils. Error bars represent SEM. N=4, *P<0.05, **P<0.01. Student t test.

Discussion

Our study reveals dual roles of Tollip in facilitating lipophagy and systemic inflammation that reconcile the enlarged yet stable atherosclerosis phenotype associated with Tollip‐deficient mice. First, our data extend previous in vitro studies on the role of Tollip during the process of lysosome fusion.7, 10 Reports from others and our laboratory indicate that Tollip is critically involved in the fusion of lysosome with autophagosome in cultured cells. Our current study confirms these previous studies in an animal model in vivo, in the specific context of lipophagy. We observed a failure of lysosome fusion with lipid droplets within both aorta cells and hepatocytes of ApoE−/−/Tollip−/− mice through electron microscopy. Gene expression analyses revealed reduced expression of key genes involved in lysosome fusion as well as the lipoprotein lipase in ApoE−/−/Tollip−/− mice. The defective lipophagy and reduced LPL expression due to Tollip deficiency we observed in this study helps to explain elevated lipid deposition in atherosclerotic plaques as well as liver in ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice. Second, despite enlarged atherosclerotic plaques with elevated lipid deposition, the systemic levels of proinflammatory cytokines such as TNF‐α and IL‐6 were reduced in ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice. Our study clarifies a novel contribution of Tollip in the context of low‐grade chronic inflammation in vivo. Previous studies suggest opposing roles of Tollip as capable of serving as both a positive and negative regulator of inflammation in cultured cells.12, 13, 17 Under acute and strong inflammatory signals, Tollip may serve as a negative regulator of NFκB signaling and suppress the expression of proinflammatory mediators.12 The induction of Tollip by higher‐dose inflammatory signals such as LPS lead to endotoxin tolerance.12, 18 In contrast, under lower inflammatory signals where NFκB signaling may not be the primary component for the low‐grade inflammatory state, Tollip serves as a positive regulator for the low‐level expression of proinflammatory mediators through facilitating the generation of mitochondria reactive oxygen species.13 Among multiple inducers of chronic inflammation, subclinical endotoxemia with super low levels of circulating LPS have been increasingly recognized in chronic diseases such as diabetes mellitus and atherosclerosis.19, 20 Super low–dose LPS induces nonresolving low‐grade inflammation, enhancing the proinflammatory function of Tollip through translocating Tollip from lysosome to mitochondria.7 On the other hand, dislocation of Tollip away from lysosome may compromise lipophagy and contribute to cellular lipid accumulation. Translocated Tollip may be responsible for altering the balance of cytokine expressions, favoring the expression of proinflammatory mediators such as TNF‐α and IL‐6 and reducing the expression of TGF‐β as shown in this study. Consistent with these mechanistic observations, we recently reported that injection of super low–dose LPS in ApoE single‐knockout mice induces an unstable atherosclerosis phenotype with increased plaque lipid deposition, increased systemic proinflammatory mediators, reduced TGF‐β, and reduced plaque collagen content.19 Our current observations in ApoE−/−/Tollip−/− mice complement our previous findings by demonstrating that complete deletion of Tollip compromises both lipophagy and proinflammatory cytokine expression in vivo. Reduced lipophagy explains elevated lipid deposition within enlarged atherosclerotic plaques in ApoE−/−/Tollip−/− mice. On the other hand, reduced systemic inflammation as reflected in reduced plasma levels of TNF‐α/IL‐6 and increased levels of TGF‐β due to Tollip deletion renders a stable atherosclerosis phenotype with increased plaque collagen and smooth muscle cells. Our data not only address the dual roles of Tollip in lipophagy and inflammation but also help to clarify the relative contribution of rising plasma lipids and inflammation during the pathogenesis of atherosclerosis. Out data are consistent with previous findings that hyperlipidemia is a key driver for early development of atherosclerosis, and that high levels of circulatory inflammatory cytokines are not capable of stimulating the development of atherosclerosis in the absence of hyperlipidemia.21 Our data also suggest that hyperlipidemia without excessive inflammation may prevent the progression of unstable advanced atherosclerosis, as the atherosclerotic plaques manifested in ApoE−/−/Tollip−/− mice tend to have increased collagen contents and elevated smooth muscle cells sprouting over the plaque areas, characteristics of stable atherosclerotic plaques. Likewise, despite elevated lipid deposition in liver tissues, we did not observe apparent fibrosis within liver tissues of ApoE−/−/Tollip−/− mice, which is distinct from conventional models of nonalcoholic fatty liver disease with an inflammatory component, where liver fibrosis is a common phenomenon and often leads to cirrhosis.22, 23 Animals with nonalcoholic fatty liver disease tend to have elevated liver inflammation as reflected by increased infiltration of liver neutrophils.24 In contrast, we observed less neutrophil infiltration in liver tissues from ApoE−/−/Tollip−/− mice as compared with ApoE−/− mice. Collectively, our data suggest that defective lipophagy may partially contribute to the pathogenesis of steatosis and that the lack of an inflammatory component may prevent the full‐blown development of nonalcoholic fatty liver disease with fibrosis and cirrhosis.

