Yuehong Wu1, Ouyang Li1, Chengwen He2, Yong Li2, Min Li2, Xiaoming Liu Liu2, Yujiong Wang2, Yulong He1. 1. Department of Biochemistry and Molecular Biology, College of Life Science, Zhejiang Sci‑Tech University, Hangzhou, Zhejiang 310018, P.R. China. 2. Key Laboratory of Ministry of Education for Protection and Utilization of Special Biological Resources in Western China, Department of Biochemistry and Molecular Biology, College of Life Science, Ningxia University, Yinchuan, Ningxia 750021, P.R. China.
Abstract
Induced pluripotent stem cells (iPS) represent an important tool to develop disease‑modeling assays, drug testing assays and cell‑based replacement therapies. The application of iPS in these fields requires the development of suitable animal models. Of the suitable species, guinea pigs are particularly important and offer significant advantages. Successful iPS generation has been accomplished in a number of species; however, it has not been reported in the guinea pig. The present study successfully generated iPS from guinea pigs (giPS) using single polycistronic virus transduction with mouse octamer‑binding transcription factor 4 (Oct4), sex determining region Y‑box 2 (Sox2), Kruppel‑like factor 4 and c‑Myc. The giPS cell lines were cultured in media containing leukemia inhibitory factor and guinea pig fibroblast cells were used as feeder cells. These cultures were expanded under feeder‑free culture conditions using ESGRO Complete Plus Clonal Grade medium containing 15% fetal bovine serum on gelatin‑coated dishes. The resultant cells had a normal karyotype, exhibited alkaline phosphatase activity and expressed the pluripotency markers Oct4, Sox2 and Nanog. The cells differentiated in vivo to form teratomas that contained all three germ layers of the tissue cells. The generation of giPS may facilitate future studies investigating the mechanisms underlying innate immunity, particularly for tuberculosis. These experiments provide proof of principle that iPS technology may be adapted to use the guinea pig as a model of human diseases.
Induced pluripotent stem cells (iPS) represent an important tool to develop disease‑modeling assays, drug testing assays and cell‑based replacement therapies. The application of iPS in these fields requires the development of suitable animal models. Of the suitable species, guinea pigs are particularly important and offer significant advantages. Successful iPS generation has been accomplished in a number of species; however, it has not been reported in the guinea pig. The present study successfully generated iPS from guinea pigs (giPS) using single polycistronic virus transduction with mouse octamer‑binding transcription factor 4 (Oct4), sex determining region Y‑box 2 (Sox2), Kruppel‑like factor 4 and c‑Myc. The giPS cell lines were cultured in media containing leukemia inhibitory factor and guinea pig fibroblast cells were used as feeder cells. These cultures were expanded under feeder‑free culture conditions using ESGRO Complete Plus Clonal Grade medium containing 15% fetal bovine serum on gelatin‑coated dishes. The resultant cells had a normal karyotype, exhibited alkaline phosphatase activity and expressed the pluripotency markers Oct4, Sox2 and Nanog. The cells differentiated in vivo to form teratomas that contained all three germ layers of the tissue cells. The generation of giPS may facilitate future studies investigating the mechanisms underlying innate immunity, particularly for tuberculosis. These experiments provide proof of principle that iPS technology may be adapted to use the guinea pig as a model of human diseases.
