Literature DB >> 28393194

Metallothionein 1G promotes the differentiation of HT-29 human colorectal cancer cells.

Juan Martín Arriaga1, Alicia Inés Bravo2, José Mordoh1, Michele Bianchini3.   

Abstract

Metallothioneins (MTs) are a family of low-molecular-weight, cysteine-rich proteins involved in zinc and redox metabolism, that are epigenetically downregulated during colorectal cancer (CRC) progression, but may be re-induced with a variety of agents. Since loss of MT expression is associated with a worse prognosis, in the present study we investigated the effects of overexpression of the most significantly downregulated isoform in CRC, namely MT1G, on the HT-29 cell line. Overexpression of MT1G resulted in xenograft tumors with an aberrant morphology, characterized by an evident increase in mucin-containing cells that were identified as goblet cells under electron microscopy. Immunohistochemical detection of CDX2 and cytokeratin 20 was also increased, as were goblet‑cell and enterocyte-specific genes by qRT-PCR. Microarray analysis of gene expression confirmed the alteration of several differentiation signaling pathways, including the Notch pathway. Using sodium butyrate and post-confluent growth as inducers of differentiation, we demonstrated that MT1G does indeed play a functional role in promoting goblet over enterocyte differentiation in vitro. Labile zinc is also induced upon differentiation of CRC cells, functionally contributing to enterocyte over goblet differentiation, as revealed using zinc‑specific chelating agents. Overall, our results uncover a new tumor-suppressor activity of MT1G in promoting the differentiation of at least some CRC tumors, and implicate MTs and zinc signaling as new players in colorectal differentiation. This further contributes to the hypothesis that re-induction of MTs may have therapeutic value by diminishing the aggressiveness of CRC tumors.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28393194      PMCID: PMC5428900          DOI: 10.3892/or.2017.5547

Source DB:  PubMed          Journal:  Oncol Rep        ISSN: 1021-335X            Impact factor:   3.906


Introduction

Colorectal cancer (CRC) is the third most commonly diagnosed cancer worldwide, having a mortality rate near 50% (1). Recent studies have shown that these tumors retain multilineage differentiation processes similar to those of the normal intestinal epithelium, mainly the goblet cell and enterocyte lineages (2). Furthermore, molecular classifications representing these cellular phenotypes can have prognostic value and be predictive of response to different therapeutic agents (3). Metallothioneins (MTs) are a family of low-molecular-weight, cysteine-rich proteins involved in zinc and redox metabolism. By chelating zinc ions through redox-active thiol groups, they have the capacity to regulate the exchangeable, loosely-bound pool of intracellular zinc, termed the ‘labile’ pool, which participates in zinc transfer reactions and intracellular signaling. Thus MTs have been implicated in many aspects of tumor biology, such as proliferation, differentiation, apoptosis, angiogenesis, redox and zinc homeostasis, anti-inflammatory reactions and immunomodulation (4–7). The human genome encodes at least 11 functional MT isoforms that share structural and functional similarities. Due to their structural similarity, commercially available antibodies do not distinguish between individual MT isoforms, and therefore their individual mRNA expression levels can be measured by qRT-PCR. However, due to the fact that they are variably expressed in tissues and induced by several stimuli, it is possible that different tumors express distinct MT genes, which could help explain the conflicting data on MT function in different tumor types (6,7). We and others have previously shown that multiple MT1 isoforms and MT2A are downregulated during CRC progression (especially isoform MT1G) mainly through epigenetic mechanisms, and that this is associated with shorter patient survival (8–11). Several agents such as DNA methyltransferase inhibitors, histone deacetylase inhibitors or zinc are capable of re-inducing MT expression in colorectal tumors, which can slow down in vivo tumor growth and sensitize these tumors to chemotherapeutic agents (12). In order to help understand the phenotypic consequences of MT induction, in the present study we investigated the effects of stable overexpression of the most downregulated isoform in CRC, namely MT1G, on the HT-29 CRC cell line. We uncovered a new role for this isoform in modulating tumor differentiation and thus expand the mechanisms by which this gene may act as a tumor suppressor in CRC.

Materials and methods

Reagents and cell lines

The MT1G cDNA was cloned into the pcDNA3.1/myc-His(−)A expression vector, resulting in an MT1G-myc fusion protein as previously described (12). Sodium butyrate and N,N,N',N'-tetrakis(2-pyridylmethyl) ethylenediamine (TPEN) were purchased from Sigma-Aldrich Inc. (St. Louis, MO, USA), and FluoZin-3-AM (FZ) from Invitrogen (San Diego, CA, USA). The human CRC cell lines HT-29 and HCT116 were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA), maintained as previously described (8), and subjected to STR profiling for authentication after all experiments were finalized. For post-confluent growth, day 0 was considered the day when cells reached 100% confluence, and fresh medium was replaced every 1–2 days thereafter.

Animal studies and histological procedures

Eight- to 10-week-old male nude mice were subcutaneously injected (2×106 cells each) with two independent clones of MOCK or MT1G+ cells (5 mice/group) and tumor size was measured with a caliper to calculate tumor volume using the formula: Tumor volume (mm3) = [length (mm)]×[width (mm)]2×π/6. All animal procedures were approved by the Institutional Animal Care Board of the Leloir Institute. After 50 days, tumors were excised, formalin-fixed and paraffin-embedded for histological examination. A fraction of each tumor was preserved in RNAlater medium (Ambion Inc., Austin TX, USA) at 4̊C for 24 h, and then stored at −80̊C. RNA was extracted from RNAlater-preserved tissues using the TRIzol method (Invitrogen), and quantification and quality control were performed with the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Paraffin sections (4 µm thick) were re-hydrated and stained with Alcian Blue stain (1% in 3% acetic acid, pH 2.5) or processed for immunohistochemistry using the Vectastain Universal Elite ABC kit (Vector Laboratories, Inc., Burlingame, CA, USA) with citrate buffer antigen retrieval and the following antibodies: anti-cytokeratin 20 (KS 20.8; Dako Corporation, Carpinteria, CA, USA) and anti-CDX2 (clone EPR2764Y; Cell Marque, Rocklin, CA, USA). For transmission electron microscopy, freshly xenografted tumors were cut into small (~1-mm thick) pieces and promptly fixed in 2.5% glutaraldehyde in phosphate-buffered saline (PBS) for 2 h, washed and fixed for 90 min in 1% osmium tetroxide in phosphate-buffered saline (PBS), de-hydrated in acetone gradients and included in resin. Semi-(0.5 µm) and ultra-thin (70 nm) sections were cut and contrasted in 2.5% uranyl-acetate, and visualized using a Zeiss EM 109T microscope coupled to a digital CCD Gatan ES1000W camera.

Gene expression profile analysis and qRT-PCR

Total RNA was extracted, and mRNA expression was analyzed using an Agilent Custom microarray 8×15K (Agilent Technologies, Palo Alto, CA, USA), which contained 15,744 oligonucleotide probes representing >8,200 different human transcripts. Two samples from each group were used to detect mRNA expression; each biological replicate was run in duplicate, and the fluorochromes were swapped to reduce dye-bias; in total eight 15K microarrays were scanned using the Axon Confocal Scanner 4000B (Molecular Devices, Sunnyvale, CA, USA) with optimized settings: dye channel, 635 nm, PMT=720, laser power, 30%, scan resolution, 10 nm; dye channel, 532 nm, PMT=540, laser power, 30%, scan resolution, 10 nm; line average, 4 lines. The data were analyzed using GenePix® Pro 6 Microarray Acquisition and Analysis Software (Molecular Devices) and normalized with the MIDAS v2.2: Microarray Data Analysis System (TIGR's Microarray Data Analysis System). Normalization was necessary to compensate for variability between slides and fluorescent dyes. To this end we employed a locally weighted linear regression [Lowess (13,14)]; data were filtered using low-intensity cutoff and replicate consistency trimming. The differentially expressed genes among the MT1G+, and control (MOCK) sets were identified using the significant analysis of microarray (SAM) statistical software from MultiExperiment Viewer (MeV) (TIGR's Microarray Data Analysis System). In the comparisons of MT1G+ vs. MOCK, the genes that were all upregulated in the comparisons were identified as the persistently upregulated genes, and the genes that were all downregulated in the comparisons were defined as the persistently downregulated genes. The gene annotation enrichment analysis using Gene Ontology (GO) (http://www.geneontology.org/) and Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.jp/kegg/) data for gene sets was performed using Database for Annotation, Visualization, and Integrated Discovery (DAVID) software (15,16). A Benjamini p-value of 0.05 was used in the analysis. Quantitative reverse-transcription PCR (qRT-PCR) was used to quantify mRNA levels as previously described (8). Briefly, PCR runs were carried out using SYBR Universal Master Mix (Applied Biosystems, Carlsbad, CA, USA), and relative expression levels were determined by the ΔΔCt method using ACTB gene expression to normalize all samples. The primers used are listed in Table I.
Table I.

