Literature DB >> 28370854

EphB3-targeted regulation of miR-149 in the migration and invasion of human colonic carcinoma HCT116 and SW620 cells.

Guodong Zhang1, Xiaozhu Liu2, Yinfeng Li2, Yan Wang3, Huankun Liang4, Kangyan Li4, Laiqing Li4, Cuicui Chen4, Wenqiao Sun5, Shoulei Ren3, Pengfei Zhu3, Licheng Zhang5.   

Abstract

microRNAs play key roles during various crucial cell processes such as proliferation, migration, invasion and apoptosis. Also, microRNAs have been shown to possess oncogenic and tumor-suppressive functions in human cancers. Here, we describe the regulation and function of miR-149 in colorectal cancer cell lines. miR-149 expression patterns were detected in human colorectal cell lines and tissue samples, and then focused on its role in regulation of cell growth, migration, invasion, and its target gene identification. Furthermore, the function of the target gene of miR-149 was analyzed in vitro and in vivo. miR-149 expression was downregulated in human colorectal cancer HCT116 and SW620 cell lines compared to the normal colon epithelial NCM460 cell line using quantitative real-time polymerase chain reaction methods. Further studies indicated that introduction of miR-149 was able to suppress cell migration and invasion. Then, EphB3 was identified as a direct target gene of miR-149 in colorectal cancer cells. Moreover, experiments in vitro showed that knockdown expression of EphB3 could suppress cell proliferation and invasion, and ectopic expression of EphB3 restored the phenotypes of CRC cell lines transfected with miR149. In addition, silencing of EphB3 significantly affected cycle progression distribution and increased apoptosis in CRC cell lines. Finally, in vivo results demonstrated that knockdown of EphB3 by siRNA inhibited tumor growth. In conclusion,the important role of miR-149 in colorectal cancer progression suggesting that miR-149 may serve as a therapeutic target for colorectal cancer treatment.
© 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Entities:  

Keywords:  EphB3; human colorectal cell; invasion; miR-149; migration

Mesh:

Substances:

Year:  2017        PMID: 28370854      PMCID: PMC5378266          DOI: 10.1111/cas.13161

Source DB:  PubMed          Journal:  Cancer Sci        ISSN: 1347-9032            Impact factor:   6.716


microRNAs (miRNAs) are endogenous, small, single‐stranded, non‐coding RNAs that function as repressors of gene expression by binding to target sites in the 3′ untranslated regions (UTRs) of messenger RNA (mRNA).1 miRNAs can be classified as oncogenes or as tumor suppressors, and by targeting various transcripts, they participate in proliferation, apoptosis, metabolism, and cellular differentiation processes.2, 3 Emerging evidence has established miRNAs as pivotal players in the initiation, promotion, and progression of various human cancers. For example, miR‐340 could restrain cell migration and invasion in and breast cancer whereas miR‐373 and miR‐10b activate carcinoma migration and promote tumor invasion and metastasis.4, 5, 6, 7 Therefore, miRNAs may represent a novel and attractive therapeutic strategy as one miRNA could simultaneously regulate the expression of hundreds of different genes. Colorectal cancer (CRC) is one of the most frequent cancers and a common cause of cancer‐related deaths in the world.8 Although the morbidity and mortality rates have declined in some western countries, this rate has remained elevated in China and other developing countries in past decades.8, 9, 10 Screening for CRC allows the early diagnosis of the malignancy and reduces the mortality of this disease. Recent studies have suggested that miR‐149 may play an important role in various cancer diseases. miR‐149 has been shown to function as both a tumor suppressor and an oncogene in the development of multiple types of solid tumors.11, 12 Ectopic expression of miR‐149 induces apoptosis of neuroblastoma cells. Loss of miR‐149 leads to some oncogenes gain of function in renal cell carcinoma and prostate carcinoma.13, 14 Elevated expression of miR‐149 has been reported to be important in the progression of nasopharyngeal carcinoma.15 However, the expression pattern and role of miR‐149 in the development of CRC remains unclear. In this study, we examined miR‐149 expression pattern in CRC cells and tissue samples, and investigated the function of miR‐149 in cell proliferation, migration, and invasion of CRC cells. We also identified EphB3 as a target gene for miR‐149 using luciferase reporter assay. Moreover, experiments in vitro showed that knockdown expression of EphB3 could suppress cell proliferation and invasion, and ectopic expression of EphB3 restored the phenotypes of CRC cell lines transfected with miR149. In addition, silencing of EphB3 significantly affected cycle progression distribution and increased apoptosis in CRC cell lines. Finally, in vivo results demonstrated that knockdown of EphB3 by siRNA inhibited tumor growth. Our results indicated that miR‐149 might act as a tumor suppressor and served as a potential therapeutic target in CRC.

Materials and Methods

Cell culture

The human CRC cell lines HCT116, SW620 and normal colon epithelial NCM460 cell were cultured at 37°C in a 5% CO2 atmosphere and maintained in DMEM containing 10% FBS and 2 mM l‐glutamine (Invitrogen, Los Angeles, CA, USA).

Patient samples

A total of 30 pairs of primary CRCs and their paired noncancerous colonic tissues were collected from Cancer Center of The 88 Hospital of People's Liberation Army. All patients provided written informed consent for the use of their tissues. This study was approved by the Institutional Review Board of The 88 Hospital of People's Liberation Army, and all participants gave written informed consent. All tissues had been histologically confirmed to be an adenocarcinoma of the colon. Tissue samples were collected, snap‐frozen in liquid nitrogen, and stored at −80°C until further analysis.

