Literature DB >> 28362829

OAZ1 knockdown enhances viability and inhibits ER and LHR transcriptions of granulosa cells in geese.

Bo Kang1,2, Dongmei Jiang1,2, Rong Ma1, Hui He1, Zhixin Yi1, Ziyu Chen1.   

Abstract

An increasing number of studies suggest that ornithine decarboxylase antizyme 1 (OAZ1), which is regarded as a tumor suppressor gene, regulates follicular development, ovulation, and steroidogenesis. The granulosa cells in the ovary play a critical role in these ovarian functions. However, the action of OAZ1 mediating physiological functions of granulosa cells is obscure. OAZ1 knockdown in granulosa cells of geese was carried out in the current study. The effect of OAZ1 knockdown on polyamine metabolism, cell proliferation, apoptosis, and hormone receptor transcription of primary granulosa cells in geese was measured. The viability of granulosa cells transfected with the shRNA OAZ1 at 48 h was significantly higher than the control (p<0.05). The level of putrescine and spermidine in granulosa cells down-regulating OAZ1 was 7.04- and 2.11- fold higher compared with the control, respectively (p<0.05). The CCND1, SMAD1, and BCL-2 mRNA expression levels in granulosa cells down-regulating OAZ1 were each significantly higher than the control, respectively (p<0.05), whereas the PCNA and CASPASE 3 expression levels were significantly lower than the control (p<0.05). The estradiol concentration, ER and LHR mRNA expression levels were significantly lower in granulosa cells down-regulating OAZ1 compared with the control (p<0.05). Taken together, our results indicated that OAZ1 knockdown elevated the putrescine and spermidine contents and enhanced granulosa cell viability and inhibited ER and LHR transcriptions of granulosa cells in geese.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28362829      PMCID: PMC5376318          DOI: 10.1371/journal.pone.0175016

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Ornithine decarboxylase antizymes (OAZs) bind to ornithine decarboxylase (ODC), which in turn enhance the degradation of the enzyme protein by the 26S proteasome and also inhibit intracellular polyamine influx [1-3]. Thus, OAZs are considered as negative regulators of intracellular polyamines. Polyamines are essential for cellular processes such as cell growth and proliferation, and hence play important roles in reproduction [4, 5]. Among four types of OAZs described to date [6], the prototype and the most highly investigated form is OAZ1, which is expressed ubiquitously at significantly higher levels and is believed to be the predominant factor in the regulation of ODC [7, 8]. The essential role of OAZ1 in inhibiting ODC and polyamine uptake suggests that OAZ1 is a negative regulator of cell proliferation and tumor development [9-11]. Recent studies have indicated that OAZ1 also prevents centrosome abnormalities and facilitates DNA double-strand break repairs [12, 13]. Fong et al. reported that OAZ1 overexpression reduced the forestomach cell proliferation and increased apoptosis in mice with forestomach carcinogenesis [14]. Further, OAZ1 overexpression has been shown to have a tumor-suppressive effect in C57BL/6 and DBA/2 mice [15]. In addition to accelerate the degradation of ODC, an increasing number of studies indicate that OAZ1 also binds to and accelerates the degradation of other proteins shown to regulate cell proliferation, such as AURKA, CCND1, and SMAD1 [16-18]. The goose is one of the most important waterfowl species and is also a vital component in the fast-growing poultry industry of China [19, 20]. The study to improve goose laying performance is very important for poultry industry development. Our previous study suggested that increased OAZ1 expression might disrupt polyamine homeostasis by inhibiting ODC activity and suppress follicular development in geese [21]. Recently, studies from our and others laboratories indicate that OAZ1 regulates the ovarian and follicular development and ovulation by mediating intracellular polyamine homeostasis in the ovary [21-23]. Granulosa cells play a critical role in ovarian functions such as follicular development, ovulation, and steroidogenesis in both mammals and birds. To date, and to our knowledge, studies on OAZ1 regulating ovarian functions, particularly granulosa cells, are scarce. The action of OAZ1 mediating physiological functions of granulosa cells is obscure. We therefore undertook studies using short hairpin RNA (shRNA) targeted to OAZ1, with the aim of determining the importance of OAZ1 in polyamine metabolism, cell proliferation, apoptosis, and hormone responsiveness of primary granulosa cells in geese. The results indicated that OAZ1 knockdown elevated the putrescine and spermidine contents and enhanced granulosa cell viability and inhibited estrogen receptor (ER) and luteinizing hormone receptor (LHR) transcriptions of granulosa cells in geese.