Primer sequences.

GeneForward primerReverse primer
MT1GCTTCTCGCTTGGGAACTCTAAGGGGTCAAGATTGTAGCAAA
MT2AGCAACCTGTCCCGACTCTAGTTGCAGGAGGTGCATTTG
ACTBGCCATCTCTTGCTCGAAGTCCAGATGTTTGAGACCTTCAACACCCC
CDKN1AAAGACCATGTGGACCTGTGGTAGAAATCTGTCATGCTG
HSIGAGGACACTGGCTTGGAGACATCCAGCGGGTACAGAGATG
HALPIGACCACTCCCATGTCTTCTCCTTTCGCACGCCTGAGTTGAA
CA2CCGCGGACACACAGTGCAGGCCAGTGCTCAGGTCCGTTGTGT
CA1CAGAACATACAGTGGATGGAGTCAAGGCCTCACCAACCTTCATCA
K20AAATGCTCGGTGTGTCCTGACTTCCTCCTGATGCTCCTT
ATOH1CCCCGGGAGCATCTTGGGGACCGAGGCGAAGTT
TFF3CTCCAGCTCTGCTGAGGAGTGCTTGAAACACCAAGGCACT
HMUC2CAGCACCGATTGCTGAGTTGGCTGGTCATCTCAATGGCAG
CDX2GATGGTGATGTAGCGACTGTAGTGACTCGGCAGCCAAGTGAAAAC

Alkaline phosphatase activity measurement

The activity of this enzyme was used as a marker of differentiation of HT-29 cells (17). For this purpose, confluent cell lines were lysed in 10 mM Tris (pH 7.4), 1 mM MgCl2, 20 µM ZnCl2, 0.2% Triton X-100 + protease inhibitors, and incubated with NBT-BCIP as the chromogenic substrate for 16 h at 37̊C. The resulting brown precipitate was solubilized in 10% SDS, 10% HCl and absorbance was measured at 595 nm.

siRNA transfection

Two siRNAs targeting the MT1G isoform (si1G.1 and si1G.2) and one targeting all functional MT-1 and MT-2 isoforms were previously validated (12), and transfected at 125 nM using LF2000 (Invitrogen) as described by the manufacturer. After 24 h of siRNA treatment, medium was replaced with or without 2 mM sodium butyrate for 48 h, and cells were collected for RNA extraction or ALP activity measurement.

Scratch assays and gelatin zymography

We used the scratch assay to estimate the migration capacities of MOCK and MT1G+ cell lines, which were plated in triplicate in 24-well plates until they reached confluence. Two perpendicular scratches were made with a pipette tip, after which the cells were washed thrice in PBS and replaced with 1% fetal bovine serum (FBS) medium. Areas with the same wound length were selected and photographed until complete wound closure. Wound closure at a given time t was calculated as: (initial wound length - wound length at time t)/initial wound length×100. To determine gelatinase activity of matrix metalloproteinases (MMPs), upon reaching confluence medium was replaced with serum-free Dulbeccos modified Eagles medium (DMEM) for 24 h, and the conditioned medium was centrifuged at 1,200 × g for 5 min, and immediately loaded into 10% polyacrylamide electrophoretic gels with or without 2.5 mg/ml gelatin (Sigma-Aldrich) as described in (18). Coomasie Blue staining of the non-gelatin gels were used as a loading control.

Measurement of intracellular labile zinc

For this purpose we employed the cell-permeable zinc-specific fluorophore FZ as described in (12). Briefly, cells were plated in triplicate in sterile plastic coverslips (for fluorescence microscopy) or in 96-well plates (for fluorimetric analysis), and incubated for 30 min at room temperature with 2 µM FZ in PBS, washed in PBS and incubated a further 30 min in PBS at room temperature. Propidium iodide staining was used to control for plating differences and data are expressed as normalized fluorescence FZ = (F - FTPEN)/(FZn - FTPEN), so as to get values relative to a ‘maximum’ intensity given by pretreatment with zinc 400 µM for 8 h (FZn, resulting in FZ=1) and a ‘minimum’ intensity given by 20 µM TPEN treatment during the final 30 min incubation of fluozin (FTPEN, resulting in FZ=0). This score allowed us to better compare results of the different experiments.

Statistical analysis

Data are expressed as mean ± SEM and p-values <0.05 were considered significant. Comparison of means was carried out using Student's t-test, with one-way ANOVA followed by Dunnett's post hoc t-test for three or more groups, or with two-way ANOVA followed by Bonferroni's post hoc t-test for two variables. GraphPad Prism 5.0 (GraphPad Software, Inc., La Jolla, CA, USA) software was used for analysis.

Results

MT1G overexpression in the HT-29 CRC cell line

We stably expressed MT1G as a myc-epitope fusion protein in HT-29 cells. When grown in vivo as subcutaneous xenografts on nude mice, these MT1G+ cells grew at similar rates compared to the empty-vector (‘MOCK’)-transfected cells (data not shown), in stark contrast to the antiproliferative effects we had previously observed using the HCT116 cell line (12). However, hematoxylin and eosin (H&E) staining (Fig. 1A) showed that MT1G+ tumors contained a higher number of mucin-containing, Alcian Blue-positive cells (Fig. 1B) that were confirmed to be goblet cells by transmission electron microscopy (Fig. 1C). Nuclear expression of the intestine-specific homeobox transcription factor CDX2 was markedly enhanced in the MT1G+ tumors, as shown by immunohistochemical staining on Fig. 1D, as was also the intensity of cytokeratin 20 (Fig. 1E). The latter also suggests that commitment to the enterocyte lineage may be enhanced as well. Indeed, both goblet-associated (TFF3, ATOH1 and MUC2) and enterocyte-associated genes (HSI, CA2 and ALPI) were overexpressed in the MT1G+ tumors by qRT-PCR analysis (Fig. 1F), suggesting that MT1G+ tumors are more differentiated than MOCK controls.
Figure 1.

HT-29 MOCK and MT1G+ subcutaneous xenografts in nude mice. (A) H&E and (B) Alcian Blue stainings showing an increase in the number of mucin-like cells in the MT1G+ tumors. (C) Microphotograph of a goblet-like cell in MT1G+ tumors. (D) CDX2 and (E) keratin 20 immunohistochemistry. (F) Expression of enterocyte and goblet-associated differentiation markers, as assessed by qRT-PCR. AFC, average fold-change.

Gene expression analysis of HT-29 MT1G+ tumors using cDNA microarrays

We then used cDNA microarrays to profile the mRNA expression of MOCK and MT1G+ HT-29 xenografts, derived from two different MT1G+ or MOCK clonal cell lines (MT1G-1 and MT1G-2, or MOCK-1 and MOCK-2, respectively). Gene expression profiles of the biological replicates were reproducible and highly correlated (Pearson's correlation coefficient 0.81). Analysis of data with Rank product analysis revealed significant gene expression differences among the groups, with a total of 305 known genes found to be consistently upregulated or downregulated in the MT1G+ tumors (Table II). GO analysis indicated that several functional categories were enriched by DAVID, and included upregulated genes associated with cell differentiation, cell fate commitment and Notch signaling pathway, as well as downregulated genes in the categories of regulation of apoptosis, cell migration and cell proliferation (Table III). Differentially expressed genes were also analyzed for KEGG pathway enrichment and two significantly enriched pathways were identified between upegulated or downregulated genes: the Notch signaling pathway and pathways in cancer, respectively.
Table II.

List of all significantly differentially expressed genes in MT1G+ vs. MOCK HT-29 xenografts.