Technologies for reprogramming differentiated cells into a pluripotent cell line have provided a novel perspective into regenerative medicine. Induced pluripotent stem cells (iPS) represent a potential source for the development of disease-modeling assays, drug testing assays and cell-based replacement therapies. To date, iPS have been derived from a number of species, including mouse (1), human (2), rhesus monkey (3), rat (4), pig (5), dog (6), marmoset (7,8), sheep (9,10), bovine (11), buffalo (Bubalus bubalis) (12), equine (13) and bat (14). It has been recognized that iPS technology is one of the most promising methods for cell-based regenerative medicine therapies (2,15). Thus, suitable animal models are required. Of the species that may be useful, the guinea pig offers significant advantages.Over the past several decades, the guinea pig has been a widely used experimental animal model for the study of infectious disease, particularly Mycobacterium (M.) tuberculosis. The guinea pig is suitable for studies of M. tuberculosis as it is susceptible to human tubercle bacilli. There are a number of similarities between guinea pigs and humans, including the following: i) Newborn guinea pigs, like humaninfants, have a very mature lymphomyeloid complex; ii) hormone secretion and immunological responses in guinea pigs are more similar to humans than rodents; iii) guinea pigs, like humans, require an exogenous supply of ascorbic acid (vitamin C) in their diet; iv) guinea pigs, like humans and non-human primates, are corticosteroid-resistant; and v) humans and guinea pigs have similar physiological aspects of the pulmonary tract, particularly with regard to lung tissue responses to inflammatory stimuli (16). These similarities indicate that the guinea pig is a particularly useful model of humaninfectious disease.Guinea pigs have been widely used in to assess biological reagents and drugs utilized in tuberculosis (TB), particularly in the biological standardization of tuberculins used for skin testing. The development and preclinical testing of the bacillus Calmette-Guérin vaccine was primarily based on guinea pig models (16). Due to the response of the guinea pig to anti-TB antibiotics, the species has been used successfully to evaluate the efficacy of novel drugs and drug combinations. With the development of multi drug-resistant strains of M. tuberculosis, the guinea pig may be vital for the identification of novel and efficient anti-myobacterial drugs (16,17).Proliferation of guinea pig embryonic fibroblasts may be performed for only a limited number of passages (18); therefore, the successful generation of guinea pig iPS would provide a model to facilitate research at the cellular and molecular levels. To the best of our knowledge, there have been no previous reports of guinea pig embryonic stem cell (ESC) generation and, although ESCs have potential for future cell therapy and regenerative medicine, iPS technologies would have the specific advantages that: i) Derivatives of iPS may be suitable for regenerative medicine, avoiding ethical concerns and potential immune rejection; and ii) iPS may potentially be derived from donor individuals of differing ages, health status and genetic backgrounds. Therefore, the present study generated iPS from guinea pigs as an initial step towards the development of experimental cell therapy using autologous iPS from this species.
Materials and methods
Experimental animals
All animal procedures were approved by the Animal Care and Use Committee of the Zhejiang Sci-Tech University (Hangzhou, China). One guinea pig (Dunkin-Hartley; female; age, 1 year; 40 days pregnant; weight, 1,200 g) and 8 mice (BALB/c-nu; female; age, 6–8 weeks; weight, 18–25 g) were provided by the Laboratory Animal Center of Ningxia Medical University (Yinchuan, China) and the Laboratory Animal Center of Zhejiang University (Hangzhou, China). Animals were maintained at room temperature with normal humidity, and were given free access to food and water under a 12-h dark/light diurnal cycle.
Cell culture
Guinea pig iPS (giPS) were cultured on feeder layers of mitomycin C-treated guinea pig fibroblast cells. All reagents were purchased from Sigma Aldrich; Merck Millipore (Darmstadt, Germany) unless otherwise indicated. giPS were passaged every 3 days. giPS were cultured in KnockOut™ Dulbecco's modified Eagle's medium (DMEM) containing 0.5% glutamine, 1.0% nonessential amino acids, 1 mM sodium pyruvate, 0.1 mM β-mercaptoethanol, 15% ESC-qualified fetal bovine serum (FBS; SH30406.02E; HyClone; GE Healthcare Life Sciences, Logan, UT, USA), 100 U/ml penicillin, 100 mg/ml streptomycin (15070–063; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 1,000 U/ml mouseleukemia inhibitory factor (LIF; ESG1106; EMD Millipore, Billerica, MA, USA). To determine whether the giPS colonies could grow under feeder-free culture conditions, giPS were alternatively cultured in feeder-free culture conditions on gelatin-coated dishes using ESGRO Complete Plus Clonal Grade medium (SF001-500P; EMD Millipore) containing 15% FBS. giPS were cryopreserved in ESC-qualified fetal bovine serum containing 10% dimethyl sulfoxide (cell culture grade; A3672; AppliChem GmbH, Darmstadt, Germany). The 293FT packaging cells (Invitrogen; Thermo Fisher Scientific, Inc.) (19,20), which were used to produce lentiviruses, were cultured in DMEM containing 10% FBS, 50 U/ml penicillin and 50 mg/ml streptomycin.To isolate guinea pig fetal fibroblasts, a 40-day-pregnant guinea pig was washed with phosphate-buffered saline (PBS) followed by 75% alcohol. The animal was then sacrificed and a fetus was collected, and their heads and visceral tissues were removed. The remaining fetal tissues were washed in fresh PBS, transferred into a 0.1 mM trypsin/1 mM EDTA solution (3 ml mixture/embryo) and incubated at 37°C for 20 min. Following incubation, 3 ml 0.1 mM trypsin/1 mM EDTA solution was added to each embryo, and embryos were incubated at 37°C for 20 min. Following trypsinization, 6 ml DMEM containing 10% FBS was added to each embryo, pipetting up and down a few times to dissociate cells. Samples were incubated at room temperature for 5 min and transferred into a new tube. Cells were collected by room temperature centrifugation for 5 min at 1,000 × g, and then resuspended in fresh medium. For the first passage, 1×106 cells were cultured on 100-mm dishes at 37°C with 5% CO2. The present study used guinea pig fibroblasts at passages 3–5 to avoid replicative senescence.