Real‐time RT‐PCR

Total RNA was extracted from CRC cells and tumor tissues by using TRIZOL Reagent (Invitrogen). The cDNA Synthesis Kit (Takara, Tokyo, Japan) was used for the synthesis of cDNA according to the manufacturer's instructions. Quantitative RT‐PCR was performed to detect the expression levels of miRNA and mRNA. Quantitative PCR was accomplished to detect the expression levels of miRNA and mRNA using the Light Cycler 480 detection system (Roche Diagnostics, Indianapolis, IN, USA) and interaction dye SYBR Green. U6 snRNA and actin mRNA levels were used for normalization. Primer sequences were listed in Table 1. The quantitative RT‐PCR results were analyzed and expressed as relative miRNA or mRNA levels of the Ct value, which was then converted to fold change.
Table 1

Primers used for quantitative real‐time PCR analysis. Primers were designed using Primer Express version 2.0 software (Thermo Fisher). Primer specificity was confirmed using Primer‐BLAST web software (National Centre for Biotechnology Information)

GeneNamePrimers (5′ to 3′)
hsa‐miR‐149miR‐149‐RTGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGAGT
miR‐149‐FGGCTCTGGCTCCGTGTCTT
miR‐149‐RCAGTGCAGGGTCCGAGGTATT
U6U6‐RTGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAAT
U6‐FCAAATTCGTGAAGCGTTCCATA
U6‐RAGTGCAGGGTCCGAGGTATTC
EphB3EphB3‐FCCTGTACGCCAACACAGTGC
EphB3‐RCTCGAGCCGGATTATATTG
β‐actinβ‐actin‐FCCTGTACGCCAACACAGTGC
β‐actin‐RATACTCCTGCTTGCTGATCC
Caspase ‐3Caspase ‐3‐FGTATGCATACTCCACAGCAC
Caspase ‐3‐RGTTGCCACCTTTCGGTTAAC
Caspase ‐6Caspase ‐6‐FCATGACAGAAACAGATGC
Caspase ‐6‐RGTAAGATTGTCTCTATCTG
BaxBax ‐FCTGAGCGAGTGTCTCAAG
Bax ‐RAGTTGAAGTTGCCGTCAG
Bcl‐2Bcl‐2‐FCGAGATGTCCAGCCAGCTG
Bcl‐2‐RGATCCAGGTGTGCAGGTGC
Primers used for quantitative real‐time PCR analysis. Primers were designed using Primer Express version 2.0 software (Thermo Fisher). Primer specificity was confirmed using Primer‐BLAST web software (National Centre for Biotechnology Information)

Western blot analysis

Total proteins were prepared from the CRC cells. The protein concentration was determined using Bio‐Rad protein assay system (Bio‐Rad, Hercules, CA, USA). Proteins were analyzed with SDS polyacrylamide gel electrophoresis. After electrophoresis, they were electro‐transferred to the PVDF membrane. The membrane containing the proteins was used for immunoblotting with appropriate antibodies. The protein bands were scanned and quantified.

Transfection of miRNA mimics, siRNAs or plasmid vectors

The human miR‐149 duplex mimic and negative control oligonucleotide duplex mimic (miR‐NC) were designed and provided by Ribobio (Guangzhou, China). The small interfering RNA (siRNA) for EphB3 and the negative control RNA (siRNA‐NC) were synthesized and purified by Genepharma (Shanghai, China). The sequences of miRNAs and siRNAs were described in Table 2. The open reading frame of EphB3 (NM_004443) that was generated by PCR was then inserted into the pEGFP‐C1 expression vector which was named pEGFP/EphB3. The recombinant vector was confirmed by the digestion analysis of restriction endonuclease and DNA sequencing. Cultured HCT116 and SW620 cells were transfected with miRNAs, siRNAs or plasmid vectors with the Lipofectamine 2000 reagent (Invitrogen) following the manufacturer's protocol.
Table 2

Primers used for cell transfection and luciferase reporter vector construction. Primers were designed using Primer 5.0 software

GeneNamePrimers (5′ to 3′)
miR‐149miR‐149 mimicsUCUGGCUCCGUGUCUUCACUCCC
mimics‐NCmiR‐149 mimicsGGGAGUGAAGACACGGAGCCAGA
SiEphB3SiEphB3‐senseGGACCCUAAUGAGGCUGUU
SiEphB3‐ antisenseAACAGCCUCAUUAGGGUCC
SiRNA‐NCSiRNA control‐senseGGAAAUCGAGUUCGCCGUU
SiRNAcontrol‐antisenseAACGGCGAACUCGAUUUCC
EphB3EphB3‐luc‐FGCTCTAGACACCGGCTCCCACGGGGACC
EphB3‐luc‐RATAAGAATGCGGCCGCCATCTTATTGCCTTTATTCTG
Primers used for cell transfection and luciferase reporter vector construction. Primers were designed using Primer 5.0 software

Cell proliferation, migration and invasion assays

For cell proliferation assay, cell viability was determined by the MTT method. Briefly, CRC cells were transfected with 150 nM miR‐149 mimics or 100 nM siRNA‐EphB3. Twenty‐four hours later, cells were seeded in 96‐well plates at a density of 1 × 104 cells/well. Then, 20 μL MTT (5 mg/mL) was added to each well and incubated for 4 h. The medium was then removed, and the formazan crystals were dissolved with dimethylsulfoxide (DMSO). Absorbance was read at 570 nm on a microplate reader (Multiskan Spectrum; Thermo Fisher, Waltham, MA, USA). For cell migration and invasion assay, uncoated or matrigel coated transwells (BD Biosciences, Franklin, NJ, USA) containing 8 μm pores were used (BD Biosciences, Mountain View, CA, USA). Cells transfected with 150 nM miR‐149 mimics or 100 nM siRNA‐EphB3 were seeded into the upper chamberin serum‐free DMEM. Cells were fixed in 100% methanol 72 h later and stained with a 1:5 dilution of Giemsa (Sigma, San Francisco, CA, USA) for 40 min at room temperature. Cells remaining on the upper side of the filter were removed with a cotton swab. The filters were then mounted onto slides and images were taken at 10× magnification. From these images, the number of migratory or invasive cells was counted.