A, Upregulated genes

Gene referenceGene symbolNameMeanP-values (Up)RP-values (Up)
NM_138444KCTD12Potassium channel tetramerisation domain containing 122.652.81E-0680.00
NM_000051ATMAtaxia telangiectasia mutated2.524.68E-0691.77
NM_175698SSX2Synovial sarcoma, X breakpoint 23.066.56E-0699.19
NM_031964KRTAP17-1Keratin-associated protein 17-12.352.25E-05141.15
NM_003357SCGB1A1Secretoglobin, family 1A, member 1 (uteroglobin)2.192.72E-05155.94
NM_005430WNT1Wingless-type MMTV integration site family, member 12.402.81E-05156.29
NM_001031672CYB5RLCytochrome b5 reductase-like2.373.18E-05164.29
NM_000546TP53Tumor protein p532.123.75E-05168.99
NM_001123065Chromosome 7 open reading frame 652.044.59E-05181.40
NM_001443FABP1Fatty acid binding protein 1, liver2.275.99E-05197.89
NM_000364TNNT2Troponin T type 2 (cardiac)2.018.24E-05216.07
NM_001201BMP3Bone morphogenetic protein 32.171.01E-04224.84
NM_031310PLVAPPlasmalemma vesicle-associated protein2.021.22E-04239.78
NM_182981OSGIN1Oxidative stress induced growth inhibitor 11.891.44E-04249.22
NM_139211HOPXHOP homeobox1.881.65E-04256.18
NM_017774CDKAL1CDK5 regulatory subunit-associated protein 1-like 11.862.00E-04271.00
NM_001077195ZNF436Zinc finger protein 4361.962.62E-04289.52
NM_000067CA2Carbonic anhydrase II1.762.82E-04295.37
NM_015894STMN3Stathmin-like 31.172.86E-04296.25
NM_014237ADAM18ADAM metallopeptidase domain 182.192.95E-04298.48
NM_182705FAM101BFamily with sequence similarity 101, member B1.814.28E-04330.71
NM_025191EDEM3ER degradation enhancer, α-mannosidase-like 31.784.56E-04337.06
NM_020639RIPK4Receptor-interacting serine-threonine kinase 41.704.56E-04337.43
NM_004557NOTCH4Notch 41.704.77E-04340.80
NM_005618DLL1δ-like 1 (Drosophila)1.705.05E-04346.21
NM_004001FCGR2BFc fragment of IgG, low affinity IIb, receptor (CD32)1.715.22E-04349.94
NM_001008225CNOT4CCR4-NOT transcription complex, subunit 41.666.17E-04367.80
NM_170664OTOAΟtoancorin1.646.23E-04368.88
NM_019845RPRMReprimo, TP53-dependent G2 arrest mediator candidate1.396.24E-04369.37
NM_033409SLC52A3Chromosome 20 open reading frame 541.656.26E-04369.79
NM_001010879ZIK1Zinc finger protein interacting with K protein 1 homolog (mouse)1.596.68E-04376.61
NM_007365PADI2Peptidyl arginine deiminase, type II1.986.99E-04381.36
NM_007314ABL2v-abl Abelson murine leukemia viral oncogene homolog 20.997.21E-04385.01
NM_001080519BAHCC1BAH domain and coiled-coil containing 11.587.93E-04397.25
NM_000584CXCL8Interleukin 81.689.46E-04419.56
NM_002649PIK3CGPhosphoinositide-3-kinase, catalytic, γ-polypeptide1.741.07E-03437.34
NM_178311GGTLC1γ-glutamyltransferase light chain 11.281.09E-03440.27
NM_001124756PABPC1LPoly(A) binding protein, cytoplasmic 1-like1.511.11E-03442.81
NM_001010926HES5Hairy and enhancer of split 5 (Drosophila)1.091.15E-03446.74
NM_152643KNDC1Kinase non-catalytic C-lobe domain (KIND) containing 11.851.18E-03449.71
NM_152279ZNF585BZinc finger protein 585B1.301.18E-03450.06
NM_003018SFTPCSurfactant protein C1.511.20E-03452.03
NM_003460ZP2Zona pellucida glycoprotein 2 (sperm receptor)1.791.23E-03456.86
NM_022101Chromosome X open reading frame 560.841.30E-03464.79
NM_001136566RAD21L1RAD21-like 1 (S. pombe)0.611.31E-03465.53
NM_019886CHST7Carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 71.491.43E-03477.78
NM_002410MGAT5Mannosyl (α-1,6-)-glycoprotein β-1,6-N-acetyl-glucosaminyltransferase1.371.49E-03484.02
NM_001130715PLAC8Placenta-specific 81.471.51E-03485.05
NM_012368OR2C1Olfactory receptor, family 2, subfamily C, member 11.421.60E-03493.64
NM_198463C3ORF67Chromosome 3 open reading frame 671.551.72E-03503.50
NM_080647TBX1T-box 11.011.74E-03504.66
NM_001136003C2CD4DC2 calcium-dependent domain containing 4D1.381.83E-03512.27
NM_014909VASH1Vasohibin 11.381.84E-03512.54
NM_002318LOXL2Lysyl oxidase-like 21.441.91E-03518.96
NM_031457MS4A8Membrane-spanning 4-domains, subfamily A, member 8B1.362.17E-03538.29
NM_001146190ZNF407Zinc finger protein 4071.352.20E-03541.10
NM_004375COX11COX11 cytochrome c oxidase assembly homolog (yeast)1.372.36E-03552.91
NM_001040462BTNL8Butyrophilin-like 80.842.39E-03554.54
NM_001265CDX2Caudal type homeobox 21.332.44E-03558.57
NM_001013661VSIG8V-set and immunoglobulin domain containing 81.332.50E-03563.31
NM_019119PCDHB9Protocadherin-β91.322.51E-03564.49
NM_001144875DOK3Docking protein 31.292.54E-03566.33
NM_003722TP63Tumor protein p631.382.56E-03569.10
NM_006138MS4A3Membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)1.582.73E-03580.41
NM_005427TP73Tumor protein p731.372.88E-03589.30
NM_003106SOX2SRY (sex determining region Y)-box 21.073.12E-03604.10
NM_033318SMDT1Chromosome 22 open reading frame 320.803.14E-03605.59
NM_012426SF3B3Splicing factor 3b, subunit 3, 130 kDa1.313.31E-03615.60
NM_002458MUC5BMucin 5B, oligomeric mucus/gel-forming1.533.45E-03623.75
NM_001001411ZNF676Zinc finger protein 6761.453.48E-03625.90
NM_000362TIMP3TIMP metallopeptidase inhibitor 31.333.55E-03629.94
NM_014751MTSS1Metastasis suppressor 11.233.62E-03633.32
NM_201442C1SComplement component 1, s subcomponent0.913.63E-03633.68
NM_005961MUC6Mucin 6, oligomeric mucus/gel-forming1.213.92E-03647.05
NM_001002758PRY2PTPN13-like, Y-linked 21.473.99E-03650.48
NM_001135654PABPC4Poly(A) binding protein, cytoplasmic 4 (inducible form)1.314.01E-03651.26
NM_014030GIT1G protein-coupled receptor kinase interacting ArfGAP 11.174.13E-03657.53
NM_001083537FAM86B1Family with sequence similarity 86, member B11.294.16E-03658.91
NM_001645APOC1Apolipoprotein C-I1.204.27E-03664.10
NM_003226TFF3Trefoil factor 3 (intestinal)1.194.29E-03664.92
NM_005172ATOH1Atonal homolog 1 (Drosophila)1.264.31E-03665.93
NM_003708RDH16Retinol dehydrogenase 16 (all-trans)0.924.41E-03670.22
NM_002917RFNGRFNG O-fucosylpeptide 3-β-N-acetylglucosaminyltransferase1.284.56E-03677.43
NM_016585THEGTheg homolog (mouse)1.194.63E-03681.11
NM_007058CAPN11Calpain 111.514.73E-03684.84
NM_003759SLC4A4Solute carrier family 4, sodium bicarbonate co-transporter, member 41.194.74E-03685.17
NM_020299AKR1B10Aldo-keto reductase family 1, member B10 (aldose reductase)1.174.77E-03686.57
NM_032133MYCBPAPMYCBP-associated protein0.924.95E-03693.39
NM_001631ALPIAlkaline phosphatase, intestinal1.254.98E-03695.09
NM_002486NCBP1Nuclear cap binding protein subunit 1, 80 kDa1.235.09E-03699.73
NM_001105659LRRIQ3Leucine-rich repeats and IQ motif containing 31.185.13E-03702.05
NM_014276RBPJLRecombination signal binding protein for immunoglobulin-κJ region-like1.155.29E-03708.75
NM_015461ZNF521Zinc finger protein 5210.915.35E-03711.10
NM_001105662  Ubiquitin specific peptidase 171.215.63E-03722.91
NM_005068SIM1Single-minded homolog 1 (Drosophila)1.195.73E-03726.21
NM_018646TRPV6Transient receptor potential cation channel, subfamily V, member 60.646.05E-03739.17
NM_139026ADAMTS13ADAM metallopeptidase with thrombospondin type 1 motif, 130.846.31E-03749.50
NM_152749ATXN7L1Ataxin 7-like 10.756.31E-03749.64
NM_019034RHOFRas homolog gene family, member F (in filopodia)1.216.35E-03751.22
NM_017592MED29Mediator complex subunit 290.926.38E-03752.10
NM_206965FTCDFormiminotransferase cyclodeaminase1.166.40E-03752.88
NM_020063BARHL2BarH-like homeobox 21.106.41E-03753.43
NM_016338IPO11Importin 110.746.51E-03756.92
NM_001109997KLHL33Kelch-like 33 (Drosophila)1.156.61E-03761.02
NM_004235KLF4Kruppel-like factor 4 (gut)0.966.64E-03762.27
NM_172365PPP1R36Protein phosphatase 1, regulatory subunit 360.936.74E-03765.82
NM_003665FCN3Ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen)1.236.86E-03770.05
NM_017910TRMT61BtRNA methyltransferase 61 homolog B (S. cerevisiae)0.977.11E-03778.71
NM_031459SESN2Sestrin 20.277.16E-03780.18
NM_203458NOTCH2NLNotch 2 N-terminal like0.597.16E-03780.21
NM_002203ITGA2Integrin, α2 (CD49B, α2 subunit of VLA-2 receptor)1.207.16E-03780.44
NM_138337CLEC12AC-type lectin domain family 12, member A1.327.22E-03782.42
NM_020533MCOLN1Mucolipin 10.517.33E-03786.12
NM_022481ARAP3ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 31.117.42E-03789.36
NM_001105578SYCE2Synaptonemal complex central element protein 21.137.66E-03797.43
NM_021969NR0B2Nuclear receptor subfamily 0, group B, member 21.167.68E-03798.17
NM_015852ZNF117Zinc finger protein 1171.187.69E-03798.86
NM_023946LYNX1Ly6/neurotoxin 11.107.89E-03805.77
NM_001039887PROSER3Chromosome 19 open reading frame 551.177.94E-03807.24
NM_015184PLCL2Phospholipase C-like 21.068.02E-03809.76
NM_004938DAPK1Death-associated protein kinase 10.548.06E-03811.54
NM_004755RPS6KA5Ribosomal protein S6 kinase, 90 kDa, polypeptide 51.048.21E-03816.35
NM_001007532STHSaitohin1.178.24E-03817.51
NM_002613PDPK13-Phosphoinositide-dependent protein kinase-11.108.34E-03820.46
NM_006620HBS1LHBS1-like (S. cerevisiae)1.048.46E-03824.24
NM_003382VIPR2Vasoactive intestinal peptide receptor 20.778.55E-03826.94
NM_203486DLL3δ-like 3 (Drosophila)1.078.56E-03827.15
NM_018010IFT57Intraflagellar transport 57 homolog (Chlamydomonas)0.928.74E-03833.66
NM_001135816CXORF56C1QTNF9B antisense RNA 1 (non-protein coding)0.878.76E-03834.30
NM_033133CNP2′,3′-Cyclic nucleotide 3 phosphodiesterase1.028.84E-03836.32
NM_005199CHRNGCholinergic receptor, nicotinic, γ0.989.01E-03841.20
NM_182765HECTD2HECT domain containing 20.799.12E-03844.85
NM_001145290SLC37A2Solute carrier family 37 (glycerol-3- phosphate transporter), member 20.909.15E-03845.70
NM_001195252APTXAprataxin1.059.31E-03850.77
NM_001251964TP53AIP1Tumor protein p53-regulated apoptosis inducing protein 11.269.35E-03851.82
NM_198270NHSNance-Horan syndrome (congenital cataracts and dental anomalies)1.139.53E-03857.71
NM_000578SLC11A1Solute carrier family 11 (proton-coupled divalent metal ion transporters), member 11.069.63E-03859.97
NM_002139RBMXRNA binding motif protein, X-linked1.069.65E-03860.47
NM_000435NOTCH3Notch 31.109.71E-03862.14
NM_033066MPP4Membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)1.129.87E-03867.43