Lentiviral infection and iPS cell derivation
To obtain high-quality fetal fibroblasts, guinea pig fibroblasts were isolated and morphologically characterized in vitro. The lentiviral plasmid, FUW-OSKM (Addgene plasmid no. 20328; www.addgene.org/20328/), which is a single polycistronic virus encoding octamer-binding transcription factor 4 (Oct4), sex determining region Y-box 2 (Sox2), Kruppel-like factor 4 (Klf4) and c-Myc, was donated by Dr. Rudolf Jaenisch (Massachusetts Institute of Technology, Cambridge, MA, USA) (15). giPS were generated from fibroblasts and used at passage3-5, as described by Carey et al (15). Briefly, 293FT cells were plated at a density of 2×106 cells per 60-mm dish. The following day, cells were transfected with 12 µg/ml FUW-OSKM as well as 9 µg/ml PsPAX2 and 3.6 µg/ml PMD.2G (PMD.2G encodes the viral protein V-G, and PsPAX2 is a packaging vector. These two plasmids were donated by Dr. Peter Hornsby (University of Texas Health Science Center at San Antonio) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Following transfection for 24 h, the supernatant of the transfectant was collected and filtered using a 0.45-mm pore-size Whatman® cellulose acetate filter (Sigma-Aldrich; Merck Millipore) and concentrated by centrifugation at 10,000 × g for 3 h at 4°C. Guinea pig fibroblasts were seeded at 4×105 cells per 35-mm dish and the following day the medium was replaced with virus-containing supernatant supplemented with 8 µg/ml polybrene (Nacalai Tesque, Inc., Kyoto, Japan) prior to incubation for 24 h; this process was repeated three times. A total of 12 h following the last infection, the medium was replaced with fibroblast culture medium. Fibroblasts were passaged using trypsin and plated at densities between 5×104 and 5×105 cells/10-cm on gelatin-coated dishes of guinea pig fibroblast feeder layers, following infection for 5 days. For reprogramming, the culture medium was replaced 24 h later by giPS medium in the presence of 1 mM valproic acid and 10 µg/ml vitamin C. The resultant giPS colonies were picked mechanically based on morphology and maintained according to previously used mouse iPS protocols (1). Colonies that were compact with clear edges were manually selected and expanded on guinea pig fibroblast feeder layers. One of the picked cell lines was selected for further study and passaged >30 times.
Western blot analysis
Cells were prepared and lysed using Qproteome Mammalian Protein Prep kit (Qiagen, Inc., Valencia, CA, USA), and protein concentrations were determined using the Bradford protein assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Equal amounts of total protein (60 µg/lane) were boiled in denaturing loading buffer (200 mM Tris-HCl at pH 6.8, 50% glycerol, 8% SDS, 400 mM DTT, 0.4% bromophenol blue), separated by 10% SDS-PAGE and subsequently transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad Laboratories, Inc.). The membranes were blocked in 5% non-fat milk powder in TBS containing 0.1% Tween-20 (TBST) at pH 7.6 following the protocol of the antibody manufacturer. PVDF membranes were incubated with the following primary antibodies following a brief wash in TBST: Rabbit anti-Nanog (1:1,000; 14295-1-AP), rabbit polyclonal β-actin (1:1,000; 20536-1-AP), rabbit anti-Sox2; 1:2,000; 11064-1-AP) and rabbit anti-Oct4; 1:500; 11263-1-AP), all purchased from ProteinTech Group, Inc., Chicago, IL, USA. Antibodies were diluted in 2% non-fat milk powder in TBST, and incubated overnight at 4°C. The membranes were subsequently incubated with horseradish peroxidase-conjugated anti-rabbit immunoglobulin (IgG) antibodies (1:2,000; SA00001-2; ProteinTech Group, Inc.) for 60 min at room temperature, followed by detection with an Enhanced Chemiluminescence reagent (GE Healthcare Life Sciences, Chalfont, UK). β-actin served as a loading control.
