| Literature DB >> 28367091 |
Kyung-Min Kwon1, Tae-Wook Chung2, Choong-Hwan Kwak3, Hee-Jung Choi2, Kyung-Woon Kim4, Sun-Hyung Ha3, Seung-Hak Cho5, Young-Choon Lee6, Ki-Tae Ha2, Moon-Jo Lee7, Cheorl-Ho Kim8.
Abstract
The disialoganglioside GD3 has been considered to be involved in tumor progression or suppression in various tumor cells. However, the significance of the biological functions of GD3 in breast cancer cells is still controversial. This prompted us to study the possible relationship(s) between GD3 expression and the metastatic potential of a breast cancer MDA-MB231 cells as an estrogen receptor negative (ER-) type. The human GD3 synthase cDNA was transfected into MDA-MB231 cells, and G-418 bulk selection was used to select cells stably overexpressing the GD3 synthase. In vitro invasion potentials of the GD3 synthase over-expressing cells (pc3-GD3s) were significantly suppressed when compared with control cells. Expression of intercellular adhesion molecule-1 (ICAM-1; CD54) was down-regulated in the pc3-GD3s cells and the decrease in ICAM-I expression is directly related to the decrease in invasiveness of the pc3-GD3s cells. Another type of ER negative SK-BR3 cells exhibited the similar level of ICAM-1 expression as MDA-MB231 cells, while the ER positive MCF-7 cells (ER+) showed the increased expression level of ICAM-1. Then, we investigated signaling pathways known to control ICAM-1 expression. No difference was observed in the phosphorylation of ERK and p38 between the pc3-GD3s and control cells (pc3), but the activation of AKT was inhibited in pc3-GD3s, and not in the control (pc3). In addition, the composition of total gangliosides was changed between control (pc3) and pc3-GD3s cells, as confirmed by HPTLC. The pc3-GD3s cells had an accumulation of the GD2 instead of the GD3. RT-PCR results showed that not only GD3 synthase, but also GM2/GD2 synthase (β4-GalNc T) expression was increased in pc3-GD3s cells. Overexpression of GD3 synthase suppresses the invasive potential of human breast cancer MDA-MB-231 cells through down-regulation of ICAM-1 and the crucial pathway to allow the apoptotic effect has been attributed to accumulation of the GD2 ganglioside. ER has been linked to the ICAM-1 expression with GD3 to GD2 conversion in human breast cancer cells. This is the first finding of the endogenous sialyltransferase functions in tumor cells.Entities:
Keywords: Breast cancer; GM2/GD2 synthase (β4-GalNc T); Ganglioside GD3 synthase; Intracellular adhesion molecule-1; Invasion.; MDA-MB231
Mesh:
Substances:
Year: 2017 PMID: 28367091 PMCID: PMC5370434 DOI: 10.7150/ijbs.16903
Source DB: PubMed Journal: Int J Biol Sci ISSN: 1449-2288 Impact factor: 6.580
RT-PCR primer sequences
| Genes | Primers | Anneling Temp. (°C) | PCR product size (bp) | |
|---|---|---|---|---|
| GD3 synthase | Fwd: atggctgtactggcgtggaagt | 55°C | 571 bp | |
| Rev: atgtctttctggaccacagaaggt | ||||
| GM3 synthase | Fwd: atccagttatcatcaaagagactgc | 55°C | 373 bp | |
| Rev: atacatcaagaaggctgtcaaaaac | ||||
| ICAM-1 | Fwd: cagtgaccatctacagctttccgg | 55°C | 556 bp | |
| Rev: gctgctaccacagtgatgatgacaa | ||||
| GM2/GD2 synthase | Fwd:atcggctacgggctctcatcacc | 55°C | 478 bp | |
| Rev:acctcgcgcaccttgtcagtcc | ||||
| β-actin | Fwd: caagagatggccacggctgct | 55°C | 247 bp | |
| Rev: tccttctgcatcctgtcggca |
Real-time PCR primer sequences
| Genes | Primers | Anneling Temp. (°C) | Ref. | |
|---|---|---|---|---|
| GD3 synthase | Fwd: gcgatgcaatctccctcct | 62°C | 4 | |
| Rev: ttgccgaattatgctgggat | ||||
| ICAM-1 | Fwd: cctgatgggcagtcaacagcta | 62°C | 32 | |
| Rev: acagctggctcccgtttca | ||||
| GAPDH | Fwd: aggtcatccctgagctgaacgg | 62°C | 44 | |
| Rev: cgcctgcttcaccaccttcttg |
Figure 1A) GD3 synthase gene expression patterns in human breast cancer cells. Total mRNA was isolated from breast cancer and SK-Mel II melanoma cells. The bar graphs represent the relative band intensity obtained from RT-PCR results by densitometry. For the expression levels of GD3 synthase mRNA, RT-PCR (B) and real-time PCR (C) analyses were performed. The protein expression was analyzed by Western blot (D). The pc3-GD3s cells were cultured with 1 mg/ml G-418. All experiments have been performed at least three times and we examined mean differences between groups by using the error bar graph procedure.
