| Literature DB >> 28392785 |
Marie Robbe-Saule1, Jérémie Babonneau1, Odile Sismeiro2, Laurent Marsollier1, Estelle Marion1.
Abstract
Bacterial transcriptome analyses during host colonization are essential to decipher the complexity of the relationship between the bacterium and its host. RNA sequencing (RNA-seq) is a promising approach providing valuable information about bacterial adaptation, the host response and, in some cases, mutual tolerance underlying crosstalk, as recently observed in the context of Mycobacterium ulcerans infection. Buruli ulcer is caused by M. ulcerans. This neglected disease is the third most common mycobacterial disease worldwide. Without treatment, M. ulcerans provokes massive skin ulcers. A healing process may be observed in 5% of Buruli ulcer patients several months after the initiation of disease. This spontaneous healing process suggests that some hosts can counteract the development of the lesions caused by M. ulcerans. Deciphering the mechanisms involved in this process should open up new treatment possibilities. To this end, we recently developed the first mouse model for studies of the spontaneous healing process. We have shown that the healing process is based on mutual tolerance between the bacterium and its host. In this context, RNA-seq seems to be the most appropriate method for deciphering bacterial adaptation. However, due to the low bacterial load in host tissues, the isolation of mycobacterial RNA from skin tissue for RNA-seq analysis remains challenging. We developed a method for extracting and purifying mycobacterial RNA whilst minimizing the amount of host RNA in the sample. This approach was based on the extraction of bacterial RNA by a differential lysis method. The challenge in the development of this method was the choice of a lysis system favoring the removal of host RNA without damage to the bacterial cells. We made use of the thick, resistant cell wall of M. ulcerans to achieve this end.Entities:
Keywords: Mycobacterium ulcerans; RNA purification; RNA-seq; cross-talk; host-bacteria interaction
Year: 2017 PMID: 28392785 PMCID: PMC5364165 DOI: 10.3389/fmicb.2017.00512
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Primer/probe sequences.
| Primer/probe | Name | Sequence (5′ to 3′) | Efficiency (%) | R2 | Reference |
|---|---|---|---|---|---|
| MuPpk_Forward | Polyphosphate kinase, MUL_1972, [ | CGGGAAACTACAACAGCAAGACC | 96% | 0.9997 | This study |
| MuPpk_Reverse | CCACCAACAGATTGCGATAGG | ||||
| MuPpk_Probe | CCGACATTGGCGCAGACCTCACC | ||||
| GAPDH_Forward | Glyceraldehyde-3-phosphate dehydrogenase, [Mouse] | GTGGCAAAGTGGAGATTGTTG | 97% | 0.9999 | This study |
| GAPDH_Reverse | TGACAAGCTTCCCATTCTCG | ||||
| GAPDH_Probe | TCCACTCACGGCAAATTCAACGGCA |
Comparison of Ct values between the coextraction method (Method 1) and the differential lysis method (Method 2).
| M1-1 | M1-2 | M1-3 | M2-1 | M2-2 | M2-3 | |
|---|---|---|---|---|---|---|
| 33.6 | 32.4 | 32.7 | 30.3 | 30.7 | 31.5 | |
| Murine | 17.7 | 17.5 | 17.1 | 33.3 | 32.5 | 32.8 |