Alkaline phosphatase staining and immunocytochemistry for pluripotency markers
To assess alkaline phosphatase activity and expression of pluripotency markers in giPS, cells were washed three times in PBS, fixed in 4% paraformaldehyde at room temperature for 30 min and washed a further three times with PBS. For alkaline phosphatase analysis, cells were subsequently incubated with SIGMAFAST5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma-Aldrich; Merck Millipore), according to the manufacturer's protocol. For immunofluorescence, cells were incubated with the following primary antibodies: Rabbit anti-Oct4 (1:200), mouse anti-stage-specific embryonic antigen 1 (SSEA1; 1:100; ab16285; Abcam, Cambridge, UK), and rabbit anti-Nanog (1:200) and incubated at 4°C overnight. The following day, the cells were incubated at room temperature for 60 min with the following secondary antibodies: Goat anti-rabbit IgG (H+L)-fluorescein isothiocyanate conjugated or donkey anti-mouse IgG(H+L)-Alexa Fluor 555-labeled (A0562 and A0460; both from Beyotime Institute of Biotechnology, Haimen, China). Cells were counterstained with DAPI (C1005; Beyotime Institute of Biotechnology). Images were captured using a fluorescence microscope.
RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis
Total RNA was isolated using TRIzol® reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. RNA was prepared from guinea pig fibroblasts and mouse induced pluripotent stem cells (donated by Dr. Duanqing Pei; Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences) to serve as the control. A total of 500 ng RNA was treated using the DNaseI, RNase-free kit (Takara Biotechnology Co., Ltd., Dalian, China) to remove any potential genomic DNA contamination. The RevertAid First Strand cDNA Synthesis kit (Takara Biotechnology Co., Ltd.) was used to synthesize cDNA using a random hexamer primer, according to the manufacturer's protocol. qPCR reactions were performed in duplicate using the Power SYBR-Green Master mix (Takara Biotechnology Co., Ltd.), and the Bio-Rad iCycler iQ and iQ5 Real-Time PCR Detection system (Bio-Rad Laboratories, Inc.). The thermocycling conditions were as follows: Initial cycle at 95°C for 30 sec, followed by 40 cycles of 95°C denaturation for 5 sec, 60°C annealing for 30 sec and 72°C extension for 15 sec. Expression values were normalized to those of the β-actin housekeeping gene using the ΔΔCq method (21). Primer sequences are presented in Table I.
Table I.
Primer sequences for reverse transcription-quantitative polymerase chain reaction.
Gene
Sequence (5′-3′)
Size (bp)
Oct4
F: GCATACGAGTTCTGCGGAGGGAT
191
R: GGTTCCACCTTCTCCAACTTCACG
Sox2
F: ACAGATGCAACCGATGCACCGC
213
R: GCCCTGGAGTGGGAGGAAGAGGTAA
Nanog
F: GCCCTACACCGTCCTTTCG
170
R: GCCATTTCTTGCATTTCATTCTC
Tbx3
F: GGAGCAGTGGATGTCTAAAGTG
169
R: AGTCCGAAATGTACTATAAGGGAG
β-actin
F: AGACGAAGCCCAGAGCAAA
273
R: CCAGAGGCATACAGGGACAG
Oct4, octamer-binding transcription factor 4; Sox2, sex determining region Y-box 2; Tbx3, T-box 3; F, forward; R, reverse.