Materials and methods

Ethics statement

All animal experiments of this study were approved by the Animal Care and Use Committee of the Sichuan Agricultural University (Chengdu, China), in order to ensure compliance with international guidelines for animal welfare.

Animals, primary granulosa cell collection and culture

The Sichuan white geese (Anser cygnoides) used in this study were from the Experimental Farm of Waterfowl Breeding in Sichuan Agricultural University (Ya’an, China). The animals were kept under same environmental conditions and provided ad libitum water and locally available commercial feed. The geese were exposed to natural lighting and temperature. Adult female geese during the egg-laying stage were killed by exsanguination to obtain the whole ovary under anesthesia with 3% isofulurane (35 mg/kg body weight). The primary granulosa cells were collected as the method described by Gilbert et al. [24]. Granulosa cells were cultured in a humidified incubator at 37°C and 5% CO2 in a Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12, Thermo Fisher scientific, Shanghai, China) medium supplemented with 3% fetal bovine serum (FBS) and 100 U/ml penicillin/streptomycin to a concentration of 1 × 105 cells/ml.

Granulosa cell viability assay

Granulosa cell viability was determined using a 3-(4, 5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. Granulosa cells were plated at a density of 3–5×103 cells per well in a 96-well plate. Viable cells were stained with MTT solution (0.1 mg/ml, 4 h). Formazan crystals were dissolved by 100 μl dimethylsulfoxide (DMSO). Absorbance was measured at 570 nm using a spectrophotometer (Thermo Fisher scientific, Vantaa, Finlan). Each analysis was performed using three replicate wells.

shRNA OAZ1 construction and transfection

Plasmid DNA encoding green fluorescent protein (GFP) and shRNA OAZ1 vector was constructed from Pentr/U6/shRNA/GFP vector (BGI, Shenzhen, China). The targeted OAZ1 sequence (GenBank accession number KC845302) was 5′-GCGGATACTCAACAGTCACTG-3′ using the specific primers (forward: 5′-CACCGCGGATACTCAACAGTCACTGCGAACAGTGACTGTTGAGTATCCG-3′ and reverse: 5′-AAAAGCGGATACTCAACAGTCACTGTTCGCAGTGACTGTTGAGTATCCGC-3′). Ligation products with shRNA OAZ1 were transformed into Escherichia coli DH5a competent cells, and verified by sequencing. For transfection, 1.0 μg of shRNA OAZ1 plasmid, 3.0 μl X-tremeGENE™ HP DNA Transfection Reagent (Roche, Shanghai, China), and up to 100 μl DMEM/F-12 medium were applied per well of 12-well culture plates and co-incubated overnight. The level of OAZ1 mRNA expression was detected using quantitative real-time PCR (qPCR) as detailed below. Granulosa cells and culture medium were harvested at 24, 48, and 72 h after transfection for the analyses. Each group had three replicates, and the same treatment was repeated in triplicate.

Total RNA extraction and qPCR

Total RNA was extracted from granulosa cells using the RNAiso Plus kit (Takara, Dalian, China) following the manufacturer’s protocol. Reverse transcription to obtain cDNA was performed using a PrimeScript™ RT reagent kit with a gDNA Eraser (Takara). Primers used in this experiment were synthesized in BGI Company (Shenzhen, China) (Table 1). qPCR detection and expression analysis of genes was then carried out using the iQ SYBR Green Supermix kit (Bio-Rad Laboratories, CA, USA). Threshold and threshold cycle (Ct) values were determined automatically by the CFX ManagerTM Software (Bio-Rad Laboratories) using default parameters. The comparative cycle threshold (2-ΔΔCt method) was used to analyze the expression levels of genes examined in this study. The abundance of each gene transcripts was normalized by GAPDH gene expression levels and expressed as arbitrary units (AU). The relative quantization of gene expression was performed in three replicates for each sample.
Table 1

Oligonucleotide PCR primer sets used in this study.