B, Downregulated genes

Gene referenceGene symbolNameMeanP-values (Down)RP-values (Down)

AJ298317MUC5ACMucin 5AC, oligomeric mucus/gel-forming−2.548.43E-06112.88
AF547222LOC280665Anti-CNG α1 cation channel translation product-like−2.761.31E-05123.92
AK097187NQO2NAD(P)H dehydrogenase, quinone 2−2.483.75E-05169.61
AK128551RNF216Ring finger protein 216−2.196.09E-05198.31
BC062748EFCAB10EF-hand calcium binding domain 10−2.101.14E-04233.55
NM_000639FASLGFas ligand (TNF superfamily, member 6)−1.612.15E-04274.72
NM_001124ADMAdrenomedullin−1.483.43E-04311.18
NM_000043FASFas (TNF receptor superfamily, member 6)−1.684.22E-04329.27
BC065002EXD3Exonuclease 3′-5′ domain containing 3−2.045.19E-04349.20
NM_004931CD8BCD8b molecule−1.246.82E-04378.73
NM_021635PBOV1Prostate and breast cancer overexpressed 1−1.177.31E-04386.63
NM_000093COL5A1Collagen, type V, α1−1.678.08E-04398.60
NM_000429MAT1AMethionine adenosyltransferase I, α−1.678.43E-04403.54
NM_000033ABCD1ATP-binding cassette, sub-family D (ALD), member 1−1.698.92E-04411.33
NM_000125ESR1Estrogen receptor 1−1.678.95E-04411.64
NM_000808GABRA3γ-Aminobutyric acid (GABA) A receptor, α3−1.609.27E-04415.96
NM_000595LTALymphotoxin-α (TNF superfamily, member 1)−1.639.95E-04427.69
NM_000197HSD17B3Hydroxysteroid (17-β) dehydrogenase 3−1.671.04E-03432.79
NM_001037442RUFY3RUN and FYVE domain containing 3−1.541.05E-03434.60
NM_000545HNF1AHNF1 homeobox A−1.641.07E-03437.31
NM_001005490OR6C74Olfactory receptor, family 6, subfamily C, member 74−1.591.09E-03439.40
NM_001031848SERPINB8Serpin peptidase inhibitor, clade B (ovalbumin), member 8−1.541.15E-03447.15
NM_000612IGF2Insulin-like growth factor 2 (somatomedin A)−1.631.16E-03448.01
NM_000517HBA2Hemoglobin, α2−1.641.19E-03451.63
NM_001130861CLDN5Claudin 5−1.441.24E-03458.33
NM_001004688OR2M2Olfactory receptor, family 2, subfamily M, member 2−1.591.24E-03458.57
NM_001030004HNF4AHepatocyte nuclear factor 4, α−1.561.26E-03460.62
NM_001033952CALCACalcitonin-related polypeptide α−1.541.26E-03461.21
NM_001010870TDRD6Tudor domain containing 6−1.581.32E-03466.23
NM_001018025MTCP1Mature T cell proliferation 1−1.571.41E-03475.20
NM_001012967DDX60LDEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like−1.571.41E-03475.20
NM_001085SERPINA3Serpin peptidase inhibitor, clade A (α-1 antiproteinase, antitrypsin), member 3−1.491.42E-03476.63
NM_000633BCL2B-cell CLL/lymphoma 2−1.631.45E-03479.53
NM_001037666GATSL3GATS protein-like 3−1.521.52E-03486.52
NM_001165BIRC3Baculoviral IAP repeat containing 3−1.421.58E-03491.86
NM_002247KCNMA1Potassium large conductance calcium-activated channel, subfamily M, α member 1−1.331.94E-03521.16
NM_173625C17ORF78Chromosome 17 open reading frame 78−1.011.95E-03521.61
NM_001124759FRG2CFSHD region gene 2 family, member C−1.442.00E-03524.95
NM_001080453INTS1Integrator complex subunit 1−1.512.00E-03524.88
NM_004613TGM2Transglutaminase 2 (C polypeptide, protein-glutamine-γ-glutamyltransferase)−1.242.14E-03536.10
NM_001044392MUC1Mucin 1, cell surface-associated−1.512.31E-03548.26
NM_001195127WI2-2373I1.2Forkhead box L1-like−1.392.41E-03556.59
NM_001243042HLA-CMajor histocompatibility complex, class I, C−1.382.43E-03558.50
NM_001083602PTCH1Patched 1−1.492.58E-03570.46
NM_207352CYP4V2Cytochrome P450, family 4, subfamily V, polypeptide 2−0.862.71E-03579.03
NR_029392KRT16P2Keratin 16 pseudogene 2−0.542.97E-03594.00
NM_001172646PLCB4Phospholipase C, β4−1.393.03E-03598.52
NM_002089CXCL2Chemokine (C-X-C motif) ligand 2−1.343.39E-03620.43
NM_001496GFRA3GDNF family receptor α3−1.383.40E-03620.75
NM_001668ARNTAryl hydrocarbon receptor nuclear translocator−1.373.42E-03622.12
NM_021151CROTCarnitine O-octanoyltransferase−1.183.47E-03624.70
NM_001949E2F3E2F transcription factor 3−1.363.53E-03628.70
NM_002307LGALS7Lectin, galactoside-binding, soluble, 7−1.323.56E-03630.07
NM_001704BAI3Brain-specific angiogenesis inhibitor 3−1.373.57E-03630.78
NM_001978DMTNErythrocyte membrane protein band 4.9 (dematin)−1.353.62E-03633.47
NM_183001SHC1SHC (Src homology 2 domain containing) transforming protein 1−0.903.64E-03634.32
NM_001185156IL24Interleukin 24−1.393.71E-03637.18
NM_004048B2Mβ-2-microglobulin−1.273.73E-03637.88
NM_001004456OR1M1Olfactory receptor, family 1, subfamily M, member 1−1.603.85E-03644.36
NM_002133HMOX1Heme oxygenase (decycling) 1−1.333.97E-03649.35
NM_002457MUC2Mucin 2, oligomeric mucus/gel-forming−1.314.02E-03651.72
NM_001198PRDM1PR domain containing 1, with ZNF domain−1.394.05E-03653.14
NM_001136022NFATC4Nuclear factor of activated T cells, cytoplasmic, calcineurin-dependent 4−1.434.06E-03653.68
NM_001454FOXJ1Horkhead box J1−1.384.11E-03656.34
NM_002006FGF2Fibroblast growth factor 2 (basic)−1.354.11E-03656.64
NM_177996EPB41L1Erythrocyte membrane protein band 4.1-like 1−0.974.19E-03659.94
NM_004417DUSP1Dual specificity phosphatase 1−1.254.38E-03669.42
NM_201282EGFREpidermal growth factor receptor−0.884.53E-03676.59
NM_004416DTX1Deltex homolog 1 (Drosophila)−1.254.68E-03682.88
NM_003128SPTBN1Spectrin, β, non-erythrocytic 1−1.294.75E-03685.70
NM_001807CELCarboxyl ester lipase (bile salt-stimulated lipase)−1.364.94E-03693.06
NM_207336ZNF467Zinc finger protein 467−0.864.95E-03693.44
NM_002381MATN3Matrilin 3−1.325.00E-03695.99
NM_002317LOXLysyl oxidase−1.325.00E-03696.01
NM_024766CAMKMTCalmodulin-lysine N-methyltransferase−1.155.07E-03699.15
NM_003667LGR5Leucine-rich repeat containing G protein-coupled receptor 5−1.295.27E-03707.84
NM_002535OAS22′-5′-Oligoadenylate synthetase 2, 69/71 kDa−1.305.27E-03708.15
NM_145041TMEM106ATransmembrane protein 106A−1.105.27E-03708.30
NM_003061SLIT1Slit homolog 1 (Drosophila)−1.305.36E-03711.28
NM_013292MYLPFMyosin light chain, phosphorylatable, fast skeletal muscle−1.215.40E-03712.71
NM_004310RHOHRas homolog gene family, member H−1.265.55E-03719.34
NM_002483CEACAM6Carcinoembryonic antigen-related cell adhesion molecule 6−1.305.71E-03725.32
