Literature DB >> 28358058

MiR-126 and miR-126* regulate shear-resistant firm leukocyte adhesion to human brain endothelium.

Camilla Cerutti1,2, Laura J Edwards3,4, Helga E de Vries5, Basil Sharrack6, David K Male1, Ignacio A Romero1.   

Abstract

Leukocyte adhesion to brain endothelial cells, the blood-brain barrier main component, is a critical step in the pathogenesis of neuroinflammatory diseases such as multiple sclerosis (MS). Leukocyte adhesion is mediated mainly by selectins, cell adhesion molecules and chemokines induced by pro-inflammatory cytokines such as TNFα and IFNγ, but the regulation of this process is not fully clear. This study investigated the regulation of firm leukocyte adhesion to human brain endothelium by two different brain endothelial microRNAs (miRs), miR-126 and miR-126*, that are downregulated by TNFα and IFNγ in a human brain endothelial cell line, hCMEC/D3. Using a leukocyte adhesion in vitro assay under shear forces mimicking blood flow, we observed that reduction of endothelial miR-126 and miR-126* enhanced firm monocyte and T cell adhesion to hCMEC/D3 cells, whereas their increased expression partially prevented THP1, Jurkat and primary MS patient-derived PBMC firm adhesion. Furthermore, we observed that miR-126* and miR-126 downregulation increased E-selectin and VCAM1, respectively, while miR-126 overexpression reduced VCAM1 and CCL2 expression by hCMEC/D3 cells, suggesting that these miRs regulate leukocyte adhesion by modulating the expression of adhesion-associated endothelial mRNA targets. Hence, human brain endothelial miR-126 and miR-126* could be used as a therapeutic tool to reduce leukocyte adhesion and thus reduce neuroinflammation.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28358058      PMCID: PMC5372244          DOI: 10.1038/srep45284

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Leukocyte trafficking from the blood into the central nervous system (CNS) is a multistep process1, where firm adhesion between leukocytes and brain endothelial cells forming the blood-brain barrier is a critical step both in immunosurveillance2 and in neuroinflammatory diseases such as multiple sclerosis (MS)3. In the CNS, leukocyte adhesion occurs in postcapillary venules4 and is orchestrated by locally secreted pro-inflammatory cytokines567 such as TNFα and IFNγ, which induce expression of selectins, cell adhesion molecules and chemokines as E-selectin, vascular adhesion molecule 1 (VCAM1), chemokine (C-C motif) ligand 2 and 7 (CCL2 or MCP1 and CCL7 or MCP3)8. These key molecules are expressed in MS lesions7910 and have been shown to mediate firm leukocyte adhesion41112. However, the exact molecular control by human brain endothelial cells in the regulation of leukocyte adhesion remains to be fully understood. MicroRNAs (miRs) are a class of highly conserved, non-coding RNA molecules (20–25 nucleotides), that modulate gene expression by repression of their target genes at the post-transcriptional level13. MiRs are key regulators of a vast number of biological processes and disorders, including MS14 and those regulating neurovascular function in inflammation15, such as regulation of cell adhesion molecules and leukocyte adhesion to human brain endothelium1216. Human miR-126 (also known as miR-126-3p) and its complement, miR-126* (also known as miR-126-5p and originally named miR-123) originate from the same precursor, and their locus is hosted by intron-7 of the Egfl7 (epidermal grow factor-like domain 7) gene on chromosome 9. MiR-126 and miR-126* are amongst the most abundant miRs expressed in resting endothelium from different vascular beds1718, including CNS endothelium19. MiR-126 is a well-studied miR in vascular biology with a critical role in angiogenesis and vascular integrity1720 and it was the first miR studied in the context of endothelial adhesion molecule regulation in inflammation18. In addition, miR-126 regulates adhesion of human promyelocytic cell (HL-60) and chronic myelogenous leukemia (LAMA84) cells to human umbilical vein endothelial cells (HUVEC) by targeting VCAM11821. MiR-126* appears less abundant than miR-126 in endothelium1722. It has been shown to be implicated in erythropoiesis23, endothelial cell turnover24, cancer cell motility252627, monocyte recruitment by breast cancer epithelial cells through increased production of miR-126* targets CXCL12 (stromal cell-derived factor 1 Sdf-1a), CCL228 and it regulates leucocyte trafficking in lung by controlling ALCAM expression29. In this study, we investigated the roles of miR-126 and miR-126* in the control of leukocyte adhesion to human brain endothelium. Because leukocyte recruitment and adhesion in vivo occur in a dynamic system dominated by the shear flow of the circulating blood on the endothelium, we used a flow based adhesion assay. We report that human brain endothelial miR-126 and miR-126* regulate shear-resistant firm monocyte, T cell, healthy- and multiple sclerosis-derived PBMC adhesion to a human brain endothelial cell line, hCMEC/D3. Furthermore, we observed that human brain endothelial miR-126 and miR-126* effects on leukocyte adhesion to hCMEC/D3 can be partially accounted for by its modulation of expression of adhesion-related targets, VCAM1, CCL2 and E-selectin.