PrimersSequence (5’ - 3’)SizeTm
OAZ1F: CAGGTGGGCGAGGGAATAGT142 bp65°C
R: GCATCTGTAAGCCTTGACTGGAC
OAZ2F: AAGCCTCATGTTGTCCACTTC142 bp65°C
R: GTGCTGATAACCCTTCTTTGC
AZINF: GCTCTTACTGCACATTGCCACA180 bp58°C
R: TGAATGTACGTTTGCAGTTCCTTG
ODCF: TGTATCTGCTTGACATTGGTGGTG146 bp60°C
R: CAGGAAGATACTATGTCGCATCAGC
SAMDCF: GCTTGACCCAGTAGTTATGGACCA180 bp58°C
R: TGAATAGTCCAGTAAGTTCCATCCG
SPDSF: TCTGCTGCCAAGGTGAGTGC111 bp55°C
R: AGGGATGGTGCAATAGGCGTA
SPMSF: GTGCTGATCCTTGGAGGTGGT110 bp55°C
R: TTACACCCGTCGATCACCATT
SMOF: GGCATCAATACCACCGACAAG116 bp55°C
R: TAAGTCAAGCTCTCGCTCTCCG
SSATF: CACCCTTTCTACCACTGTCTG173 bp58°C
R: CCAATGCCAAGTCCTCTGT
APAOF: GAGTTTGAGCAACCCTTCTGG143 bp58°C
R: TGGCTGGAGGACCACAAA
CCND1F: CTGCTTCGTCCTCTACAGTCTTTG163 bp55°C
R: TTCTTGGCAGGCTCGTAAACA
AURKAATCATACTGTCATTCAAAGAGCGTG169 bp55°C
CATTTCAGGAGGCAAGTAGTCAAG
PCNAF: AGAAATGAATGAGCCAGTCCAGC178 bp55°C
R: TTCAATCTTTGGAGCCAGGTAGT
BCL-2F: GATGCCTTCGTGGAGTTGTATG98 bp60°C
R: GCTCCCACCAGAACCAAAC
SMAD1F: CCGCTTGTAGTGGTAAGGATTGA146 bp55°C
R: AATTACATGCGGCAGCCCTT
BAXF: CCACAAGCAAGCAAAGAGCC162 bp58°C
R: CTGTAATGGCAACTGTAAATGCTTC
CASPASE 8F: GGTGTCGCAGTTCAGGTA127 bp57°C
R: CATTGTAGTTTCAGGGCTT
CASPASE 9F: TTCCAGGCTCTGTCGGGTAA150 bp64°C
R: GTCCAGCGTTTCCACATACCA
CASPASE 3F: CTGGTATTGAGGCAGACAGTGG158 bp60°C
R: CAGCACCCTACACAGAGACTGAA
ERF: ACCCAAACAGACCATTCAACGAA187 bp56°C
R: CGCCAGACTAAGCCAATCATCAG
FSHRF: TCCTGTGCTAACCCTTTCCTCTA207 bp59°C
R: AACCAGTGAATAAATAGTCCCATC
LHRF: GTAACACTGGAATAAGGGAAT191 bp53°C
R: GAAGGCTTGACTGTGGATA
GAPDHF: GTGGTGCAAGAGGCATTGCTGAC86 bp55°C
R: GCTGATGCTCCCATGTTCGTGAT

Polyamine contents measurement

Putrescine, spermidine, and spermine contents in granulosa cells were determined by high performance liquid chromatography (HPLC) analysis with an Agilent 1100 Series system (Agilent Technologies, CA, USA) following a benzoylation procedure. The separation was achieved on a chromatographic column Chromstar TM C18 (5 μm, 4.6 × 250 mm, Agilent Technologies) in an HPLC system using a fluorescence detector set excitation wavelength at 229 nm. The proportion of mobile phase A (methyl alcohol) and B (water) was 62:38 (v/v). The isocratic elution was performed as follows: 17 min, 62% mobile phase A. The column temperature was maintained at 25°C, the flow rate was at 1 ml/min, and the injection volume was 20 μl. Results were compared to the internal standard (1, 6-hexanediamine) and the standard curves for putrescine, spermidine and spermine standards (Sigma-Aldrich, Shanghai, China). The inter-assay coefficients of variation were <10%.