Vector constructs and luciferase reporter assay

To construct EphB3 3′UTR plasmid, the full‐length 3′UTR of human EphB3 mRNA (NM_004443) containing the putative miR‐149 binding sequence was cloned into the pGL3 promotor vector (Promega, Madison, WI, USA) (Fig. S1). The putative miR‐149 recognition sites in the EphB3 3′UTR were mutated by site‐directed mutagenesis. For the dual luciferase assay, CRC cells were transfected with 150 nM of pre‐miR‐149, or a negative precursor control using Lipofectamine 2000 (Invitrogen). After 24 h, cells were co‐transfected with 200 ng of pRL‐EphB3 and 100 ng of pGL3‐luc as the internal control. Cell extracts were prepared 48 h later and the dual luciferase reporter assay (Promega) was performed according to the manufacturer's protocol.

Cell cycle assay

Cell cycle assay was performed by flow cytometry. After transfected with 100 nM siRNA‐EphB3 or siRNA control, CRC cells were harvested, washed twice using PBS, and fixed in 70% ethanol at 4°C overnight. Then cells were incubated with propidium iodide at room temperature for 1 h and were analyzed by flow cytometry using a FACScan flow cytometer (BD Biosciences). 16

Cell apotosis assay

Apoptotic cells can be recognized and distinguished from normal cells using an Annexin V‐FITC/PI apoptosis kit for flow cytometry according to the manufacturer's instructions (Invitrogen). After transfected with 100 nM siRNA‐EphB3 or siRNA control, CRC cells were harvested and washed twice with cold PBS, and then incubated with 5 μL FITC‐Annexin V and 1 μL PI working solution (100 μg/mL) for 15 min in the dark at room temperature. Cellular fluorescence was measured by flow cytometry analysis. 17

In vivo xenograft experiments

Female BALB/C nude mice at the age of 4 weeks were randomly divided into two groups (five mice per group). Has‐miR‐149 or miR‐control stable transfection HCT 116 and SW620 cells suspensions (1 × 106 cells/mL) in 200 μL serum‐free medium were subcutaneously injected into the flanks of nude mice, respectively. Tumor growth was examined twice per week for 4 weeks. After 4 weeks, tumor samples were carefully removed and weighed.

Statistical analyses

The data were analyzed by one‐way analysis of variance and the Student's t‐test to determine statistical significance using SPSS 16.0 statistic software (SPSS, Armonk, NY, USA). Each experiment was repeated at least three times. The results were expressed as mean ± SEM. Outcomes were considered statistically significant with two‐tailed P < 0.05.

Results

miR‐149 expression patterns in CRC cells and clinical samples

To assess the role of miR‐149 in colorectal cancer, we used quantitative RT‐PCR to measure the expression of miR‐149 in CRC cell lines and tumor tissues. We found that miR‐149 was significantly decreased in HCT116 and SW620 cell lines compared to the normal human colon epithelial NCM460 cell line (Fig. 1a) and colonic tissues compared to the noncancerous colonic tissues (Fig. 1b).
Figure 1

Expression level of miR‐149 in human CRC cell lines and clinical tumor tissues. (a) Expression of miR‐149 in human CRC cell lines relative to the normal human colon epithelial cell line NCM460. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, compared with NCM460 group. (b) The relative miR‐149 expression between tumor tissues and their paired adjacent colonic normal tissues from 30 CRC patients using real‐time PCR. **P < 0.01, compared with normal group.

Expression level of miR‐149 in human CRC cell lines and clinical tumor tissues. (a) Expression of miR‐149 in human CRC cell lines relative to the normal human colon epithelial cell line NCM460. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, compared with NCM460 group. (b) The relative miR‐149 expression between tumor tissues and their paired adjacent colonic normal tissues from 30 CRC patients using real‐time PCR. **P < 0.01, compared with normal group.

Ectopic expression of miR‐149 inhibits CRC cells proliferation and invasion in vitro

To investigate the role of miR‐149 in CRC cells, HCT116 and SW620 cells were transiently transfected with either miR‐149 mimics or miR‐149 mimics control (Fig. S2). Quantitative RT‐PCR results showed that miR‐149 mimics could significantly upregulate the expression of miR‐149 in HCT116 and SW620 cells at the fifth day post‐transfection (Fig. 2a) compared to miR‐149 mimics control. HCT116 and SW620 cells transfected with miR‐149 mimics showed significantly lower levels of cell proliferation than the mimics control groups as determined by MTT assay (Fig. 2b). Colony‐formation assay demonstrated that overexpression of miR‐149 significantly reduced both the number of colonies formed and the size of the colonies after 15 days of culture compared with the negative control in HCT116 and SW620cell lines (Fig. 2c,d). In addition, transwell assays indicated that the invasive capacity of HCT116 and SW620 cells over‐expressing miR‐149 were significantly reduced compared with the negative control (Fig. 2e,f).
Figure 2