NM_005531IFI16Interferon, γ-inducible protein 16−1.235.87E-03732.01
NM_133471PPP1R18Protein phosphatase 1, regulatory subunit 18−1.135.88E-03732.45
NM_006398UBDUbiquitin D−1.225.89E-03732.86
NM_004994MMP9Matrix metallopeptidase 9 (gelatinase B, 92 kDa gelatinase, 92 kDa type IV collagenase)−1.245.90E-03733.00
NR_003531MEG3Maternally expressed 3 (non-protein coding)−0.795.98E-03736.40
NM_012171TSPAN17Tetraspanin 17−1.226.10E-03741.06
NM_032599FAM71F1Family with sequence similarity 71, member F1−1.146.13E-03742.39
NM_019074DLL4δ-like 4 (Drosophila)−1.196.16E-03743.53
NM_002405MFNGMFNG O-fucosylpeptide 3-β-N-acetylglucosaminyltransferase−1.316.30E-03749.05
NM_015000STK38LSerine/threonine kinase 38-like−1.216.32E-03750.10
NM_018416FOXJ2Forkhead box J2−1.206.36E-03751.65
NM_016135ETV7Ets variant 7−1.216.38E-03752.29
NM_015886PI15Peptidase inhibitor 15−1.216.39E-03752.62
NM_002543OLR1Oxidized low density lipoprotein (lectin-like) receptor 1−1.306.40E-03752.88
NM_005023PGGT1BProtein geranylgeranyltransferase type I, β-subunit−1.246.53E-03757.78
NM_172390NFATC1Nuclear factor of activated T cells, cytoplasmic, calcineurin-dependent 1−1.026.57E-03759.52
NM_017766CASZ1Castor zinc finger 1−1.206.78E-03767.06
NM_144633KCNH8Potassium voltage-gated channel, subfamily H (eag-related), member 8−1.126.86E-03770.19
NM_025125TMEM254Chromosome 10 open reading frame 57−1.146.87E-03770.43
NM_182909FILIP1LFilamin A interacting protein 1-like−0.926.89E-03771.28
NM_173503EFCAB3EF-hand calcium binding domain 3−1.026.92E-03772.10
NM_144673CMTM2CKLF-like MARVEL transmembrane domain containing 2−1.126.95E-03773.54
NM_021819LMAN1LLectin, mannose-binding, 1-like−1.176.95E-03773.62
NM_022804SNURFSNRPN upstream reading frame−1.166.99E-03775.02
NM_021633KLHL12Kelch-like 12 (Drosophila)−1.177.01E-03775.60
NM_021966TCL1AT cell leukemia/lymphoma 1A−1.167.23E-03782.50
NM_032637SKP2S phase kinase-associated protein 2 (p45)−1.147.27E-03784.16
NM_022648TNS1Tensin 1−1.167.32E-03785.88
NM_004213SLC28A1Solute carrier family 28 (sodium-coupled nucleoside transporter), member 1−1.277.46E-03790.45
NM_033088STRIP1Family with sequence similarity 40, member A−1.147.49E-03791.43
NM_022304HRH2Histamine receptor H2−1.167.62E-03796.01
NM_021105PLSCR1Phospholipid scramblase 1−1.187.65E-03797.28
NM_024768EFCC1Coiled-coil domain containing 48−1.157.66E-03797.48
NM_006290TNFAIP3Tumor necrosis factor, α-induced protein 3−1.227.68E-03798.22
NM_030639BHLHB9Basic helix-loop-helix domain containing, class B, 9−1.147.69E-03798.53
NM_004246GLP2RGlucagon-like peptide 2 receptor−1.267.79E-03802.00
NM_032873UBASH3BUbiquitin-associated and SH3 domain containing B−1.147.79E-03802.14
NM_001963EGFEpidermal growth factor−1.357.84E-03803.92
NM_052904KLHL32Kelch-like 32 (Drosophila)−1.137.89E-03805.79
NM_006125ARHGAP6Rho GTPase activating protein 6−1.237.90E-03806.11
NM_032772ZNF503Zinc finger protein 503−1.147.95E-03807.90
NM_024886C10orf95Chromosome 10 open reading frame 95−1.157.99E-03809.09
NM_152703SAMD9LSterile α motif domain containing 9-like−1.098.02E-03809.77
NM_032752ZNF496Zinc finger protein 496−1.148.03E-03810.31
NM_138456BATF2Basic leucine zipper transcription factor, ATF-like 2−1.138.04E-03810.45
NM_172370DAOAD-amino acid oxidase activator−1.048.07E-03811.67
NM_005747CELA3AChymotrypsin-like elastase family, member 3A−1.238.07E-03811.75
NM_033101LGALS12Lectin, galactoside-binding, soluble, 12−1.148.14E-03813.87
NM_012224NEK1NIMA (never in mitosis gene a)- related kinase 1−1.218.21E-03816.40
NM_020436SALL4Sal-like 4 (Drosophila)−1.198.31E-03819.74
NM_138980MAPK10Mitogen-activated protein kinase 10−1.138.34E-03820.62
NM_020896OSBPL5Oxysterol binding protein-like 5−1.188.41E-03822.84
NM_052897MBD6Methyl-CpG binding domain protein 6−1.148.52E-03826.04
NM_207419C1QTNF8C1q and tumor necrosis factor related protein 8−0.828.58E-03827.94
NM_005933KMT2Amyeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)−1.238.59E-03828.40
NM_181712KANK4KN motif and ankyrin repeat domains 4−0.968.61E-03828.96
NM_017777MKS1Meckel syndrome, type 1−1.208.61E-03829.20
NM_176677NHLRC4NHL repeat containing 4−0.998.67E-03831.05
NM_025130HKDC1Hexokinase domain containing 1−1.148.71E-03832.53
NM_017654SAMD9Sterile α motif domain containing 9−1.218.92E-03838.42
NM_052864TIFATRAF-interacting protein with forkhead-associated domain−1.148.94E-03838.99
NM_015569DNM3Dynamin 3−1.218.95E-03839.17
NM_139047  Mitogen-activated protein kinase 8−1.128.99E-03840.70
NM_207173NPSR1Neuropeptide S receptor 1−0.879.03E-03841.91
NM_015444TMEM158Transmembrane protein 158 (gene/pseudogene)−1.219.03E-03841.90
NM_017523XAF1XIAP-associated factor 1−1.219.10E-03844.23
NM_006931SLC2A3Solute carrier family 2 (facilitated glucose transporter), member 3−1.229.11E-03844.45
NM_019018FAM105AFamily with sequence similarity 105, member A−1.199.13E-03845.15
NM_153042KDM1BLysine (K)-specific demethylase 1B−1.089.18E-03846.40
NM_033056PCDH15Protocadherin-related 15−1.149.23E-03848.31
NM_014157CCDC113Coiled-coil domain containing 113−1.219.25E-03848.53
NM_144962PEBP4Phosphatidylethanolamine-binding protein 4−1.129.31E-03850.61
NM_145862CHEK2Checkpoint kinase 2−1.099.36E-03852.29
NM_182524ZNF595Zinc finger protein 595−0.939.41E-03853.59
NM_014858TMCC2Transmembrane and coiled-coil domain family 2−1.219.46E-03855.35
NM_144990SLFNL1Schlafen-like 1−1.119.47E-03855.60
NM_022147RTP4Receptor (chemosensory) transporter protein 4−1.169.49E-03856.25
NM_022873IFI6Interferon, α-inducible protein 6−1.169.73E-03863.03
NM_152685SLC23A1Solute carrier family 23 (nucleobase transporters), member 1−1.099.73E-03863.10
NM_152278TCEAL7Transcription elongation factor A (SII)-like 7−1.099.84E-03866.45
NM_019035PCDH18Protocadherin 18−1.199.95E-03869.75
NM_153183NUDT10Nudix (nucleoside diphosphate linked moiety X)-type motif 10−1.079.99E-03870.83
Table III.