Results

TNFα + IFNγ increase E-selectin ICAM1 and VCAM1 expression, enhance firm leukocyte adhesion and downregulate miR-126 and miR-126* expression in hCMEC/D3 cells

Leukocyte adhesion is mediated mainly by CAMs and selectins expressed by endothelium. Previous studies have shown that the expression of VCAM1 and ICAM130 by hCMEC/D3 cells increased following stimulation with a combination of TNFα and IFNγ (100 U/ml + 100 ng/ml) for 24 h. In addition, it has been shown that TNFα alone increased E-selectin expression on primary human cerebral endothelium31. To assess the most suitable cytokine concentration to study leukocyte adhesion to human brain endothelial cells, a cytokine dose-response study on VCAM1, ICAM1 and E-selectin expression was performed by ELISA. An increase in VCAM1 (3-fold), ICAM1 and E-selectin (1.5-fold) expression by hCMEC/D3 cells was observed at the lowest concentration of cytokines used (0.1 ng/ml) (Fig. 1A). This effect was greater with 1 ng/ml (TNFα + IFNγ), but there was no further increase using higher concentration (10 ng/ml) of cytokines. ICAM2 is constitutively expressed on brain endothelium32 and does not increase in response to inflammatory stimuli33, thus ICAM2 was used as a control of a CAM whose levels are not increased by pro-inflammatory cytokines. Furthermore we observed a slight, but significant, decrease of ICAM2 expression levels by hCMEC/D3 cells when stimulated with cytokines at 1 ng/ml (Fig. 1A) as previously shown34. We confirm the effect of cytokines on VCAM1 expression on hCMEC/D3 monolayers cultured in the Ibidi® μ-Slide VI0.4 by immunohistochemistry (Fig. 1B). Given the observed increases of CAM and selectin expression on cytokine-treated hCMEC/D3 cells at 1 ng/ml (TNFα + IFNγ), we next investigated leukocyte adhesion to hCMEC/D3 cells under shear stress using live cell imaging. We observed a striking increase of firmly adhered shear-resistant T cells (Jurkat) and monocytes (THP1) to cytokine-stimulated hCMEC/D3, when compared to unstimulated conditions (Fig. 1C,D). Previous results from our group indicate that TNFα and IFNγ in combination (10 ng/ml, 24 h) decreased miR-126 and miR-126* expression in hCMEC/D3 by microRNA array35, here we generate a heatmap for miR-126 and miR-126* expression using a z-score derived from gene’s expression across all samples (row z-score) from published data in the public database Gene Expression Omnibus (GEO)-Geo accession GSE21350) (Fig. 1E). To investigate whether lower concentration of cytokines still downregulate both miR-126 and miR-126* in hCMEC/D3 cells, and, to confirm the microRNA array data, we performed qRT2-PCR using U6 as housekeeping gene. We found that TNFα and IFNγ in combination (1ng/ml, 24 h) reduce both miR-126 and miR-126* relative levels in hCMEC/D3 cells when compared to their expression in unstimulated cells by 30 and 70%, respectively (Fig. 1F).
Figure 1

TNFα + IFNγ increase E-selectin, ICAM1 and VCAM1 expression, enhance firm leukocyte adhesion and downregulate miR-126 and miR-126* expression in hCMEC/D3 cells.

hCMEC/D3 cell monolayers were treated with a combination of cytokines (TNFα + IFNγ) (A) at different concentrations (0, 0.1, 1, 10 ng/ml) or (B–D,F) at 1 ng/ml or left without (w/o) for 24 h. (A) VCAM1, ICAM1 and E-selectin expression levels were quantified by ELISA. (B) VCAM1 expression was quantified by immunofluorescence and expressed as Integrated Density in arbitrary units (A.U.). (C) Numbers of shear-resistant firmly adhered Jurkat and THP1 cells to hCMEC/D3 monolayer per field of view (FOV) (640 × 480 μm). (D) Representative images of shear-resistant firmly adhered fluorescently labelled Jurkat T cells (small white rounded cells) to unstimulated (left) or cytokine treated (right) hCMEC/D3 cells (monolayer of spindle shaped cells in bright field) per FOV (640 × 480 μm). (E) Heatmap representing miR-126 and miR-126* expression in unstimulated hCMEC/D3 cells and after stimulation (10 ng/ml of TNFα + IFNγ) for 24 h (n = 3). Individual repeats are shown in the heatmap. Blue indicates under expression, red overexpression, and intensity of color indicates relative change. Rows were colored using a z-score derived from a gene’s expression across all samples (row z-score). Data from Geo accession GSE21350 (Platform GPL14767) of miR-126 and miR-126* are represented. (F) Relative miR-126 and miR-126* level expression measured by qRT2-PCR from total RNA. The small nuclear RNA U6 was used as internal control. Experiments were carried out three times to four times with (A,B,F) three replicates (C) five FOV. Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, *compared to untreated (w/o TNFα + IFNγ).