Ectopic expression of miR‐149 inhibits CRC cell proliferation and invasion in vitro. (a) The level of miR‐149 expression in HCT116 and SW620 cells increased significantly after transfection with 150 nM miR‐149 mimics compared with the negative control. (b) Transfection of cells with miR‐149 mimics inhibited cell growth at the indicated time points compared with cells transfected with negative control. (c, d) Colony formation assay of HCT116 and SW620 cells transfected with the miR‐149 mimics or negative control. (e, f) Transwell assay showed that miR‐149 overexpression inhibited invasion in HCT116 and SW620 cells. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. *P < 0.05, compared with control group. **P < 0.01, compared with control group.

Ectopic expression of miR‐149 inhibits CRC cell proliferation and invasion in vitro. (a) The level of miR‐149 expression in HCT116 and SW620 cells increased significantly after transfection with 150 nM miR‐149 mimics compared with the negative control. (b) Transfection of cells with miR‐149 mimics inhibited cell growth at the indicated time points compared with cells transfected with negative control. (c, d) Colony formation assay of HCT116 and SW620 cells transfected with the miR‐149 mimics or negative control. (e, f) Transwell assay showed that miR‐149 overexpression inhibited invasion in HCT116 and SW620 cells. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. *P < 0.05, compared with control group. **P < 0.01, compared with control group.

EphB3 is a direct target gene of miR‐149 in CRC cells

First, we investigated the targets of miR‐149 used the miRecords resource to obtain potential targets of miR‐149 from three independent prediction tools included on the website. Among the putative targets of miR‐149, we chose EphB3 for further analysis, because it had been previously implicated in promoting colorectal cancer progression, and seven potential binding sites of miR‐149 in the EphB3 3′UTR by in silico analysis.18, 19, 20 Then, EphB3 expression level was analyzed in HCT116 and SW620 cells lines after transfection with either miR‐149 mimics or mimic‐NC sequences. Indeed, real‐time PCR and western blot analyses confirmed this prediction. Briefly, after transient transfection of miR‐149 mimics into HCT116 and SW620 cells EphB3 mRNA (Fig. 3a) and protein levels (Fig. 3b,c) were significantly suppressed compared with negative control.
Figure 3

EphB3 is a direct target gene of miR‐149 in CRC cells. (a) qRT‐PCR analysis of EphB3 mRNA in cells transfected with miR‐149 mimics or a negative control. **P < 0.01, miR‐149 mimics versus the respective negative control groups. (b, c) Western blots analysis of EphB3 in CRC cells transfected with miR‐149 mimics. **P < 0.01, miR‐149 mimics versus the respective negative control groups. (d) Base pairing comparison between the mature miR‐149 and the wt or mutant target site in the 3′UTR of EphB3 mRNA. (e) The luciferase activity of various reporters in the presence or absence of miR‐149 mimics in SW620 cells. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, miR‐149 mimics plus vector containing the wild‐type EphB3 3′UTR versus the other three groups.

EphB3 is a direct target gene of miR‐149 in CRC cells. (a) qRT‐PCR analysis of EphB3 mRNA in cells transfected with miR‐149 mimics or a negative control. **P < 0.01, miR‐149 mimics versus the respective negative control groups. (b, c) Western blots analysis of EphB3 in CRC cells transfected with miR‐149 mimics. **P < 0.01, miR‐149 mimics versus the respective negative control groups. (d) Base pairing comparison between the mature miR‐149 and the wt or mutant target site in the 3′UTR of EphB3 mRNA. (e) The luciferase activity of various reporters in the presence or absence of miR‐149 mimics in SW620 cells. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, miR‐149 mimics plus vector containing the wild‐type EphB3 3′UTR versus the other three groups. To obtain further direct evidence that EphB3 is a target of miR‐149, we characterized the binding site of miR‐149 in the 3′ UTR of EphB3 mRNA (Fig. 3d). The data demonstrated that miR‐149 but not miR149‐control RNA specifically decreased the luciferase activity. The mutant reporter co‐transfected with miR‐149 did not show significant decrease in the relative luciferase activity compared with negative control RNA (Fig. 3e). Taken together, these data suggest that EphB3 is a direct target gene of miR‐149 in CRC cells.

Silencing of EphB3 significantly inhibits cell proliferation and invasion in of CRC cells

To further determine the role of EphB3 in cell invasion, we used EphB3 siRNA for knockdown of EphB3 expression in HCT116 and SW620 cells, and the efficacy was confirmed by quantitative PCR and western blot analysis. Quantitative PCR analysis (Fig. 4a) and western blotting (Fig. 4b,c) showed that the expression of EphB3 was decreased after siRNA transfection. Next, results from MTT assay revealed that silencing of EphB3 could lead to the decreased capacity of growth in HCT116 and SW620 cells (Fig. 4d). In addition, transwell assay suggested that invasiveness of cells transfected with siRNA EphB3 was decreased compared to cells transfected with siRNA‐NC (Fig. 4e,f). These results clearly indicated that silencing of EphB3 mimics the effects of miR‐149 overexpression on malignant phenotypes of CRC cells.
Figure 4

Silencing of EphB3 significantly inhibits cell proliferation and invasion in of CRC cells. (a) qRT‐PCR analysis of EphB3 mRNA in CRC cells transfected with SiEphB3 or a SiRNA control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, SiEphB3 groups versus the respective negative control groups. (b, c) Western blots analysis of EphB3 in CRC cells transfected with SiEphB3 or a SiRNA control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, SiEphB3 groups versus the respective negative control groups. (d) MTT analysis of growth in CRC cells after knockdown of EphB3 expression. (e, f) Loss of EphB3 leads to decreased invasiveness in CRC cells. CRC cells transfected with siEphB3 or NC were induced to invade through matrigel‐coated transwell membranes. After 24 h, the migrated cells were fixed, stained, and photographed. Representative photographs of transwell membranes showed stained migrated cells by quantitative results of the cellular transmembrane ability in each group (n = 3). *P < 0.05, statistically significant difference among cell groups transfected with siEphB3 or negative control.