Hormone assays

Levels of follicle-stimulating hormone (FSH), LH and estradiol in the culture medium for granulosa cells were determined by using a Goose hormone ELISA kit (Bangyi, Shanghai, China). Briefly, the 50 μl standard was added to the standard wells, and 10 μl of the measuring sample and 40 μl of the sample diluent were added to the measuring sample wells. Then, 100 μl of horseradish peroxidase-conjugate reagent was added, and the wells covered with microplate sealers and incubated for 60 min at 37°C. Each well was aspirated and washed five times with washing buffer. Next, 50 μl of chromogen solution A and 50 μl of chromogen solution B were added to each well. Wells were gently mixed and incubated for 15 min at 37°C, and protected from light. Finally, 50 μl stopping solution was added, and hormone levels were determined by absorbance at 450 nm within 15 min using a spectrophotometer (Thermo Fisher Scientific). The standard curve indicated a direct relationship between optical density and hormone content.

Statistical analyses

The data were analyzed by a one-way analysis of variance using SAS 9.1 statistical software (SAS Institute Inc., NC, USA). Statistically significant results were further analyzed by Duncan’s multiple range test. The data were presented as the mean ±SEM. A value of p<0.05 was considered significant.

Results

OAZ1 knockdown enhanced the viability of granulosa cells

Geese primary granulosa cells were either transfected with shRNA targeting OAZ1 or control shRNA. As shown in Fig 1A, the level of OAZ1 mRNA expression in granulosa cells transfected with shRNA OAZ1 at 48 and 72 h was significantly lower than the control (p<0.05). The viability of granulosa cells transfected shRNA OAZ1 at 48 h was significantly higher than the control (p<0.05) (Fig 1B). Thus, granulosa cells at 48 h after shRNA OAZ1 transfection were employed to conduct the subsequent research.
Fig 1

Characteristics of granulosa cells in geese 24 h, 48 h and 72 h after shRNA OAZ1 transfection.

A: The OAZ1 mRNA expression level in granulosa cells. B: The activity of granulosa cells.

Characteristics of granulosa cells in geese 24 h, 48 h and 72 h after shRNA OAZ1 transfection.

A: The OAZ1 mRNA expression level in granulosa cells. B: The activity of granulosa cells.

OAZ1 knockdown elevated putrescine and spermidine contents by mediating the expression of polyamine metabolic enzyme genes

To determine the action of OAZ1 regulating polyamine homeostasis in primary granulosa cells from geese, the expression levels of polyamine metabolic enzyme [3, 25, 26] genes and polyamine levels (Figs 2 and 3, and Table 2) were measured. The OAZ2, SAMDC, SPDS, and APAO mRNA expression levels in granulosa cells silencing OAZ1 were significantly higher than the scramble (p<0.05). The ODC and SSAT mRNA expression levels in granulosa cells down-regulating OAZ1 were significantly lower than the control (p<0.05). The putrescine and spermidine contents in granulosa cells transfected shRNA OAZ1 were 7.04- and 2.11-fold higher compared with the control, respectively (p<0.05). However, spermine concentration was not significantly different compared with the control (p>0.05).
Fig 2

Expression levels of genes related to polyamine metabolism in granulosa cells.

The data were presented as the mean ± SEM. Bars with a star were significantly different (p<0.05).

Fig 3

Polyamines concentration in granulosa cells.

The data were presented as the mean ± SEM. Bars with a star were significantly different (p<0.05).

Table 2

Polyamines concentration (nmol/106 cell) in granulosa cells.

shRNA ScrambleshRNA OAZ1
Putrescine0.49 ± 0.033.45±0.09*
Spermidine3.65 ± 0.057.69±0.07*
Spermine1.55 ± 0.242.24±0.47

The data were presented as the mean ± SEM.