Human brain endothelial miR-126 modulates THP1, Jurkat T cell, PBMC healthy donor and MS patient-derived firm adhesion to hCMEC/D3 cells

To investigate whether human brain endothelial miR-126 regulates T cell and monocyte adhesion to hCMEC/D3 cells, we used a gain- and loss-of-function approach to modulate endogenous miR-126 expression in human brain endothelial cells. In order to mimic the effect of pro-inflammatory cytokines, we first downregulate the endogenous level of miR-126 in hCMEC/D3 cells using a miR-126 antagonist (anti-miR-126), a chemically modified antisense ssRNA that block the activity of endogenous miRs by complementarity. Brain endothelial cell transfection with anti-miR-126 significantly reduced miR-126 expression in unstimulated hCMEC/D3 cells when compared to control (scrambled Anti-miR), and it was further decreased in the presence of cytokines (Fig. 2A). Then, we investigated whether miR-126 downregulation mimics the inflammatory niche in the context of monocytic and T cell adhesion to hCMEC/D3 cells under shear stress. Transfection with anti-miR-126 increased firm T cell (Jurkat) and monocyte (THP1) adhesion to unstimulated hCMEC/D3 cells by 50% (Fig. 2B), this effect was maintained to a lesser extent in the presence of cytokine in firm monocyte adhesion, however no significant changes were observed in cytokine-induced T cell adhesion (Fig. 2C).
Figure 2

Human brain endothelial miR-126 downregulation enhances shear-resistant firmly adhered Jurkat and THP1 cells to hCMEC/D3 cells.

hCMEC/D3 cell were transfected with control Scrambled Anti-miR (grey) or with Anti-miR-126 (black) followed by treatment with cytokines (TNFα + IFNγ, 1 ng/ml) for 24 h or left unstimulated. (A) Relative miR-126 level expression measured by qRT2-PCR from total RNA. The small nuclear RNA U6 was used as internal control. (B,C) Numbers of shear-resistant firmly adhered Jurkat T cells and THP1 monocytes to (B) unstimulated and (C) cytokine-stimulated hCMEC/D3 cells per field of view (FOV) (640 × 480 μm). Experiments were carried out three to five times (A) three replicates (B,C) five FOVs. Data are mean ± SEM. #P < 0.05, **P < 0.01, #compared to unstimulated.

To counteract cytokine-induced miR-126 downregulation, which led to an increased firm leukocyte adhesion to the human brain endothelium, we increased endogenous miR-126 levels in hCMEC/D3 cells with miR-126 precursors (pre-miR-126), a synthetic dsRNA that simulates naturally occurring mature miR-126. Brain endothelial cell transfection with pre-miR-126 significantly increased miR-126 expression in hCMEC/D3 cells both in the presence and absence of cytokines when compared to control (scrambled Pre-miR) (Fig. 3A). Increased human brain endothelial miR-126 expression remarkably decreased shear resistant T cell and monocyte adhesion by almost 50% to both unstimulated (Fig. 3B) and cytokine-treated human brain endothelial cells (Fig. 3C). To further demonstrate miR-126 contribution to the considerable reduction of immune cell firm adhesion to human brain endothelial cells in the context of vascular neuroinflammation, we reassessed the effect of miR-126 upregulation in cytokine-stimulated hCMEC/D3 cells with healthy donor and multiple sclerosis (MS) patient-derived peripheral blood mononuclear cell (PBMC) in order to mimic more closely the in vivo inflammatory event. Three different healthy donors and MS patient-derived PBMC from with different types of MS were used (Fig. 3D), relapsing-remitting MS (RRMS), secondary progressive MS (SPMS) and primary progressive (PPMS). We tested each healthy and MS donor sample for CD4+, CD8+, monocyte CD14+ and NK cells subpopulation proportion, and, we found they were comparable between samples (Supplemental Fig. S1). Using live cell adhesion imaging under flow conditions, we found that brain endothelial miR-126 overexpression decreased both healthy donor and MS-derived PBMC firm adhesion to cytokine-treated hCMEC/D3 cells by 50–60% in all samples tested (Fig. 3E,F and supplemental Video S1) when compared to control (Fig. 3E,F and supplemental Video S2). This confirms that miR-126 plays a role in the regulation of immune cell adhesion to human brain endothelium. In addition, we observed that MS derived PBMC adhesion to hCMEC/D3 cells under shear stress was initially characterized by capture of individual single cells, followed by, in some areas, branched strings formation of adhered PBMC around the previously captured cells, as shown in Fig. 3G and most of them were CD8+ T cells (Supplemental Fig. S1) as previously reported36, and, recently confirmed37.
Figure 3

miR-126 upregulation decreases monocytic, T cell, PBMC and MS-derived PBMC firm adhesion to hCMEC/D3 cells.

hCMEC/D3 cells were transfected with control Scrambled Pre-miR (grey) or with Pre-miR-126 (black) followed by treatment with cytokines (TNFα + IFNγ, 1 ng/ml) for 24 h or left unstimulated. (A) Relative miR-126 level expression measured by qRT2-PCR from total RNA. The small nuclear RNA U6 was used as internal control. (B,C) Numbers of shear-resistant firmly adhered Jurkat T cells and THP1 monocytes to (B) unstimulated and (C) cytokine-stimulated hCMEC/D3 monolayers per field of view (FOV) (640 × 480 μm). (D) Information of the three PBMC healthy donors and multiple sclerosis (MS) patient PBMC donors; pathological features, relapsing-remitting MS (RRMS), secondary progressive MS (SPMS), primary progressive (PPMS). (E,F) Numbers of shear-resistant firmly adhered (E) healthy donor PBMC and (F) MS patient derived PBMC to cytokine-stimulated hCMEC/D3 monolayers per field of view (FOV) (640 × 480 μm). (G) Representative images of shear-resistant firmly adhered healthy donor PBMC and MS patient derived PBMC MS to control scrambled Pre-miR or Pre-miR-126 transfected and cytokine-treated hCMEC/D3 cells (monolayer of spindle shaped cells in bright field) per FOV (640 × 480 μm). Experiments were carried out (B,C) three times to five times with five FOVs and (E,F) with ten FOVs. Data are mean ± SEM. *,#P < 0.05, **P < 0.01, ***P < 0.001, #compared to unstimulated.