Karyotyping analysis
Karyotyping was performed using conventional techniques as described by Wu et al (22). Briefly, chromosomes were analyzed from actively proliferating cultures of giPS. Cells were treated with colchicine at 37°C for 6 h, trypsinized, centrifuged for 5 min at 1,000 × g at room temperature and incubated with 0.04 M KCI at 37°C for 20 min. The cells were subsequently fixed for 20 min using ice-cold 1:3 (v/v) acetic acid/methanol and collected. The resultant dispersed giPS suspension was smeared onto a cold slide, dried, stained with 10% Giemsa for 20 min at room temperature and observed microscopically.
Teratoma formation and hematoxylin and eosin (H&E) staining
To assess the differentiation potential of giPS, giPS were implanted into severe combined immunodeficientmice. A total of 2×106 cells were suspended in 100 µl culture medium containing 50% Matrigel (23,24) and injected subcutaneously into the mice. Mice injected with guinea pig fibroblast cells served as controls. A total of eight weeks later, mice were sacrificed. Tumors were collected, fixed in 4% paraformaldehyde and examined using conventional histological procedures (7). The H&E method was used to stain the sections (6 µm).
Statistical analysis
Data were presented as the mean ± standard deviation of three experiments with n=3 repeats. All statistical analyses were performed using SPSS version 13.0 (SPSS, Inc., Chicago, IL). One-way analysis of variance followed by Scheffe's post hoc test was used for analysis of multiple groups. An independent samples Student's t-test was used for comparison of two groups. P<0.01 was considered to indicate a statistically significant difference.
Results
Reprogramming of guinea pig fetal fibroblasts to giPS
Following the infection of guinea pig fibroblasts with a single polycistronic virus encoding Oct4, Sox2, Klf4 and c-Myc, cultures were maintained in ESC conditions in the presence of valproic acid (25) and vitamin C. Following 10 to 14 days, a number of small colonies with altered morphology appeared in the confluent fibroblast cultures. The cells expressed a high nuclear/cytoplasmic ratio and prominent nucleoli as presented in Fig. 1. Colonies that were compact with clear edges were manually selected and expanded on guinea pig fibroblast feeder layers. One of the picked cell lines was selected for further study and passaged >30 times. giPS at passage 30 with mouse ESC-like morphology are presented in Fig. 2. When giPS were cultured in media not containing LIF, their typical ESC morphology and differentiation was altered. This indicated that giPS were similar to mouse ESC. When such colonies were fixed and stained for alkaline phosphatase activity analysis, they were positive for alkaline phosphatase (Fig. 2). To determine whether colonies could grow under feeder-free culture conditions, cells were alternatively plated on gelatin-coated dishes in ESGRO Complete Plus Clonal Grade Medium containing 15% FBS. As presented in Fig. 3A, cells continued to grow rapidly. In addition, alkaline phosphatase staining analysis demonstrated that the dense patches of small rapidly dividing cells were alkaline phosphatase positive (Fig. 3B). Clones used for detailed studies in the present research have been grown continuously in culture at normal growth rates for >30 passages.
Figure 1.
Reprogramming guinea pig fetal fibroblasts. Primary cultures of guinea pig fetal fibroblasts isolated from 40-day-pregnant guinea pigs were transduced with a polycistronic virus encoding octamer-binding transcription factor 4, sex determining region Y-box 2, Kruppel-like factor 4 and c-Myc, and were subsequently treated with valproic acid and vitamin C on guinea pig fibroblast feeder layers. Between days 10 to 14, a number of small colonies with altered morphology appeared. The colonies could be selected from day 21. (A) Guinea pig fetal fibroblasts derived from 40-day-pregnant guinea pig. Scale bar=100 µm. (B) Colonies with altered morphology at culture day 14 following infection. Scale bar=100 µm. (C) On day 14, small colonies with altered iPS-like morphology appeared on the cultures at a low magnification (scale bar=100 µm) and (D) at a higher magnification (scale bar=25 µm). Cells had similar morphological characteristics as previously reported for mouse induced pluripotent stem cells.
Figure 2.
Guinea pig iPS cultured on GF feeder layers. (A and B) Images were taken on day 3 and 4 following isolation, and depict the expansion of putative iPS colonies following isolation. (C) A colony growing on GF feeder layers. (D) Alkaline phosphatase activity in colonies. Scale bar=100 µm. iPS, induced pluripotent stem cells; GF, guinea pig fibroblasts.