Silencing of EphB3 significantly inhibits cell proliferation and invasion in of CRC cells. (a) qRT‐PCR analysis of EphB3 mRNA in CRC cells transfected with SiEphB3 or a SiRNA control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, SiEphB3 groups versus the respective negative control groups. (b, c) Western blots analysis of EphB3 in CRC cells transfected with SiEphB3 or a SiRNA control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, SiEphB3 groups versus the respective negative control groups. (d) MTT analysis of growth in CRC cells after knockdown of EphB3 expression. (e, f) Loss of EphB3 leads to decreased invasiveness in CRC cells. CRC cells transfected with siEphB3 or NC were induced to invade through matrigel‐coated transwell membranes. After 24 h, the migrated cells were fixed, stained, and photographed. Representative photographs of transwell membranes showed stained migrated cells by quantitative results of the cellular transmembrane ability in each group (n = 3). *P < 0.05, statistically significant difference among cell groups transfected with siEphB3 or negative control.

Ectopic expression of EphB3 restores the phenotypes of CRC cell lines transfected with miR149

To further clarify whether miR‐149 related phenotype could explain by down‐regulation of EphB3, HCT116 cells were co‐transfection with miR149 mimics and pEGFP/EphB3 vector. Forty‐eight hour after co‐transfection, quantitative RT‐PCR and western blotting assays were carried out to determine the expression of EphB3 mRNA and protein, and results exhibited that the co‐transfection could rescue the decreased expression of EphB3 mRNA and protein in HCT116 cells induced by miR‐149 mimics (Fig. 5a–c). We found that overexpression of EphB3 could reverse the growth inhibition in HCT116 cells induced by miR‐149 mimics (Fig. 5d). Moreover, as shown in Figure 5(e–h), the decreased capacity of colony‐formation and invasion in HCT116 cells induced in miR‐149 mimics were also reversed through overexpression of EphB3. Taken together, these findings suggested that EphB3 was a functional target of miR‐149 in CRC cells.
Figure 5

Ectopic expression of EphB3 restores the phenotypes of CRC cell lines transfected with miR149. (a) qRT‐PCR analysis of EphB3 mRNA in CRC cells after ectopic expression of EphB3. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, miR‐149 mimics + pEGFP/EphB3 group versus miR‐149 mimics group. (b, c) Western blots analysis of EphB3 expression in CRC cells after ectopic expression of EphB3. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, miR‐149 mimics + pEGFP/EphB3 group versus miR‐149 mimics group. (d) MTT analysis of growth in CRC cells after ectopic expression of EphB3. (e–h) Ectopic expression of EphB3 could rescue the capacity of decreased invasiveness in CRC cells induced by miR‐149 mimics. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, miR‐149 mimics + pEGFP/EphB3 group versus miR‐149 mimics group.

Ectopic expression of EphB3 restores the phenotypes of CRC cell lines transfected with miR149. (a) qRT‐PCR analysis of EphB3 mRNA in CRC cells after ectopic expression of EphB3. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, miR‐149 mimics + pEGFP/EphB3 group versus miR‐149 mimics group. (b, c) Western blots analysis of EphB3 expression in CRC cells after ectopic expression of EphB3. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, miR‐149 mimics + pEGFP/EphB3 group versus miR‐149 mimics group. (d) MTT analysis of growth in CRC cells after ectopic expression of EphB3. (e–h) Ectopic expression of EphB3 could rescue the capacity of decreased invasiveness in CRC cells induced by miR‐149 mimics. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, miR‐149 mimics + pEGFP/EphB3 group versus miR‐149 mimics group.

Silencing of EphB3 significantly affects cycle progression distribution and increases apoptosis in CRC cell lines

To explore the functional effect of EphB3 on cell cycle progression and cell survival, we measured cycle progression distribution and apoptosis in CRC cells transfected with EphB3 SiRNA and EphB3‐NC. Results from flow cytometry indicated that inhibition of EphB3 expression increased number of G1 and S phase cells and decreased G2 and M phase cells compared to control group cells (Fig. 6a–c). Furthermore, we detected that knockdown of EphB3 increased apoptosis in CRC cell lines measured by flow cytometry analysis (Fig. 7a,b).
Figure 6

Effect of EphB3 silencing on cell cycle progression in CRC cells. (a) Flow cytometry analysis of cell cycle distribution in CRC cells transfected with siEphB3 or negative control. (b, c) DNA quantitative analysis of cell cycle distribution in CRC cells transfected with siEphB3 or negative control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. *P < 0.05, G1 phase cells of SiEphB3 group versus SiRNA‐NC group; #P < 0.05, S phase cells of SiEphB3 group versus SiRNA‐NC group; P < 0.05, G1 phase cells of SiEphB3 group versus SiRNA‐NC group; ▲P < 0.05, G2/M phase cells of SiEphB3 group versus SiRNA‐NC group.