Conclusions

At the translational levels, our data suggest that restoring the proper function of Tollip instead of completely blocking Tollip may present the optimum approach to treat atherosclerosis and steatosis. Our data lend caution to related translational studies that aim to treat atherosclerosis by completely blocking target molecules through inhibitor approaches. Instead, balanced approaches to restore the proper functions of target molecules and pathways may hold better therapeutic promise in the effective treatment of chronic atherosclerosis.

Sources of Funding

This study was supported by grants from the National Institutes of Health R01 HL115835 and R56AI108264 to Dr Li. Dr Geng was supported by a Postdoctoral Fellowship Award from the American Heart Association.

Disclosures

None. Figure S1. Toll‐interacting protein (Tollip) deficiency promotes the development of stable atherosclerotic plaques. A and B, Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with regular chow for an additional 8 weeks. A, Representative Oil Red O staining images within the aortic roots of ApoE−/− and ApoE−/−/Tollip−/− mice. B, Quantification of Oil Red O staining–positive area (mm2) of aortic roots. *P<0.05. Mann–Whitney U test. Figure S2. Toll‐interacting protein (Tollip) deficiency does not lead to significant increase in aortic macrophages. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. Aortic sections were stained with monocyte/macrophage marker antibody (green) and DAPI (blue) to visualize aortic macrophages. Figure S3. Toll‐interacting protein (Tollip) deficiency increases plasma levels of lipids. Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. Plasma triglyceride, total cholesterol, and free cholesterol were measured. Error bars represent SEM. *P<0.05; **P<0.01; ***P<0.001. Mann–Whitney U test. Figure S4. Toll‐interacting protein (Tollip) deficiency leads to elevated plaque levels of transforming growth factor‐β (TGF‐β). Apolipoprotein E–deficient (ApoE−/−) and ApoE−/−/Tollip−/− mice (male, 8 weeks old) were fed with a high‐fat diet for an additional 8 weeks. Aortic sections were stained with monocyte/macrophage marker antibody (green) and anti–transforming growth factor‐β. Error bars represent SEM. **P<0.01. Student t test. Click here for additional data file.
  24 in total

1.  Tollip, a new component of the IL-1RI pathway, links IRAK to the IL-1 receptor.

Authors:  K Burns; J Clatworthy; L Martin; F Martinon; C Plumpton; B Maschera; A Lewis; K Ray; J Tschopp; F Volpe
Journal:  Nat Cell Biol       Date:  2000-06       Impact factor: 28.824

2.  A ubiquitin-binding motif required for intramolecular monoubiquitylation, the CUE domain.

Authors:  Susan C Shih; Gali Prag; Smitha A Francis; Myra A Sutanto; James H Hurley; Linda Hicke
Journal:  EMBO J       Date:  2003-03-17       Impact factor: 11.598

3.  Tollip, an intracellular trafficking protein, is a novel modulator of the transforming growth factor-β signaling pathway.

Authors:  Lu Zhu; Lingdi Wang; Xiaolin Luo; Yongxian Zhang; Qiurong Ding; Xiaomeng Jiang; Xiao Wang; Yi Pan; Yan Chen
Journal:  J Biol Chem       Date:  2012-10-01       Impact factor: 5.157

4.  Dysfunctions in endosomal-lysosomal and autophagy pathways underlie neuropathology in a mouse model for Lafora disease.

Authors:  Rajat Puri; Toshimitsu Suzuki; Kazuhiro Yamakawa; Subramaniam Ganesh
Journal:  Hum Mol Genet       Date:  2011-09-30       Impact factor: 6.150

Review 5.  Autophagy and Lipid Droplets in the Liver.

Authors:  Nuria Martinez-Lopez; Rajat Singh
Journal:  Annu Rev Nutr       Date:  2015-05-06       Impact factor: 11.848

6.  Characterization of Tollip protein upon Lipopolysaccharide challenge.

Authors:  Tao Li; Jean Hu; Liwu Li
Journal:  Mol Immunol       Date:  2004-05       Impact factor: 4.407

7.  Endotoxin tolerance dysregulates MyD88- and Toll/IL-1R domain-containing adapter inducing IFN-beta-dependent pathways and increases expression of negative regulators of TLR signaling.