Human brain endothelial miR-126* modulates leukocyte firm adhesion to hCMEC/D3 cells

MiR-126 partial complement, miR-126*, is also downregulated by cytokine (Fig. 1F) and by transfection with anti-miR-126* in unstimulated and cytokines-treated hCMEC/D3 cells (Fig. 4A). MiR-126* downregulation increased monocyte firm adhesion to both unstimulated and cytokine-stimulated hCMEC/D3 cells (Fig. 4B), while Jurkat T cell adhesion was, unexpectedly, partially prevented (Fig. 4C). The difference in miR-126* effect on monocyte and T cell firm adhesion could be accounted by its effect on different adhesion and immune-specific target mRNA of proteins that mediate adhesion. Increased levels of endothelial miR-126* with pre-miR-126* (Fig. 5A) still decreased both Jurkat T (~20%), THP1 (~50%) firm adhesion either to unstimulated (Fig. 5B) and cytokine-stimulated (Fig. 5C) hCMEC/D3 cells under flow. Furthermore, pre-miR-126* decreased healthy donor derived PBMC adhesion to stimulated hCMEC/D3 cells under flow (Fig. S2). These findings suggest that monocyte and T cell adhesion to brain endothelium may be regulated via different intracellular mechanisms by miR-126*.
Figure 4

miR-126* downregulation regulates THP1 monocyte and Jurkat T cell firm adhesion to hCMEC/D3 cells.

hCMEC/D3 cell were transfected with control Scrambled Anti-miR (grey) or with Anti-miR-126* (black) followed by treatment with cytokines (TNFα + IFNγ, 1 ng/ml) for 24 h or left unstimulated. (A) Relative miR-126* level expression measured by qRT2-PCR from total RNA. The small nuclear RNA U6 was used as internal control. (B,C) Numbers of shear-resistant firmly adhered (B) THP1 monocytes and (C) Jurkat T cells to unstimulated and cytokine-stimulated hCMEC/D3 cells per field of view (FOV) (640 × 480 μm). Experiments were carried out three times with (A) two replicates (B,C) five FOVs. Data are mean ± SEM. #P < 0.05, **P < 0.01, ***,###P < 0.001, #compared to unstimulated.

Figure 5

miR-126* upregulation decreases shear-resistant firmly adhered Jurkat and THP1 cells to hCMEC/D3 cells.

hCMEC/D3 cells were transfected with control Scrambled Pre-miR (grey) or with Pre-miR-126 (black) (A) Relative miR-126* level expression measured by qRT2-PCR from total RNA. The small nuclear RNA U6 was used as internal control. (B,C) Numbers of shear-resistant firmly adhered THP1 monocytes and Jurkat T cells to (B) unstimulated and (C) cytokine-stimulated hCMEC/D3 cells per field of view (FOV) (640 × 480 μm). Experiments were carried out three times with five FOVs. Data are mean ± SEM. #P < 0.05, **P < 0.01, ***,###P < 0.001, #compared to unstimulated.

Human brain endothelial miR-126 and miR-126* target different adhesion-related genes

To further elucidate the role of miR-126 and miR-126*, in the regulation of shear resistant monocyte, T cell and PBMC adhesion to brain endothelial cells, we explored possible molecular mediators for this observed biological response among miR-126 and miR-126* targets. Human mature miR-126 and miR-126* originate from the same primary transcript (Pre-miR) and their sequences are different in base composition (Fig. 6A), miR-126* (hsa-miR-126-5p mature sequence CAUUAUUACUUUUGGUACGCG and miRbase accession MIMAT0000444) and miR-126* (hsa-miR-126-3p mature sequence UCGUACCGUGAGUAAUAAUGCG and miRbase accession MIMAT0000445), thereby targeting different genes. First, we systematically collated miR-126 and miR-126* predicted targets involved in leukocyte adhesion using databases available on-line (listed in methods) to predict target gene transcripts in silico. Then, we selected adhesion related-targets previously found to be involved in neuroinflammatory diseases and/or leukocyte trafficking, and, that are expressed by hCMEC/D3 (Geo: GSM1089040)35 (Fig. 6B). Finally, we selected for further studies, four of these proteins that are master mediators of leukocyte trafficking: miR-126 predicted targets VCAM1 and CCL2 (MCP1), and miR-126* predicted targets SELE (E-selectin) and CCL7 (MCP3) (Fig. 6C). Although VCAM1 and CCL2 have been previosly shown to be miR-126 gene targets in different endothelial and non-endothelial cell types182138394041424344, it has not been reported in human brain endothelium. We tested the effects of miR-126 and miR-126*, using gain-and loss-of-function approach, on their mRNA expressed in hCMEC/D3 cells respective targets at the protein level following the experimental design depicted in Fig. 6D. Decreased or increased levels of miR-126 in unstimulated hCMEC/D3 cells significantly enhanced or reduced membrane-associated VCAM1 expression respectively (Fig. 7A), while no significant changes in secreted endothelial CCL2 were detected (Fig. 7B). Cytokines-treatment (TNFα and IFNγ) strongly increased membrane-associated VCAM1 level and CCL2 secretion by brain endothelial cells (Fig. 7C,D) compared to unstimulated (Fig. 7A,B), while miR-126 upregulation slightly decreases the cytokine effects on hCMEC/D3 cells with reduction in VCAM1 expression (Fig. 7C) and CCL2 secretion (Fig. 7D). This finding correlates with the effect of miR-126 on both monocytic and T cell adhesion to human brain endothelial cells shown in Fig. 3.
Figure 6