Figure 7

Effect of EphB3 silencing on cell apotosis in CRC cell lines. (a) Flow cytometry analysis of cell apotosis in CRC cells transfected with siEphB3 or negative control; (b) Quantitative analysis of cell apotosis in CRC cells transfected with siEphB3 or negative control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, SiEphB3 groups versus the respective negative control groups.

Effect of EphB3 silencing on cell cycle progression in CRC cells. (a) Flow cytometry analysis of cell cycle distribution in CRC cells transfected with siEphB3 or negative control. (b, c) DNA quantitative analysis of cell cycle distribution in CRC cells transfected with siEphB3 or negative control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. *P < 0.05, G1 phase cells of SiEphB3 group versus SiRNA‐NC group; #P < 0.05, S phase cells of SiEphB3 group versus SiRNA‐NC group; P < 0.05, G1 phase cells of SiEphB3 group versus SiRNA‐NC group; ▲P < 0.05, G2/M phase cells of SiEphB3 group versus SiRNA‐NC group. Effect of EphB3 silencing on cell apotosis in CRC cell lines. (a) Flow cytometry analysis of cell apotosis in CRC cells transfected with siEphB3 or negative control; (b) Quantitative analysis of cell apotosis in CRC cells transfected with siEphB3 or negative control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, SiEphB3 groups versus the respective negative control groups. To confirm the reliability of apoptosis result, we performed quantitative RT‐PCR and western blotting analysis of a set of markers for apoptosis, including bcl‐2, bax, caspase‐3 and caspase‐6. We found that a strong increase in the expression of bcl‐2, caspase‐3 and caspase‐6, in contrast, a strong decrease in the expression of bax in EphB3 SiRNA group compared with control group (Fig. 8a–e). In addition, the expression of cleaved caspase‐3 and cleaved caspase‐6 were also determined through western blotting analysis. The data revealed that the expression of cleaved caspase‐3 and cleaved caspase‐6 were strong increased in EphB3 SiRNA group compared with control group (Fig. S3).
Figure 8

Expression levels of markers for apoptosis. (a, b) qRT‐PCR analysis of cell apotosis related proteins expression in CRC cells transfected with SiEphB3 or a SiRNA control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. *P < 0.05, SiEphB3 groups versus the respective negative control groups. (c–e) Western blots analysis of apotosis related proteins expression in CRC cells transfected with SiEphB3 or a SiRNA control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. *P < 0.05, SiEphB3 groups versus the respective negative control groups.

Expression levels of markers for apoptosis. (a, b) qRT‐PCR analysis of cell apotosis related proteins expression in CRC cells transfected with SiEphB3 or a SiRNA control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. *P < 0.05, SiEphB3 groups versus the respective negative control groups. (c–e) Western blots analysis of apotosis related proteins expression in CRC cells transfected with SiEphB3 or a SiRNA control. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. *P < 0.05, SiEphB3 groups versus the respective negative control groups.

Knockdown of EphB3 inhibits tumor growth in vivo

To examine the role of EphB3 in tumor development, we constructed a BALB/C nude xenograft mouse model in which mice were transplanted with EphB3 SiRNA and EphB3‐control transfected CRC cells. After 4 weeks, tumors from SiRNA EphB3 group were significantly smaller than those from mice transfected with control (Fig. 9a). Furthermore, silencing of EphB3 significantly reduced xenograft tumor volume (Fig. 9b) and tumor weight (Fig. 9c).
Figure 9

Knockdown of EphB3 inhibits tumor growth in vivo. (a) Xenograft growth in nude mice. (b) Macroscopic appearance of xenotransplanted tumors. (c) Quantitative analysis of tumor weights. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, SiEphB3 groups versus the respective negative control groups.

Knockdown of EphB3 inhibits tumor growth in vivo. (a) Xenograft growth in nude mice. (b) Macroscopic appearance of xenotransplanted tumors. (c) Quantitative analysis of tumor weights. Data are the mean ± SEM (n = 3), each bar represents the mean of three independent experiments carried out in triplicate. **P < 0.01, SiEphB3 groups versus the respective negative control groups.