*denotes a significantly different (p<0.05).

Expression levels of genes related to polyamine metabolism in granulosa cells.

The data were presented as the mean ± SEM. Bars with a star were significantly different (p<0.05).

Polyamines concentration in granulosa cells.

The data were presented as the mean ± SEM. Bars with a star were significantly different (p<0.05). The data were presented as the mean ± SEM. *denotes a significantly different (p<0.05).

OAZ1 altered expression abundance of cell proliferation and apoptosis genes in granulosa cells

Further, we performed qPCR to elucidate the effect of OAZ1 knockdown on the transcriptions of genes related to granulosa cell proliferation and apoptosis. As shown in Fig 4, the amount of CCND1 (encoding the Cyclin D1 protein which is crucial for the transition of cells from G1 to S phase), SMAD1 (encoding the SMAD1 protein which is an intracellular protein that transduce extracellular signals from TGF beta ligands to the nucleus), and BCL-2 (encoding the BCL-2 protein which is specifically considered an important anti-apoptotic protein) mRNA expression in granulosa cells down-regulating OAZ1 was significantly higher than the control (p<0.05), and were 1.41-, 2.13- and 1.35-fold higher compared with the control, respectively. Whereas the PCNA (a cell proliferation marker) and CASPASE 3 transcripts in granulosa cells down-regulating OAZ1 were 0.61- and 0.75-fold higher, respectively, compared with the control (p<0.05). However, the expression levels of AURKA (encoding the AURKA protein which plays an essential role in mitotic events, peaks during the G2 phase to M phase transition), BAX (encoding the BAX protein which forms a heterodimer with BCL-2 and functions as an apoptotic activator), CASPASE 8 and 9 were not significantly different than the vehicle group (p>0.05).
Fig 4

Expression levels of genes related to granulosa cell proliferation and apoptosis.

The data were presented as the mean ± SEM. Bars with a star were significantly different (p<0.05).

Expression levels of genes related to granulosa cell proliferation and apoptosis.

The data were presented as the mean ± SEM. Bars with a star were significantly different (p<0.05).

OAZ1 knockdown down-regulated estradiol concentration in culture media and ER and LHR mRNA expression levels in granulosa cells

The estradiol concentration underwent a slight but statically significant decrease in culture media for granulosa cells down-regulating OAZ1 compared with the control (748.73±4.21 vs 781.65±6.69 pg/ml) (p<0.05), while FSH and LH contents were not significantly different. As shown in Fig 5, the ER and LHR mRNA expression levels were significantly lower in granulosa cells silencing OAZ1 compared with the control (p<0.05).
Fig 5

Expression levels of hormone receptor genes in granulosa cells.

The data were presented as the mean ± SEM. Bars with a star were significantly different (p<0.05).

Expression levels of hormone receptor genes in granulosa cells.

The data were presented as the mean ± SEM. Bars with a star were significantly different (p<0.05).