Identification of miR-126 and miR-126* adhesion-related putative gene targets in silico.

(A) Stem loop of the primary precursor (Pri-miR) structure of human miR-126 and miR-126* and the mature hsa-miR-126 and has-miR-126* sequences. (B) List of adhesion-associated hsa-miR-126 and hsa-miR-126* predicted targets in silico. (C) Sequence alignment of the predicted duplex formation between mature miRs and their putative gene target mRNA selected for further study in hCMEC/D3 cells. (D) Graphic representation of the experimental design used to study the predicted target at protein level, the same experimental well was used to study membrane associated protein and secreted protein.

Figure 7

Brain endothelial miR-126 modulates VCAM1 and CCL2 in hCMEC/D3 cells.

(A–D) hCMEC/D3 cells were transfected with control Scrambled Pre-miR or Pre-miR-126 or control Scrambled Anti-miR or Anti-miR-126 (C,D) followed by treatment with cytokines (TNFα + IFNγ, 1 ng/ml) for 24 h or (A,B) left unstimulated. (A,C) Membrane-associated VCAM1 expression was quantified by ELISA and (B,D) secreted CCL2 (MCP1) was measured by capture ELISA. Experiments were carried out (A,C) four or (B,D) three times with three replicates each. Data are mean ± SEM. *P < 0.05, ###P < 0.001, #compared to unstimulated.

Brain endothelial miR-126* downregulation increases membrane-associated E-selectin (CD62E) expression (Fig. 8A) and CCL7 secretion (Fig. 8B) in unstimulated hCMEC/D3 cells. In cytokine (TNFα and IFNγ) treated brain endothelial cells, anti-miR-126* treatment induced a small increase of membrane-associated E-selectin expression (Fig. 8C), however no significant difference in CCL7 secretion was observed when compared to control (control-anti-miR) (Fig. 8D). No changes in E-selectin and CCL7 expression were detected in pre-miR-126*-transfected hCMEC/D3 cells (Fig. 8A–D). Interestingly, we found that unstimulated hCMEC/D3 cells secreted less than 15.6 pg/ml CCL7, the lowest detectable amount above the assay’s threshold (Fig. 8B). Furthermore, we observed that following modulation of miR-126* levels in cytokine-treated hCMEC/D3 cells, there is a tendency to modulate CCL7 secretion (Fig. 8D). It is possible that differences in modulation of E-selectin and CCL7 expression by miR-126* contribute to the different behaviour in T cell and monocyte adhesion to anti-miR-126*-transfected hCMEC/D3 cells (Fig. 4B,C).
Figure 8

Brain endothelial miR-126* modulates E-selectin in hCMEC/D3 cells.

(A–D) hCMEC/D3 cells were transfected with control Scrambled Pre-miR or Pre-miR-126 or control Scrambled Anti-miR or Anti-miR-126 (C,D) followed by treatment with cytokines (TNFα + IFNγ, 1 ng/ml) for 24 h or (A,B) left unstimulated. (A,C) Membrane-associated E-selectin (CD62E) expression was quantified by ELISA and (B,D) secreted CCL7 (MCP3) was measured by capture ELISA. Experiments were carried out three times with three replicates each. Data are mean ± SEM. *P < 0.05, **P < 0.01, ###P < 0.001, #compared to unstimulated.

Taken together, our results indicate that brain endothelial miR-126 and miR-126* regulate monocytic and T cell shear-resistant adhesion to human brain endothelial cells, partially, via modulation of VCAM1, CCL2, E selectin and CCL7 target genes.