Significant functional categories of upregulated and downregulated genes.

A, Upregulated genes

P-valueBonferroniBenjaminiFDR
GO category
  Cell fate commitment7.2E-078.9E-048.9E-041.2E-03
  Negative regulation of cell differentiation2.9E-053.5E-021.2E-024.7E-02
  Differentiation6.8E-051.7E-021.7E-028.8E-02
  Developmental protein9.2E-052.4E-021.2E-021.2E-01
  Notch signaling pathway1.0E-042.6E-028.7E-031.3E-01
  Intestine2.4E-046.0E-021.5E-023.1E-01
KEGG pathway
  Notch signaling pathway3.5E-052.7E-032.7E-033.7E-02
B, Downregulated genes
GO category
  Regulation of cell death5.9E-079.2E-044.6E-049.8E-04
  Regulation of cell proliferation1.8E-042.4E-011.9E-022.9E-01
  Regulation of cell migration2.0E-042.7E-011.9E-023.3E-01
KEGG pathway
  Pathways in cancer1.9E-041.6E-021.6E-022.1E-01

GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; FDR, false discovery rate.

Given the finding of downregulated genes in the cell migration category, we performed migration ‘scratch’ assays in the HT-29 and HCT116 cell lines overexpressing MT1G, and found in both cell lines a statistically significant reduction in migration rates upon MT1G overexpression (Fig. 2A and B). Gelatin zymography using conditioned media from these cells, however, revealed no differences in MMP2 activity (Fig. 2C).
Figure 2.

Wound healing ‘scratch’ assays in (A) HT-29 and (B) HCT116 MT1G+ cells showing decreased migration capacity, but no difference in MMP2 activity as measured by (C) gelatin zymography; *p<0.05, **p<0.01 and ***p<0.001.

Next, in order to further investigate the involvement of MT1G in the differentiation of HT-29 cells, we used two different and well-known cell culture conditions to stimulate the in vitro differentiation of these cells: sodium butyrate (BUT) treatment (19) and post-confluent cell growth (20). We used TFF3 and MUC2 mRNA expression as surrogate markers for the goblet cell lineage, and HSI and CA1 mRNAs, along with enzymatic alkaline-phosphatase activity (ALP) for enterocytes.

Involvement of MT1G in butyrate-mediated differentiation of HT-29 cells

Sodium butyrate is a well-known inducer of differentiation in CRC cell lines (21), and indeed, as shown in Fig. 3A, treatment with this agent dose-dependently induced differentiation as assessed by ALP activity. Concordantly, this agent also induced MT1G and MT2A mRNA levels, in close correlation to ALP activity (Pearson r=0.993, p=0.007 for MT1G and r=0.999, p=0.0006 for MT2A; Fig. 3B). To determine whether the induction of MTs has a functional role in butyrate-induced differentiation, we used siRNAs to inhibit the induction of only MT1G (si1G.1 and si1G.2) or of all MT1 and MT2 isoforms (siMTs), as previously described (12). Fig. 3C shows that siRNA pre-treatment partially mitigated MT1G induction after BUT treatment and markedly, also diminished the induction of CDX2 (Fig. 3D), and of goblet-cell marker TFF3 (Fig. 3E). Notably, BUT treatment had no effect on mRNA levels of MUC2, as has been previously reported by others (17) (data not shown). In contrast, although the enterocyte-specific markers HSI and CA1 were markedly upregulated at 2 mM BUT, silencing of MTs had no effect on their induction (Fig. 3F and G), or on the cell-cycle arrest mediator CDKN1A/p21 (data not shown), whereas ALP activity was only slightly, but significantly reduced (Fig. 3H).
Figure 3.