Figure 2The pc3-GD3s cells show changes in morphology but not in cell growth Cell were cultured in DMEM supplemented with 10% or 5% FBS. The pc3 (◆ ) and pc3-GD3s cells (■) were plated in triplicates. Cell growth in different serum conditions was assessed by the XTT assay after 24 hr (A). The cell morphology was observed by phase contrast microscopy (B). Inhibition of invasiveness in GD3 synthase-transfected MDA-MB231 cells (C). Representative microphotographs of Hematoxylin and Eosin stained cells. Cells that invaded through the gelatin and were located on the underside of the filter were counted. All experiments performed at least three times and we examined mean differences between groups by using the error bar graph procedure.
Figure 3Downregulation of ICAM-1 expression (A, B, C, D, E) in pc3-GD3s cells. Expression levels of ICAM-1 mRNA were checked by RT-PCR (A) and real-time PCR (B). Expression of ICAM-1 confirmed by Western blot (C) and FACS analysis (D). A schematic representation of DNA constructions containing two different forms of the ICAM-1 promters linked to the luciferase reporter gene is shown. The values represent the mean ±S.D. for three independent experiments with triplicate measurements (E). Inhibition of AKT phosphorylation in pc3-GD3s cells (F). Total protein extracts from pc3 and pc3-GD3s cells were examined by Western blot analysis with anti-phospho-AKT, anti-AKT, anti-phospho-ERK1/2, anti-ERK1/2, anti-phospho-p38 and anti-p38 antibodies. The nonspecific IgG antiserum has been used to block the cell reaction. GAPDH was included as an internal control. All experiments performed at least three times and we examined mean differences between groups by using the error bar graph procedure.
Figure 4Differential regulation of ICAM-1 expression in pc3-GD3s-trasnfected SK-BR3 (ER-) and MCF-7 (ER+) cells. Expression levels of GM3 synthase, GD3 synthase and ICAM-1 mRNAs in the pc3-GD3s-transfected SK-BR3 (ER-) were checked by RT-PCR (A) and relative band intensities were compared with each β-actin control (B). β-Actin was included as an internal control. For MCF-7 (ER+) cells, ICAM-1 mRNA level in the pc3-GD3s-transfected MCF-7 cells was examined by Western blot analysis (C) and relative band intensity was also compared with GAPDH control (D). All experiments performed at least three times. We examined mean differences between groups by using the error bar graph procedure.
Figure 5Accumulation of the GD2 ganglioside in pc3-GD3s cells. (A) The total ganglioside on a HPTLC plate. (B) Comparison of ganglioside contents in pc3 and pc3-GD3s cells. Percentage of each ganglioside was measured by densitometry with total gangliosides of each lane as 100%. (C) Total mRNA was isolated from pc3 and pc3-GD3s cells. GD2 synthase (β4-GalNc T) was detected by RT-PCR (30 cycles). The bar graphs represent the relative band intensity obtained from the RT-PCR results by densitometry.