Discussion

Leukocyte adhesion at the blood-brain barrier is believed to be a critical step in leukocyte extravasation that triggers neuroinflammatory diseases such as MS, characterized by a dramatic increase of pro-inflammatory cytokines such as TNFα and IFNγ45, which induce endothelial E-selectin, ICAM1, VCAM1, CCL2 (MCP1) and CCL7 (MCP3) expression and modulate leukocyte adhesion to the endothelium303146. Here, we show that TNFα and IFNγ in combination, significantly increased E-selectin, ICAM1, VCAM1, CCL2 and CCL7 expression on hCMEC/D3 cells, using a lower dose of cytokines (1ng/ml) than previously (10–100 ng/ml) in order to avoid apoptosis in brain endothelial cells47. Using live-cell imaging, we investigated shear resistant firm adhesion of leukocytes to brain endothelium under continuous flow, that permits to study only specific adhesion and avoids unspecific cell-cell binding and/or interaction, and mimics leukocyte adhesion in vivo. Firm adhesion to cytokine-stimulated hCMEC/D3 cells was increased, as expected, furthermore we observed that the number of firmly adhered Jurkat T cells was higher than THP1 monocytes, consistent with the ratio of T cells/monocytes found in the perivascular infiltrate in MS active lesions9 and dependent on Jurkat and THP1 chemokine receptors, integrin and surface glycation profile. New therapies, such as Natalizumab, have been developed to physically prevent the interaction between VLA-4 (α4-integrin) expressed by T cells and VCAM1 expressed by brain endothelium. However, these therapies may lead to progressive multifocal leukoencephalopathy48. Recently, miRs have been shown to represent possible therapeutic targets that act endogenously at the post-transcriptional level regulating a large number of different mRNA targets (members of distinct signaling pathways) modulating their expression4950, although quantitatively the changes are often individually small51, a single miR can significantly impact a number of target genes directly and/or indirectly, so it can have a profound impact on complex cellular processes, by modulating several proteins involved in one process52. In this study we show that treatment with TNFα and IFNγ (1 ng/ml) for 24 hours downregulates endogenous levels of human brain endothelial miR-126 and miR-126*. MiR-126 and miR-126* were found down-regulated in different inflammatory-associate diseases such as cystic fibrosis53, ischaemia54, atherosclerosis24, stroke43, and, in melanoma, breast and lung cancer cells274255. In this paper, we specifically addressed the regulation of shear resistant leukocyte adhesion to brain endothelium by brain endothelial miR-126 and miR-126*. Although, miR-126 has been shown to regulate HL-60 cell adhesion to HUVEC18, and, in the context of CNS, breast cancer miR-126 and miR-126* repress recruitment of mesenchymal stem cells and inflammatory monocytes to inhibit breast cancer metastasis in brain42, the role of brain endothelial miR-126 and miR-126* in inflammation at the human neurovascular unit and/or in multiple sclerosis has not been investigated. We established that human brain endothelial miR-126 and miR-126* regulate firm leukocyte adhesion to hCMEC/D3 cells, and in particular, that increased miR-126 and miR-126* levels in brain endothelial cells, significantly reduced leukocyte adhesion, not only in untreated cells, but also in the presence of proinflammatory cytokines. There are two possible explanations for these findings: the first one is that the cytokines cause a direct reduction in the expression of miR-126 and miR-126* which allows a consequent increase in the half-life of mRNA for selectins, adhesion molecules and chemokines, in turn leading to increased protein expression. Alternatively, the second is that cytokine-induced mRNA for the selectins, adhesion molecules and chemokines may lead to a consumption of miRs that target those mRNAs. The first mechanism is a primary effect caused directly by cytokine activation of the cells, and the second mechanism is a consequence of the induction of other genes. Control of the Egfl7 gene which includes the gene segments encoding for miR-126 and miR-126* is reported to be under the control of transcription factors Erg, GATA-2 and Ets-1/256. Ets-1 is induced by TNFα57, so modulation of Egfl7 and the miRs could follow TNFα stimulation. In turn, Ets-1 controls a wide range of cytokines and chemokines involved in neuroinflammation58. Meanwhile, it has been shown that the early (6 h) cytokine-induced miR-155, that contributes to regulate firm leukocyte adhesion12 to human brain endothelial cells and modulates VCAM1, ICAM1 expression12, targets the transcription factor Ets-159. Indeed, endothelial Ets-1 down-regulation decreases transactivation of Egfl7 and leads to miR-126/-126* down-regulation56, which may explain the decrease of endothelial miR-126 and miR-126* levels at 24 hours after cytokine stimulation (no significant changes were observed at 6 h, Geo accession GSE21350), thus after miR-155 upregulation by cytokines. Though, we think that the second explanation is more likely, because the decrease in miR-126 and miR-126* was seen 24 hours after cytokine stimulation, during which time mRNA for VCAM1, E selectin, CCL2 and CCL7 are induced by TNFα and IFNγ via either AP1 or NF-κB, as we observed increases in protein expression at 24 h and early time points (Figs 1,7,8 and S3) with relative increases in monocyte and T cell adhesion (Fig. S4). Furthermore, NF-κB controls gene transcription of miR-146a, another brain endothelial cytokine-induced miR that contributes to leukocyte adhesion regulation via repression of RhoA and NFAT5 leading to CCL2 and VCAM1 downregulation in hCMEC/D3 cells16. NF-κB cooperates with miR-155 targets and miR-126/-126* transcription factors Ets-1 to control miR-146a expression in T cell, then we can speculate that miR-126 and miR126* expression may also depend on miR-146a and miR-155 cytoplasmic levels. This may result from the fine tuning properties of miRs and the kinetics of molecules involved directly and indirectly in miR-126 and miR-126* regulation. Thus, the two mechanisms are not mutually exclusive, and both imply that miR-126 and miR-126* are involved in controlling the levels of some of the key molecules required for leukocyte migration into the CNS. MiR-126 and miR-126* have different mature sequences, thus different gene targets motifs. As a result, we showed some differences in their actions on leukocyte adhesion to human brain endothelium. In particular, the firm adhesion of Jurkat cells was slightly decreased by treatment with anti-miR-126*, whereas THP1 responded by increased adhesion as anticipated. Here, we observed that miR-126* regulates E-selectin, for the first time. Endothelial E-selectin mediates T cell rolling and adhesion through PSGL-1 (P-selectin glycoprotein ligand-1)60 which is expressed by Jurkat T cells61, however while E-selectin expression increases on hCMEC/D3, Jurkat adhesion is reduced by anti-miR-126*. The best explanation for the difference may be that miR-126* targets other endothelial mRNA targets -not investigated here- that are modulating Jurkat T cell, but not THP1 monocytic adhesion. Indeed, although some miR-126* target genes have been investigated here, it is likely that the large effect observed on leukocyte adhesion by miR-126* modulation is the result of small effects on expression of many target genes (some listed in Fig. 6B), taking also in consideration that the miRs star form is less abundant22, thus the effect on a single target gene is smaller. A possible candidate is CD200, a predicted target of miR-126*, which is highly expressed in the CNS and involved in the pathology of MS, it has been shown to be involved in T cell-endothelium, but not in monocyte-endothelium interactions62. Furthermore, activated leukocyte cell adhesion molecule (ALCAM), a biologically validated target of miR-126* in HUVEC29, has been shown to be upregulated in neuroinflammation (multiple sclerosis lesions) and mediates leukocyte migration into the CNS, in particular CD14+ monocytes63. We show that miR-126 modulates CCL2 and VCAM1 expression in hCMEC/D3 cells, in particular an increase of miR-126 decreases both VCAM1 and CCL2 in the presence of cytokines, which correlates with a decrease of THP1, Jurkat or PBMC (healthy or MS donor) firm adhesion to human brain endothelial cells. In particular, the results with MS patient-derived PBMC confirmed the possible therapeutic effect of pre-miR-126, in the context of human brain endothelial inflammation. Furthermore, the findings with VCAM1 are particularly relevant to CNS disease, since this adhesion molecule is highly regulated on human brain endothelium, by comparison with non-brain endothelium and the VLA-4/VCAM1 adhesion system is a proven target for clinical treatment of neuroinflammation. The observation that individual miRs can affect several molecules involved in a single cellular process, and that miRs that originate from the same precursor modulate different gene targets, which act simultaneously on the same molecular event such as leukocyte adhesion, reinforces the concept that miRs may be suitable targets for anti-inflammatory therapy. MiR-based gene therapy for cancer and other non-brain diseases has been already approved in clinical trials64, although only for diseases that can be easily treated locally such as chronic asthma with miR-126 and liver cancer with miR-26a and miR-346566. In vivo, miR-126 was successfully delivered for therapeutic intervention in a mouse hind-limb ischemia model67, and miR-146a, a known miR that modulates T cell adhesion to human brain endothelium16, in aorta endothelium by micro particles via E-selectin68. However, there is need for optimization of miR delivery to brain endothelial cells in vivo. In conclusion, our study demonstrates the roles of miR126 and miR126* in controlling leukocyte interaction with human brain endothelium under shear stress conditions. It also shows that exogenous modulation of these two different miRs in human brain endothelium can reduce the levels of monocyte and T cell firm-adhesion, which is the critical step determining leukocyte migration into the CNS. Our results imply that miR-126 and miR-126* are potential targets for anti-inflammatory therapies since they simultaneously modulate multiple proteins required for leukocyte adhesion.