Butyrate mediates the differentiation of HT-29 cells. (A) Assessment of ALP enzymatic activity, 72 h after treatment. (B) Induction of MT1G and MT2A mRNA expression measured by qRT-PCR 72 h after treatment. (C-G) Expression of MT1G, CDX2, TFF3, HSI and CA1 as well as (H) ALP activity after siRNA-mediated silencing of MT1G or all MTs. AFC, average fold-change; *p<0.05, **p<0.01 and ***p<0.001.

We next treated HT-29 MOCK and MT1G+ cells with butyrate. Notably, as depicted in Fig. 4A, whereas CDX2 mRNA levels were similarly induced, MT1G overexpression markedly enhanced the induction of TFF3 (Fig. 4B), whereas it blunted that of HSI (Fig. 4C). Therefore, both silencing and overexpression of MT1G support the hypothesis that this gene favors goblet over enterocyte differentiation upon butyrate treatment of HT-29 cells.
Figure 4.

(A) CDX2, (B) TFF3 and (C) HSI expression in MOCK and MT1G+ cells upon butyrate treatment. AFC, average fold-change; *p<0.05, **p<0.01 and ***p<0.001.

Involvement of MT1G in post-confluent differentiation of HT-29 cells

Next, we studied the expression of MT1G in the post-confluent growth of HT-29 cells, where this cell line is known to differentiate poorly (20). In this setting, MT1G mRNA was transiently induced at day 1 post-confluence, after which its expression was significantly reduced (Fig. 5A). In contrast, CDX2 and enterocyte-specific genes HSI and CA1 were transiently induced at day 3, two days after MT1G induction (Fig. 5B-D). Notably, TFF3 expression mirrors MT1G expression, until day 14 when it is induced again (Fig. 5E). These time-course analyses again favored the association of MT1G induction with goblet over enterocyte differentiation. Notably, as with BUT treatment, MUC2 expression was not altered in this context (Fig. 5F). We were unable to perform siRNA-mediated silencing of MT1G in this setting, as cells did not survive in a totally confluent state for >1 day after transfection.
Figure 5.

Expression of (A) MT1G, (B) CDX2, (C) HIS, (D) CA1, (E) TFF3 and (F) MUC2 upon differentiation stimulated by post-confluent growth of HT-29 cells. AFC, average fold-change; *p<0.05, **p<0.01 and ***p<0.001.

When growing HT-29 MOCK and MT1G+ cells post-confluence, we noted no difference in the induction of ALP activity between these two cell lines (Fig. 6A). Notably however, in the latter, CDX2 mRNA was induced at significantly higher levels (Fig. 6B) whereas HSI induction was abolished (Fig. 6C). While we noted no differences in the induction of TFF3 mRNA (data not shown), our data also implies a role for MT1G expression in counteracting enterocyte differentiation of HT-29 cells.
Figure 6.

Effects of stable MT1G expression on post-confluent growth of HT-29 cells. (A) ALP activity. (B) CDX2 and (C) HSI expression. AFC, average fold-change; *p<0.05, **p<0.01 and ***p<0.001.

Labile zinc levels in butyrate-treated and post-confluent HT-29 cells

Given the close relationship between MTs and zinc biology, we analyzed the levels of intracellular labile zinc in both models of differentiation, using the zinc-specific fluorophore FZ. Notably, after 72 h of 2 mM BUT treatment, FZ intensity was significantly induced in the HT-29 cells (Fig. 7A). We used TPEN treatment to chelate intracellular labile zinc before the addition of butyrate, and found that this abolished both CDX2 and HSI mRNA induction (Fig. 7B and C), but had no effect on TFF3 levels (Fig. 7D). In the post-confluence model, as shown by fluorescence microscopy in Fig. 7E and by fluorimetry in Fig. 7F, FZ intensity was induced at day 2 and progressively increased thereafter. Given that TPEN exposure for >6 h is toxic to HT-29 cells, we used daily 5-h TPEN treatments to evaluate the effect of labile zinc on goblet and enterocyte markers. Notably, TFF3 mRNA expression was significantly induced at days 1–3 post-confluence in TPEN-treated cells (Fig. 7G), whereas there was no effect on either CDX2 or HSI levels (not shown).
Figure 7.

Labile zinc induction upon differentiation. (A) Butyrate induces intracellular labile zinc levels in HT-29 cells, as measured by fluorimetry using the Fluozin-3AM (FZ) probe. (B and C) Both CDX2 and HSI induction by butyrate are blunted by TPEN pre-treatment, whereas there is no effect on (D) TFF3 expression. (E and F) Labile zinc levels are also increased in the post-confluency differentiation model of HT-29 cells, as measured by (E) epifluorescence microscopy (F) and fluorimetry. (G) Daily doses of TPEN stimulate TFF3 expression of post-confluent cultures. AFC, average fold-change; *p<0.05, **p<0.01 and ***p<0.001.

In summary, labile zinc was induced in both models of intestinal differentiation, and its chelation by TPEN treatment either inhibited enterocyte differentiation (butyrate model) or induced the expression of goblet-cell markers (post-confluency model).

Discussion

In the present study, we uncovered a new role for MT1G in altering the differentiation properties of the HT-29 cell line. We previously showed that induction of MTs by HDACi agents such as trichostatin A and sodium butyrate (BUT) is at least partly responsible for their cytostatic effects on human CRC cell lines, and that exogenous MT1G overexpression in the colorectal HCT116 cell line resulted in growth inhibition in nude mouse xenografts (12). Notably, whereas MT1G overexpression did not alter the in vivo xenograft growth rate of HT-29 cells, it markedly increased the number of goblet cells and differentiation markers of these tumors, both of the goblet and the enterocyte lineages. These effects were not readily observed in 2D culture (data not shown), suggesting that additional signals from the tumor microenvironment may be needed to fulfill this effect. The reasons for the different observed phenotypic consequences of MT1G overexpression in these two cell lines are unclear, but a possible explanation may stem from the differences in endogenous MT1G expression: HCT116 cells do not express MT1G due to promoter hypermethylation and therefore the impact of MT1G overexpression may be stronger than that in HT-29 cells, which express low, but detectable mRNA levels (8). In an effort to understand the molecular mechanisms underlying the altered differentiation of MT1G+ tumors, we performed mRNA expression profiling by cDNA microarrays. The expression of several genes involved in the regulation of cell differentiation was found to be altered, particularly in the Notch signaling pathway, whose inhibition is well known to stimulate goblet cell differentiation in the intestine through activation of ATOH1 (22). Notably, markers of different sets of intestinal stem cell markers were differentially dysregulated in MT1G+ tumors, with upregulation of HOPX (expressed in quiescent stem cells) and downregulation of Lgr5 (in crypt base columnar stem cells), again suggesting altered differentiation hierarchies (23,24). Further studies are warranted to explore this in further detail. To further characterize the involvement of MT1G in colorectal differentiation, we relied on two well-studied cell culture conditions: sodium butyrate and post-confluent growth. We showed that endogenous MT1G induction was required for the induction of goblet cell markers by butyrate, and was temporally associated with such markers in the confluency model. Moreover, stable exogenous MT1G overexpression favored goblet and blunted enterocyte differentiation in both models. Previous studies have shown MTs to be upregulated in vitro upon CRC differentiation (25), and demonstrated a role for MTs in modulating differentiation in different tissues, such as human salivary gland tumor cells (where MT1F overexpression resulted in slower growing and more differentiated tumors) (26), leukemic (27) neurons and glial (28), and T cells (29). However, to the best of our knowledge, this is the first study showing a direct functional involvement of a metallothionein isoform in CRC differentiation. Labile zinc ions have been recognized as secondary messengers capable of transducing a wide variety of intracellular signals (30,31), including differentiation (32–34). MTs can regulate labile zinc concentrations and zinc transfer to different cellular organelles (35), as well as respond to changes in intracellular zinc ions (36). We showed in the present study that labile zinc was increased during differentiation induced both by butyrate and confluency, and that this was required for enterocyte differentiation by butyrate, whereas it blunted goblet marker induction in post-confluency. While the reason behind the differences observed in both models are unclear, the overall effects of zinc induction favor an enterocyte over goblet differentiation. Notably, although labile zinc increases have already been reported to occur during butyrate-mediated differentiation of the HT-29 cell line and have been associated to defined stages of the cell cycle (37), in the present study, we reported for the first time a functional consequence of labile zinc induction in this process. Previous studies in other tissues have shown that MTs transiently translocate to the nucleus during early phases of differentiation to release the zinc ions necessary for zinc-dependent transcription factors to execute the differentiation programs of adipocytes and myoblasts (38,39). Although we previously showed that MTs in HT-29 are localized to the cytoplasm (8), we were not able to detect a nuclear shift in either of the differentiation models that we used in the present study (data not shown), although this possibility should be studied in further detail. Taking into account our results, we hypothesize that MT1G induction during differentiation may play a role in the chelation and re-distribution of intracellular labile zinc, perhaps modulating the activity of zinc-requiring transcription factors and enzymes, and stimulating the differentiation program of colorectal cells. In vitro, our results showed that MT1G favors a goblet over enterocyte differentiation, although our mouse xenografts assays suggest that in vivo the differentiation into enterocytes is also stimulated, perhaps as a compensatory mechanism or in a non-cell autonomous manner. The precise mechanisms whereby this occurs and the participation of MT1G (and other MTs) in labile zinc redistribution during differentiation need to be studied in further detail. Moreover, tumor classifications based on gene signatures associated with different cell types suggest that tumors of the more differentiated ‘goblet-’ or ‘enterocyte-like’ subtypes have a better prognosis than undifferentiated ‘stem-like’ subtype, as well as different responses to therapeutic agents. Therefore, better understanding of the molecular mechanisms that govern the differentiation processes of tumor cells may be of clinical relevance. Overall, in the present study, we unveiled a pro-differentiation effect of MT1G on various CRC cells, thus proposing a new mechanism whereby MT1G may act as a tumor suppressor in this tumor type. Moreover, we established a functional consequence of transient increases in labile zinc upon differentiation stimuli, and support the need of further studies relating zinc signaling and differentiation, that may ultimately underlie tumor cell phenotypes and response to therapies.
  38 in total