Discussion

Increasing evidence suggests that miRNAs play a critical role in carcinogenesis and cancer progression.21 Individual miRNAs have been ascribed oncogenic and tumor suppressor functions,22 and aberrant miRNA expression has been implicated in many malignancies, including colorectal cancer.23, 24 Profiling and functional studies demonstrated that many miRNAs’ potential novel prognostic values in colorectal cancer. Previous researches have shown that the role of miR‐149 was different in the progression of different types of tumors.11, 12, 13 The expression patterns of miR‐149 and its target genes were various in different types of tumors.25, 26, 27, 28 Ying et al. reported that miR‐149 was a tumor suppressor and its expression was decreased in human gastric cancer.16 Moreover, ectopic expression of miR‐149 in gastric cancer cells inhibits proliferation and cell cycle progression by downregulating target gene ZBTB2, a potent repressor of the ARF‐HDM2‐p53p21 pathway. In prostate cancer, miR‐149 expression was downregulated and was part of a six member diagnostic marker set that discriminated between malignant and normal tissues in prostate cancer patients.14 In contrast, the deletion of miR‐149 leads to the lysyl oxidase oncogenes gain of function in clear cell renal cell carcinoma.29 To date, little is known about the role of miR‐149 in CRC. Here, we reported that miR‐149 expression was significantly reduced in CRC HCT116 and SW620 cells lines. Ectopic expression of miR‐149 inhibits cells proliferation migration and invasion in CRC cells. Furthermore, we also verified that EphB3 was a direct target gene of miR‐149 in CRC cells. EphB3, one of Eph transmembrane tyrosine kinase receptors, play important roles in various of tumorigenesis.30, 31 Schmid et al. documented that overexpression of EphB3 and promoted tumor metastasis by enhancing cell survival and migration in non‐small‐cell lung cancer.18 Jerome et al.32 identified ephrinB3 as a negative regulator of cell proliferation and positive regulator of cell survival in the adult rodent brain. These findings demonstrate a crucial function for ephrinB3 in tumor progression. Our data show that EphB3 was a direct target gene of miR‐149 and regulated cell development progress, including cell proliferation, invasion, cell cycle, and cell apotosis by enhancing or knocking‐down EphB3 expression. In summary, our data indicated that miR‐149 may function as a tumor suppressor in CRCHCT116 and SW620 cells lines by targeting EphB3. Therefore, downregulation of miR‐149 promoted CRC cell proliferation and cell invasion, and silencing of EphB3 significantly reduced cell invasiveness, affected cycle progression distribution and increased apoptosis in CRC cells. Moreover, our results showed that EphB3 may function as an oncogene in the development of colorectal cancer. Therefore, miR‐149 may serve as a therapeutic target for colorectal cancer treatment. However, due to the fact that each miRNA may regulate many target genes which can affect carcinogenesis in different ways, more detailed molecular and cellular mechanisms underlining the action of miR‐149 targets are needed to investigate. In addition, miR‐149 might be derived from host cells in tumor micro‐environment, more cautious researches are indispensable to further assess the effect of EphB3 on tumor growth in vivo.

Disclosure Statement

None declared. Fig. S1. Construction of luciferase reporter vector. (a) Amplification of full length EphB3 3′UTR. (b) Verification of luciferase reporter vector construction by double digestion. Click here for additional data file. Fig. S2. miR‐149 relative expression level transfected with different concentration of miR‐149 mimics in CRC cell. Click here for additional data file. Fig. S3. Western blots analysis of cleaved caspase‐3 and cleaved caspase‐6 expression in CRC cells transfected with SiEphB3 or a SiRNA control. Click here for additional data file.
  30 in total

1.  SP1 mediates the link between methylation of the tumour suppressor miR-149 and outcome in colorectal cancer.

Authors:  Feng Wang; Yan-Lei Ma; Peng Zhang; Tong-Yi Shen; Chen-Zhang Shi; Yong-Zhi Yang; Mary-Pat Moyer; Hui-Zhen Zhang; Hong-Qi Chen; Yong Liang; Huan-Long Qin
Journal:  J Pathol       Date:  2013-01       Impact factor: 7.996

2.  Genetic variants in miR-146a, miR-149, miR-196a2, miR-499 and their influence on relative expression in lung cancers.

Authors:  Serena Vinci; Stefania Gelmini; Nicola Pratesi; Simona Conti; Francesca Malentacchi; Lisa Simi; Mario Pazzagli; Claudio Orlando
Journal:  Clin Chem Lab Med       Date:  2011-09-09       Impact factor: 3.694

3.  miR-340 inhibition of breast cancer cell migration and invasion through targeting of oncoprotein c-Met.

Authors:  Zheng-sheng Wu; Qiang Wu; Chao-qun Wang; Xiao-nan Wang; Jing Huang; Jing-jing Zhao; Shan-shan Mao; Gui-hong Zhang; Xiao-chun Xu; Nong Zhang
Journal:  Cancer       Date:  2011-01-10       Impact factor: 6.860

4.  Grade-specific expression profiles of miRNAs/mRNAs and docking study in human grade I-III astrocytomas.

Authors:  Dan Li; Pan Chen; Xia-Yu Li; Li-Yang Zhang; Wei Xiong; Ming Zhou; Lan Xiao; Fang Zeng; Xiao-Ling Li; Ming-Hua Wu; Gui-Yuan Li
Journal:  OMICS       Date:  2011-10

5.  MicroRNA expression profiles classify human cancers.

Authors:  Jun Lu; Gad Getz; Eric A Miska; Ezequiel Alvarez-Saavedra; Justin Lamb; David Peck; Alejandro Sweet-Cordero; Benjamin L Ebert; Raymond H Mak; Adolfo A Ferrando; James R Downing; Tyler Jacks; H Robert Horvitz; Todd R Golub
Journal:  Nature       Date:  2005-06-09       Impact factor: 49.962

6.  MicroRNA-218 is deleted and downregulated in lung squamous cell carcinoma.

Authors:  Morgan R Davidson; Jill E Larsen; Ian A Yang; Nicholas K Hayward; Belinda E Clarke; Edwina E Duhig; Linda H Passmore; Rayleen V Bowman; Kwun M Fong
Journal:  PLoS One       Date:  2010-09-03       Impact factor: 3.240

7.  MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer.

Authors:  I A Asangani; S A K Rasheed; D A Nikolova; J H Leupold; N H Colburn; S Post; H Allgayer
Journal:  Oncogene       Date:  2007-10-29       Impact factor: 9.867

8.  MicroRNA-149 inhibits proliferation and cell cycle progression through the targeting of ZBTB2 in human gastric cancer.