Methods

Cell culture

The hCMEC/D3 cell line30 was used at passages 26–34 and cultured in endothelial cell basal medium-2 (EGM-2) medium (Lonza, Walkersville, USA) and supplemented with the following components obtained from the manufacturer: 0.025% (v/v) rhEGF, 0.025% (v/v) VEGF, 0.025% (v/v) IGF, 0.1% (v/v) rhFGF, 0.1% (v/v) gentamycin, 0.1% (v/v) ascorbic acid, 0.04% (v/v) hydrocortisone and 2.5% (v/v) foetal bovine serum (FBS), hereafter referred to as endothelial complete medium. hCMEC/D3 cells were grown to confluence (~1 × 105 cells/cm2) on tissue culture flasks coated with collagen from calf skin (Sigma, St. Louis, USA). The T cell line Jurkat from acute T cell leukaemia and the monocytic line THP1 from acute monocytic leukaemia were a kind gift from Dr V Male (Cambridge University). Jurkat and THP1 cells were grown in suspension in RPMI 1640 W/GLUTAMAX I (Gibco® Invitrogen, Paisley, UK) culture medium (with 10% FBS and 100 μg/ml streptomycin + 100 units/ml penicillin) and used in exponential growth for all experiments with no further treatment. All cell lines were maintained in a 95% humidified air and 5% CO2 incubator at 37 °C. PBMC from healthy donors (Stemcell Technologies, Cambridge, UK) were thawed, washed, resuspended in complete media, recovered for 4 hours and used with no further treatments. MS patients recruited by Dr. Giulio Podda and Dr. Bruno Gran during their routine consultations in the Neurology department at Nottingham University Hospitals NHS Trust. Blood samples were collected, transported, handled and used for the experiments following the protocols approved by the local research ethical committee at both Nottingham University Hospitals NHS Trust and The Open University (HREC/2011/#913, NRES 08/H0408/167), the approved human tissue transfer agreement and the signed informed consents were obtained from all blood donors. PBMC were isolated from fresh heparinised blood of three MS patients by density dependent centrifugation using Ficoll-Paque PLUS and frozen in 10% DMSO in liquid nitrogen until used for flow-based leukocyte adhesion assay, where PBMC were thawed, washed, resuspended, recovered for 4 hours in complete media and used with no further treatments. methods were carried out in accordance with the relevant guidelines and regulations.