1.  Transient peaks in zinc and metallothionein levels during differentiation of 3T3L1 cells.

Authors:  C Schmidt; D Beyersmann
Journal:  Arch Biochem Biophys       Date:  1999-04-01       Impact factor: 4.013

2.  Decreased activity of inducible nitric oxide synthase type 2 and modulation of the expression of glutathione S-transferase alpha, bcl-2, and metallothioneins during the differentiation of CaCo-2 cells.

Authors:  F Vecchini; E Pringault; T R Billiar; D A Geller; P Hausel; E Felley-Bosco
Journal:  Cell Growth Differ       Date:  1997-02

3.  Metallothionein 1G and zinc sensitize human colorectal cancer cells to chemotherapy.

Authors:  Juan M Arriaga; Angela Greco; José Mordoh; Michele Bianchini
Journal:  Mol Cancer Ther       Date:  2014-03-14       Impact factor: 6.261

4.  Zinc-buffering capacity of a eukaryotic cell at physiological pZn.

Authors:  Artur Krezel; Wolfgang Maret
Journal:  J Biol Inorg Chem       Date:  2006-08-19       Impact factor: 3.358

5.  A colorectal cancer classification system that associates cellular phenotype and responses to therapy.

Authors:  Anguraj Sadanandam; Costas A Lyssiotis; Krisztian Homicsko; Eric A Collisson; William J Gibb; Stephan Wullschleger; Liliane C Gonzalez Ostos; William A Lannon; Carsten Grotzinger; Maguy Del Rio; Benoit Lhermitte; Adam B Olshen; Bertram Wiedenmann; Lewis C Cantley; Joe W Gray; Douglas Hanahan
Journal:  Nat Med       Date:  2013-04-14       Impact factor: 53.440

6.  Loss of pluripotency in human embryonic stem cells directly correlates with an increase in nuclear zinc.

Authors:  Janet L Wolford; Yasmin Chishti; Qiaoling Jin; Jesse Ward; Liaohai Chen; Stefan Vogt; Lydia Finney
Journal:  PLoS One       Date:  2010-08-20       Impact factor: 3.240

7.  Identification of genes responsive to intracellular zinc depletion in the human colon adenocarcinoma cell line HT-29.

Authors:  Birgit Kindermann; Frank Döring; Michael Pfaffl; Hannelore Daniel
Journal:  J Nutr       Date:  2004-01       Impact factor: 4.798

Review 8.  Metallothioneins and cancer.

Authors:  Tomas Eckschlager; Vojtech Adam; Jan Hrabeta; Katarina Figova; Rene Kizek
Journal:  Curr Protein Pept Sci       Date:  2009-08       Impact factor: 3.272

9.  Patterns of expression of lineage-specific markers during the in vitro-induced differentiation of HT29 colon carcinoma cells.

Authors:  A Velcich; L Palumbo; A Jarry; C Laboisse; J Racevskis; L Augenlicht
Journal:  Cell Growth Differ       Date:  1995-06

10.  Enterocytic differentiation of a subpopulation of the human colon tumor cell line HT-29 selected for growth in sugar-free medium and its inhibition by glucose.

Authors:  A Zweibaum; M Pinto; G Chevalier; E Dussaulx; N Triadou; B Lacroix; K Haffen; J L Brun; M Rousset
Journal:  J Cell Physiol       Date:  1985-01       Impact factor: 6.384

View more
  8 in total

1.  Identification of 10 Hub genes related to the progression of colorectal cancer by co-expression analysis.

Authors:  Jie Meng; Rui Su; Yun Liao; Yanyan Li; Ling Li
Journal:  PeerJ       Date:  2020-07-28       Impact factor: 2.984

Review 2.  The roles of metallothioneins in carcinogenesis.

Authors:  Manfei Si; Jinghe Lang
Journal:  J Hematol Oncol       Date:  2018-08-23       Impact factor: 17.388

3.  Metallothionein Genes are Highly Expressed in Malignant Astrocytomas and Associated with Patient Survival.

Authors:  Bernadeta Masiulionytė; Indrė Valiulytė; Arimantas Tamašauskas; Daina Skiriutė
Journal:  Sci Rep       Date:  2019-04-01       Impact factor: 4.379

4.  Identification of Hub Genes Related to Carcinogenesis and Prognosis in Colorectal Cancer Based on Integrated Bioinformatics.

Authors:  Benjiao Gong; Yanlei Kao; Chenglin Zhang; Fudong Sun; Zhaohua Gong; Jian Chen
Journal:  Mediators Inflamm       Date:  2020-04-09       Impact factor: 4.711

5.  Metallothionein-1G suppresses pancreatic cancer cell stemness by limiting activin A secretion via NF-κB inhibition.

Authors:  Kai Li; Zhicheng Zhang; Yu Mei; Qingzhu Yang; Shupei Qiao; Cheng Ni; Yao Yao; Xinyuan Li; Mengmeng Li; Dongdong Wei; Wangjun Fu; Xuefei Guo; Xuemei Huang; Huanjie Yang
Journal:  Theranostics       Date:  2021-01-01       Impact factor: 11.556

6.  Effect of Tff3 Deficiency and ER Stress in the Liver.

Authors:  Kate Šešelja; Iva Bazina; Jessica Welss; Martin Schicht; Friedrich Paulsen; Nikola Bijelić; Edi Rođak; Anita Horvatić; Andrea Gelemanović; Martina Mihalj; Mirela Baus Lončar
Journal:  Int J Mol Sci       Date:  2019-09-06       Impact factor: 5.923

7.  Expression of Metallothionein after Administration of Aspirin, Vitamin C or Zinc Supplement in the DMH Induced Colon Carcinoma in Rat

Authors:  Pamela Christudoss; Geeta Chacko; Ratnasamy Selvakumar; Jude J Fleming; Srinivasan Pugazhendhi; George Mathew
Journal:  Asian Pac J Cancer Prev       Date:  2018-11-29

8.  Transcriptome analysis identifies metallothionein as biomarkers to predict recurrence in hepatocellular cacinoma.

Authors:  Sufang Wang; Michael Gribskov
Journal:  Mol Genet Genomic Med       Date:  2019-05-06       Impact factor: 2.183

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.