Authors:  Ying Wang; Xiushan Zheng; Zhiyong Zhang; Jinfeng Zhou; Guohong Zhao; Jianjun Yang; Limin Xia; Rui Wang; Xiqiang Cai; Hao Hu; Cailin Zhu; Yongzhan Nie; Kaichun Wu; Dexin Zhang; Daiming Fan
Journal:  PLoS One       Date:  2012-10-29       Impact factor: 3.240

9.  An in silico analysis of dynamic changes in microRNA expression profiles in stepwise development of nasopharyngeal carcinoma.

Authors:  Zhaohui Luo; Liyang Zhang; Zheng Li; Xiayu Li; Gang Li; Haibo Yu; Chen Jiang; Yafei Dai; Xiaofang Guo; Juanjuan Xiang; Guiyuan Li
Journal:  BMC Med Genomics       Date:  2012-01-19       Impact factor: 3.063

10.  miRecords: an integrated resource for microRNA-target interactions.

Authors:  Feifei Xiao; Zhixiang Zuo; Guoshuai Cai; Shuli Kang; Xiaolian Gao; Tongbin Li
Journal:  Nucleic Acids Res       Date:  2008-11-07       Impact factor: 16.971

View more
  13 in total

1.  MicroRNA-149-3p expression correlates with outcomes of adrenocortical tumor patients and affects proliferation and cell cycle progression of H295A adrenocortical cancer cell line.

Authors:  Keteryne Rodrigues da Silva; Luciana Chain Veronez; Carolina Alves Pereira Correa; Régia Caroline Peixoto Lira; Mirella Baroni; Rosane de Paula Silva Queiroz; Sonir Roberto Rauber Antonini; José Andres Yunes; Silvia Regina Brandalise; Luiz Gonzaga Tone; Carlos Alberto Scrideli
Journal:  Hum Cell       Date:  2022-09-02       Impact factor: 4.374

2.  Expression of miR-149-3p inhibits proliferation, migration, and invasion of bladder cancer by targeting S100A4.

Authors:  Dengke Yang; Guang Du; An Xu; Xuetao Xi; Dong Li
Journal:  Am J Cancer Res       Date:  2017-11-01       Impact factor: 6.166

3.  Formononetin inhibits colon carcinoma cell growth and invasion by microRNA‑149‑mediated EphB3 downregulation and inhibition of PI3K/AKT and STAT3 signaling pathways.

Authors:  Ai-Lei Wang; Yong Li; Qun Zhao; Li-Qiao Fan
Journal:  Mol Med Rep       Date:  2018-04-05       Impact factor: 2.952

4.  MicroRNAs as biomarkers for the progression and prognosis of colon carcinoma.

Authors:  Hui Zhang; Zhuo Wang; Rong Ma; Jianzhong Wu; Jifeng Feng
Journal:  Int J Mol Med       Date:  2018-07-25       Impact factor: 4.101

5.  Sonic hedgehog pathway activation is associated with cetuximab resistance and EPHB3 receptor induction in colorectal cancer.

Authors:  Seong Hye Park; Min Jee Jo; Bo Ram Kim; Yoon A Jeong; Yoo Jin Na; Jung Lim Kim; Soyeon Jeong; Hye Kyeong Yun; Dae Yeong Kim; Bu Gyeom Kim; Sang Hee Kang; Sang Cheul Oh; Dae-Hee Lee
Journal:  Theranostics       Date:  2019-04-12       Impact factor: 11.556

6.  Circular RNA circNRIP1 acts as a microRNA-149-5p sponge to promote gastric cancer progression via the AKT1/mTOR pathway.

Authors:  Xing Zhang; Sen Wang; Haixiao Wang; Jiacheng Cao; Xiaoxu Huang; Zheng Chen; Penghui Xu; Guangli Sun; Jianghao Xu; Jialun Lv; Zekuan Xu
Journal:  Mol Cancer       Date:  2019-02-04       Impact factor: 27.401

7.  Circular RNA 100146 Promotes Colorectal Cancer Progression by the MicroRNA 149/HMGA2 Axis.

Authors:  Kunpeng Liu; Yuhua Mou; Xiufang Shi; Tingkun Liu; Zhanfeng Chen; Xingmei Zuo
Journal:  Mol Cell Biol       Date:  2021-01-25       Impact factor: 4.272

8.  Dual Strands of Pre-miR-149 Inhibit Cancer Cell Migration and Invasion through Targeting FOXM1 in Renal Cell Carcinoma.

Authors:  Atsushi Okato; Takayuki Arai; Yasutaka Yamada; Sho Sugawara; Keiichi Koshizuka; Lisa Fujimura; Akira Kurozumi; Mayuko Kato; Satoko Kojima; Yukio Naya; Tomohiko Ichikawa; Naohiko Seki
Journal:  Int J Mol Sci       Date:  2017-09-13       Impact factor: 5.923

Review 9.  miR-149 in Human Cancer: A Systemic Review.

Authors:  Yunjie He; Dandan Yu; Lingping Zhu; Shanliang Zhong; Jianhua Zhao; Jinhai Tang
Journal:  J Cancer       Date:  2018-01-01       Impact factor: 4.207

10.  Overexpressed methyltransferase-like 1 (METTL1) increased chemosensitivity of colon cancer cells to cisplatin by regulating miR-149-3p/S100A4/p53 axis.

Authors:  Yang Liu; Chunyan Yang; Yong Zhao; Qiang Chi; Zhen Wang; Boshi Sun
Journal:  Aging (Albany NY)       Date:  2019-12-20       Impact factor: 5.682

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.