Figure 3.
Growth of an isolated guinea pig iPS clone in feeder-free culture conditions. Following the isolation of iPS clones, cells were cultured under feeder-free culture conditions. (A) The growth patterns of cells under feeder-free culture conditions. (B) Alkaline phosphatase positive cells. Scale bar=100 µm. iPS, induced pluripotent stem cells.
In karyotypic analysis performed at passage 30, giPS exhibited a normal guinea pig karyotype of 64 XY, as presented in Fig. 4.
Figure 4.
(A) Karyotyping image of guinea pig induced pluripotent stem cell clones (magnification, ×100). (B) Karyotypic analysis at passage 30 demonstrated a normal 64 XY karyotype.
Markers of pluripotency in giPS
Immunostaining analyses demonstrated that pluripotency markers of giPS were expressed at the protein level (Fig. 5). giPS stained positive for Nanog (Fig. 5A and B) and Oct4 (Fig. 5C and D). The cells were additionally positive for the cell-surface marker SSEA1 (Fig. 5E and F), further verification that giPS exhibited pluripotency.
Figure 5.
Markers of pluripotency in giPS clones. Immunofluorescence was performed for three markers of pluripotency in giPS clones. Images represent (A) Nanog staining and (B) DAPI counterstaining, (C) octamer-binding transcription factor 4 staining and (D) DAPI counterstaining, and (E) stage-specific embryonic antigen 1 and (F) DAPI counterstaining. Scale bar=100 µm. giPS, guinea pig induced pluripotent stem cells.
RT-qPCR was performed to assess the expression of pluripotency genes in giPS, using guinea pig fibroblasts as a control. Relative gene expression levels for pluripotency genes Oct4, Sox2, T-box 3 (Tbx3) and Nanog are presented in Fig. 6. The mRNA expression levels of Oct4, Sox2, Tbx3 and Nanog increased significantly (P<0.01) in giPS compared with guinea pig fibroblasts, and were similar to those of mouse iPS.
Figure 6.
Expression of pluripotent markers of giPS at the mRNA level. mRNA expression levels of Oct4, Sox2, Tbx3 and Nanog in giPS were compared to levels in GFs used for reprogramming, with miPS serving as a positive control. Reverse transcription-quantitative polymerase chain reaction was performed on RNA isolated from triplicate cultures. Data were normalized to β-actin mRNA expression levels and experiments were performed in duplicate. Data are presented as the mean ± standard deviation. Statistical comparisons were performed using Student's t-test. **P<0.01. giPS, guinea pig induced pluripotent stem cells; Oct4, octamer-binding transcription factor 4; Sox2, sex determining region Y-box 2; Tbx3, T-box 3; GF, guinea pig fetal fibroblasts; miPS, mouse induced pluripotent stem cells.
To further assess protein expression of pluripotency factors in giPS, western blot analyses were performed. The results revealed that Oct4, Sox2 and Nanog were expressed in giPS, but not in guinea pig fibroblasts, which further confirmed the pluripotency of giPS (Fig. 7).
Figure 7.
Pluripotent proteins in giPS detected by western blotting. Protein expression levels of Sox2, Oct4, and Nanog in giPS were compared to levels in GFs used for reprogramming. β-actin served as a loading control. Sox2, Oct4, and Nanog were expressed in giPS, but not in GFs. giPS, guinea pig induced pluripotent stem cells; GF, guinea pig fibroblast; Sox2, sex determining region Y-box 2; Oct4, octamer-binding transcription factor 4.
Differentiation of giPS in vivo
To assess whether giPS have the ability to differentiate into all three germ layer cell types in vivo, giPS were transplanted into immunodeficientmice by subcutaneous injection. Teratomas developed at the subcutaneous sites. H&E staining demonstrated that the teratomas were comprised of a number of different tissue types, which represented all three germ layers, including the ectoderm (neural rosettes), mesoderm (cartilage and muscle) and endoderm (gland like cells), as presented in Fig. 8.
Figure 8.