Discussion

Numerous studies have found that polyamines play key roles in both normal and abnormal functions of cells [27]. OAZ1 plays a central role in the regulation of polyamine homeostasis [28]. Increased OAZ1 levels in response to polyamines led to inhibition of growth in IEC-6 cells, which was restored by inhibiting OAZ synthesis by asparagine in the presence of spermidine or spermine [29]. In agreement with that study, our result corroborated further that down-regulated OAZ1 enhanced the growth of primary granulosa cells. Enhanced levels of polyamines, including putrescine and spermidine, are associated with cell proliferation and hyper-proliferation [30]. Furthermore, OAZ1 affects cell proliferation and viability solely by modulating cellular polyamine metabolism in NIH3T3 and HEK-293 cells [31]. However, Ray et al. suggested that the effect of OAZ1 on IEC-6 cell growth was independent of polyamines [32]. In the present study, OAZ1 silencing resulted in an increase of the putrescine and spermidine concentrations, and an unchanged spermine concentration. This finding was in keeping with the result in HEK-CMV-Luc2-Hygro cells reported by Xiao et al. [33]. Thus, in consideration of the mechanism of polyamine action varying among cell types, whether increased viability of granulosa cells silenced OAZ1 resulted from suppressed OAZ1 expression, or decreased the putrescine and spermidine contents, remains to be determined. OAZ2 has structure and tissue distribution similar to that of OAZ1, but it is expressed at significantly lower levels [8]. OAZ1 knockdown in granulosa cells induced OAZ2 expression, suggesting that OAZ2 played an important role in suppressing ODC by compensating for decreased OAZ1 [8, 34]. Increased OAZ2 and decreased ODC transcription might contribute to counteract sharp increase of the putrescine content in granulosa cells silencing OAZ1. It is possible that augmented spermidine content in granulosa cells down-regulating OAZ1 resulted from enhanced levels of SAMDC and SPDS mRNA expression. These results suggested that OAZ1 knockdown disturbed intracellular polyamine homeostasis with elevated putrescine and spermidine contents, and accelerated the growth of granulosa cells of geese in vitro. OAZ1 has been shown to function by inhibiting cell proliferation and antitumor activity [14]. In the current study, CCND1, SMAD1, and BCL-2 mRNA expression in granulosa cells down-regulating OAZ1 with decreased CASPASE 3 expression level were significantly higher than the scramble group. Polyamine biosynthesis has been shown to peak at the G1/S transition regulated by CCND1 [35]. OAZ1 overexpression in zinc-deficient mice restrained CCND1 expression in the forestomach [14]. SMAD1 is known to serve as a signaling intermediate for bone morphogenetic proteins and anti-mullerian hormone, which are critical in regulating granulosa cell growth and differentiation [36]. OAZ1 overexpression induced a small decrease in the concentration of BCL-2 protein [37]. It corroborated the hypothesis that OAZ1 functions as inhibiting cell proliferation and promoting apoptosis. These results, including our data, indicate that OAZ1 knockdown enhanced granulosa cell growth by up-regulating the transcriptions of proliferation-promoting and anti-apoptosis genes, and suppressing the activation of apoptosomal CASPASE 3 cascade. As mentioned above, OAZ1 is a negative regulator of cell proliferation [9, 10], and PCNA is a cell proliferation marker. Our present data showed that the viability of granulosa cells down-regulating OAZ1 increased, while the level of PCNA mRNA expression decreased. However, the reason remains to be elucidated. Additionally, though OAZ1 can mediate degradation of AURKA [17], our study suggested that silencing of OAZ1 did not alter AURKA transcription. Numerous studies have suggested that FSH, LH, and estradiol induce ODC activity and hence polyamines [4, 38]. Bastida et al. reported that ODC/polyamines played important roles in mediating the effect of LH on follicular development and luteinization [39]. Polyamines are also important in directly regulating the ligand–membrane receptor interaction and gene-activating functions of ER in human breast cancer cells [40, 41]. Our results showed that knockdown of OAZ1 decreased estradiol content in culture media and suppressed ER and LHR mRNA expression in granulosa cells of geese. On the contrary, OAZ1 overexpression suppressed ER mRNA expression in human breast cancer cells [42]. One possible explanation was that the function of OAZ1 mediating ER transcription might vary between primary normal and cancer cells. Additionally, oligoamines (a specific polyamine analogues) suppressed expression of ER in human breast cancer cells [43]. Whether increased putrescine and spermidine concentrations decreased ER mRNA expression level remains to be determined. Taken together, data from our study and others indicate that OAZ1 and/or polyamines play important roles in the responsiveness of granulosa cells toward estradiol and LH in geese, though a possible mechanism remains to be elucidated.

Conclusions

In conclusion, OAZ1 knockdown, with elevated putrescine and spermidine contents enhanced granulosa cell viability by affecting the transcriptions of genes related with granulosa cell proliferation and apoptosis, as well as inhibited ER and LHR transcriptions of granulosa cells in geese. Our current study provides the first evidence that OAZ1 and/or polyamines play an important role in regulating primary granulosa cell viability and hormone receptor expression.
  43 in total

Review 1.  Regulation of cellular polyamines by antizyme.