Authors:  Wenji Piao; Chang Song; Haiyan Chen; Marco A Quevedo Diaz; Larry M Wahl; Katherine A Fitzgerald; Liwu Li; Andrei E Medvedev
Journal:  J Leukoc Biol       Date:  2009-08-05       Impact factor: 4.962

8.  Cholesterol-induced non-alcoholic fatty liver disease and atherosclerosis aggravated by systemic inflammation.

Authors:  Eung Ju Kim; Baek-hui Kim; Hong Seog Seo; Yong Jik Lee; Hyun Hee Kim; Hyun-Hwa Son; Man Ho Choi
Journal:  PLoS One       Date:  2014-06-05       Impact factor: 3.240

9.  The persistence of low-grade inflammatory monocytes contributes to aggravated atherosclerosis.

Authors:  Shuo Geng; Keqiang Chen; Ruoxi Yuan; Liang Peng; Urmila Maitra; Na Diao; Chun Chen; Yao Zhang; Yuan Hu; Chen-Feng Qi; Susan Pierce; Wenhua Ling; Huabao Xiong; Liwu Li
Journal:  Nat Commun       Date:  2016-11-08       Impact factor: 14.919

10.  Experimental endotoxemia induces adipose inflammation and insulin resistance in humans.

Authors:  Nehal N Mehta; Fiona C McGillicuddy; Paul D Anderson; Christine C Hinkle; Rachana Shah; Leticia Pruscino; Jennifer Tabita-Martinez; Kim F Sellers; Michael R Rickels; Muredach P Reilly
Journal:  Diabetes       Date:  2009-09-30       Impact factor: 9.461

View more
  18 in total

Review 1.  Cellular and molecular mechanisms involved in the resolution of innate leukocyte inflammation.

Authors:  Allison Rahtes; Shuo Geng; Christina Lee; Liwu Li
Journal:  J Leukoc Biol       Date:  2018-04-24       Impact factor: 4.962

2.  Toll-interacting protein differentially modulates HIF1α and STAT5-mediated genes in fibroblasts.

Authors:  Elizabeth Kowalski; Shuo Geng; Allison Rathes; Ran Lu; Liwu Li
Journal:  J Biol Chem       Date:  2018-06-19       Impact factor: 5.157

3.  Proteaphagy in Mammalian Cells Can Function Independent of ATG5/ATG7.

Authors:  Tatjana Goebel; Simone Mausbach; Andreas Tuermer; Heba Eltahir; Dominic Winter; Volkmar Gieselmann; Melanie Thelen
Journal:  Mol Cell Proteomics       Date:  2020-04-16       Impact factor: 5.911

4.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

5.  Tollip promotes hepatocellular carcinoma progression via PI3K/AKT pathway.

Authors:  Lu Huang; Qiong Yang; Huihong Chen; Zhenggeng Wang; Qi Liu; Shuhua Ai
Journal:  Open Med (Wars)       Date:  2022-04-01

Review 6.  Toll-Interacting Protein in Resolving and Non-Resolving Inflammation.

Authors:  Elizabeth J A Kowalski; Liwu Li
Journal:  Front Immunol       Date:  2017-05-05       Impact factor: 7.561

Review 7.  Autophagy as a promoter of longevity: insights from model organisms.

Authors:  Malene Hansen; David C Rubinsztein; David W Walker
Journal:  Nat Rev Mol Cell Biol       Date:  2018-09       Impact factor: 94.444

8.  Vitamin D3-VDR-PTPN6 axis mediated autophagy contributes to the inhibition of macrophage foam cell formation.

Authors:  Sumit Kumar; Ravikanth Nanduri; Ella Bhagyaraj; Rashi Kalra; Nancy Ahuja; Anuja P Chacko; Drishti Tiwari; Kanupriya Sethi; Ankita Saini; Vemika Chandra; Monika Jain; Shalini Gupta; Deepak Bhatt; Pawan Gupta
Journal:  Autophagy       Date:  2020-09-24       Impact factor: 16.016

Review 9.  Toll-interacting protein impacts on inflammation, autophagy, and vacuole trafficking in human disease.

Authors:  Xiaoyun Li; Gillian C Goobie; Yingze Zhang
Journal:  J Mol Med (Berl)       Date:  2020-10-31       Impact factor: 4.599

Review 10.  New Insights Into the Role of Autophagy in Liver Surgery in the Setting of Metabolic Syndrome and Related Diseases.

Authors:  Ana Isabel Álvarez-Mercado; Carlos Rojano-Alfonso; Marc Micó-Carnero; Albert Caballeria-Casals; Carmen Peralta; Araní Casillas-Ramírez
Journal:  Front Cell Dev Biol       Date:  2021-06-01
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.