(A) Teratoma formation following subcutaneous injection of giPS clone in immunodeficient mice. (B) Control mouse injected with guinea pig fibroblasts. (C) Teratoma formed by giPS collected from subcutaneous site. (D and E) Representative hematoxylin and eosin-stained sections revealed the presence of all three cell type germ layers: (F) Ectoderm (neural rosette), (G) mesoderm (cartilage) and (H) endoderm (gland like cells). Scale bar=500 µm. giPS, guinea pig induced pluripotent stem cells.
Discussion
With the development of iPS technology, these cells have become a valuable tool for cell therapy and regenerative medicine (7,22). iPS have the potential to differentiate into numerous cell types. For differentiated cells, derived from individual specific iPS, to be transplanted successfully into individuals, translational proof of principle that such procedures are safe and effective is required. Consequently, appropriate studies are required in suitable mammalian models. Although rodents and other species are excellent cell sources for reprogramming, it is generally accepted that, with the rise of multi drug-resistant strains of M. tuberculosis (17), the guinea pig is the most appropriate mammalian model for developing new and efficient antimycobacterial drugs.The present study derived lines of giPS from guinea pig fetal fibroblasts and established a suitable cell culture system. These giPS exhibited similar characteristics to mouse iPS. They had typical ESC morphology, proliferated rapidly, expressed pluripotent genes and markers at the protein and mRNA levels and grew in an LIF-dependent manner. Teratoma analysis has commonly been used to determine pluripotency and the in vivo differentiation ability of iPS (1); it is considered to be the gold standard for characterizing new iPS lines. The results of the present study indicated that guinea pig cells have the ability to differentiate in vivo.Retroviral and lentiviral vectors were the earliest established methods to deliver reprogramming factors and have been widely used. Despite their tendency to randomly and stably integrate into chromosomes, which may increase the risk of tumorigenesis (26), they have a high reprogramming efficiency when compared to other methods (14).The methodologies applied in the present study were similar to those typically performed; however, some were modified significantly. It is commonly recognized that using feeder-free conditions for iPS and ESC growth results in significant advantages for subsequent differentiation and cell transplantation (7). In the majority of previous reprogramming studies, iPS have been generated and grown on feeder layers. In certain studies, cells were later transferred to feeder-free conditions (7,22). In the present study, giPS were adapted to feeder-free conditions at an early stage. giPS grew well under these conditions, as they were expanded and subsequently cryopreserved.In certain circumstances, the transfer of human ESCs to feeder-free culture conditions, following routine growth on feeder layers, has resulted in abnormal karyotypes (27). Karyotypic abnormalities characterize iPS as ‘low quality’, thereby restricting further use of such cells. In the present study, giPS continued to exhibit a normal karyotype following transfer to feeder-free culture conditions. In addition, they maintained typical iPS/ESC morphology. These cells were alkaline phosphatase positive and expressed markers of pluripotency.Vitamin C may suppress cell senescence (28), and valproic acid (25) has been reported to promote reprogramming. Therefore, to enhance giPS generation, vitamin C was mixed with valproic acid in the ESC medium. This served an important role in suppressing the potential adverse consequences of transgene expression, particularly of c-Myc (29). The viral based methodology of iPS generation is valuable for basic and translational experiments in animals. For clinical use, however, reprogramming methods must be established in such a way that the reprogramming vectors may be excised from the cells prior to therapeutic application (30,31); alternatively, methods may avoid genetic modification completely (32,33). Thus, the generation of giPS requires further study, particularly to generate insertion-free giPS. However, the relative efficiency of reprogramming makes the viral vector method attractive for solving basic issues. Once these problems are solved, relatively safer methods may be developed. The characterization of giPS in the present study may provide proof of principle of iPS generation for this species and support the future generation of individual-specific iPS for proof of principle experiments on autologous cell therapy in guinea pigs.
Authors: Bryce W Carey; Styliani Markoulaki; Jacob Hanna; Kris Saha; Qing Gao; Maisam Mitalipova; Rudolf Jaenisch Journal: Proc Natl Acad Sci U S A Date: 2008-12-24 Impact factor: 11.205
Authors: Jesica R Canizo; Camila Vazquez Echegaray; Doris Klisch; Juan F Aller; Dante A Paz; Ricardo H Alberio; Ramiro Alberio; Alejandra S Guberman Journal: BMC Res Notes Date: 2018-07-27