Authors:  P Coffino
Journal:  Nat Rev Mol Cell Biol       Date:  2001-03       Impact factor: 94.444

2.  Tamoxifen metabolite endoxifen interferes with the polyamine pathway in breast cancer.

Authors:  T J Thomas; Thresia Thomas; Shali John; Hui-Chen Hsu; PingAr Yang; Tuomo A Keinänen; Mervi T Hyvönen
Journal:  Amino Acids       Date:  2016-07-20       Impact factor: 3.520

3.  Role of ornithine decarboxylase in regulation of estrogen receptor alpha expression and growth in human breast cancer cells.

Authors:  Qingsong Zhu; Lihua Jin; Robert A Casero; Nancy E Davidson; Yi Huang
Journal:  Breast Cancer Res Treat       Date:  2012-09-14       Impact factor: 4.872

4.  Mouse skin chemical carcinogenesis is inhibited by antizyme in promotion-sensitive and promotion-resistant genetic backgrounds.

Authors:  David J Feith; Lisa M Shantz; Paula L Shoop; Kerry A Keefer; Chethana Prakashagowda; Anthony E Pegg
Journal:  Mol Carcinog       Date:  2007-06       Impact factor: 4.784

5.  Polyamines and neoplastic growth.

Authors:  A E Pegg; D J Feith
Journal:  Biochem Soc Trans       Date:  2007-04       Impact factor: 5.407

6.  Amino acids regulate expression of antizyme-1 to modulate ornithine decarboxylase activity.

Authors:  Ramesh M Ray; Mary Jane Viar; Leonard R Johnson
Journal:  J Biol Chem       Date:  2011-12-07       Impact factor: 5.157

7.  Targeted antizyme expression in the skin of transgenic mice reduces tumor promoter induction of ornithine decarboxylase and decreases sensitivity to chemical carcinogenesis.

Authors:  D J Feith; L M Shantz; A E Pegg
Journal:  Cancer Res       Date:  2001-08-15       Impact factor: 12.701

Review 8.  Functions of Polyamines in Mammals.

Authors:  Anthony E Pegg
Journal:  J Biol Chem       Date:  2016-06-07       Impact factor: 5.157

9.  Ornithine decarboxylase antizyme upregulates DNA-dependent protein kinase and enhances the nonhomologous end-joining repair of DNA double-strand breaks in human oral cancer cells.

Authors:  Takanori Tsuji; Miki Katsurano; Soichiro Ibaragi; Kaori Shima; Akira Sasaki; Guo-Fu Hu
Journal:  Biochemistry       Date:  2007-07-14       Impact factor: 3.162

10.  Transcriptome profiling of the goose (Anser cygnoides) ovaries identify laying and broodiness phenotypes.

Authors:  Qi Xu; WenMing Zhao; Yang Chen; YiYu Tong; GuangHui Rong; ZhengYang Huang; Yang Zhang; GuoBing Chang; XinSheng Wu; GuoHong Chen
Journal:  PLoS One       Date:  2013-02-06       Impact factor: 3.240

View more
  3 in total

1.  Exogenous spermidine affects polyamine metabolism in the mouse hypothalamus.

Authors:  Dongmei Jiang; Guilin Mo; Yilong Jiang; Bo Kang
Journal:  Open Life Sci       Date:  2021-01-20       Impact factor: 0.938

2.  The E3 Ubiquitin Ligase SYVN1 Plays an Antiapoptotic Role in Polycystic Ovary Syndrome by Regulating Mitochondrial Fission.

Authors:  Lihua Sun; Hongjuan Ye; Hui Tian; Lirong Xu; Junjie Cai; Caixia Zhang; Rongxiang Wang; Hui Yang; Shuang Zhao; Jiaozhi Zhang; Shaorong Gao
Journal:  Oxid Med Cell Longev       Date:  2022-09-19       Impact factor: 7.310

3.  Effect of 3-nitropropionic acid inducing oxidative stress and apoptosis of granulosa cells in geese.

Authors:  Bo Kang; Xinxing Wang; Qilin Xu; Yongsheng Wu; Xiaohui Si; Dongmei Jiang
Journal:  Biosci Rep       Date:  2018-09-12       Impact factor: 3.840

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.