MicroRNA transfection

hCMEC/D3 cells were grown to ~70% confluence and transfected in antibiotic-free endothelial media. To introduce miR-126 or miR-126* precursor, hCMEC/D3 cells were transfected with 30 nM of pre-miR-126 or pre-miR-126* or its control, scrambled-pre-miR (Ambion, Fischer Scientific UK), using Siport™ Polyamine Transfection Agent (Ambion) in Opti-mem® I (Gibco®) media for 24 h. For inhibition studies, 60 nM of anti-miR-126 or anti-miR-126* and its control, scrambled-anti-miR (Ambion, Fischer Scientific UK) were transfected using Lipofectamine® 2000 (Thermo Fisher Scientific, Carlsbad, USA) for 6 h, media was then changed with endothelial complete medium for 18 h.

Flow-based leukocyte adhesion assay: live cell adhesion imaging under flow conditions

A flow-based adhesion assay described previously in Cerutti et al.12 was used. hCMEC/D3 cells were grown in Ibidi® μ-Slide VI0.4 (Ibidi® GmbH, Martinstreid, Germany), transfected, treated with 1 ng/ml TNFα and IFNγ or left untreated for 24 h in static conditions and washed before flow adhesion assay. THP1 and Jurkat cells (2 × 106cells/ml) were labelled with CMFDA (5-chloromethylfluoresceindiacetate, Life Technologies, Eugene, USA), while MS patient-derived PBMC were left unlabelled and were allowed to flow through the channel with endothelial monolayers and accumulate at 0.5 dyn/cm2 for 5 min. Then, the flow was increased to 1.5 dyn/cm2 (venular vessel wall shear stress) for 30 seconds to remove non-adhered leukocytes with endothelial complete media. The flow rate (θ) applied to produce the required shear stress τ (dyn/cm2) was calculated by Ibidi® for the μ-slideVI 0.4 according to the equation τ [dyn/cm2] = η [(dyn * s)/cm2]∙176.1 Φ ml/min], where the relationship between shear stress (τ) and flow rate (Φ) is based on the dynamic viscosity (η) of water at 22 °C, η = 0.01 dyn∙s/cm2 and other parameters specific to the geometry of the system. Leukocyte-endothelial interactions were recorded for 5.5 min and firm leukocyte adhesion was quantified. Firm adhesion was defined by leukocytes that remained adhered on human brain endothelium in the field of view (FOV 640 × 480 μm) throughout the accumulation time, and, after increasing the flow to 1.5 dyn/cm2, cells were manually counted using Image J software in five or ten different FOVs randomly taked along the centreline of the channel. For quantification, all firmly adhered cells in the five or ten different FOVs of one indipendent experiment were counted, then the average was calculated. Data in the graphs are mean ± SEM of 3 to 5 independent experiments expressed as firmly adhered cells/FOV. Image acquisition was performed using an of an inverted fluorescence microscope (Olympus IX70, Tokyo, Japan) -X10 objective- controlled by the Image Pro Plus software (Media Cybernetics Inc. Bethesda, USA) using a Q-IMAGING QICAM FAST 1394 on a 12-bit camera (40 images/min).

ELISA for membrane-associated adhesion molecules

Brain endothelial expression of VCAM1 (CD106), ICAM1 (CD54), ICAM2 (CD102) and E-selectin (CD62E) was measured by cell-surface ELISA performed as previously described69 using 2 μg/ml monoclonal anti-human mouse primary antibody against VCAM1 or ICAM1 or ICAM2 (R&D SYSTEMS, Abingdon, UK) or E-selectin (AbD SEROTEC Oxford, UK) and the corresponding secondary antibodies conjugated to horseradish peroxidase. The optical density (OD) was then measured using a FLUOstar Optima spectrometer (BMG LABTECH, Aylesbury, UK) at a wavelength of 450 nm. Absorbance from the wells with “blank” sample (without primary antibody) was subtracted from each of the corresponding treatment samples.

Capture ELISA for secreted chemokines

Culture supernatants of confluent hCMEC/D3 cells were collected and frozen at −20 °C. For quantitative determination of chemokines, the human CCL7 and the human CCL2 Quantikine® ELISA kits (R&D systems, Abingdon, UK) were used following the supplier’s protocols. The detection limits for CCL7 was 15.6 pg/ml and for CCL2 was 31.2 pg/ml. Signal saturation was observed at concentrations of >1000 or >2000 pg/ml for CCL7 or CCL2, respectively. Unstimulated hCMEC/D3 cell culture supernatants were first diluted in assay diluent at ratios of 1/3 (v/v) and 1/10 (v/v) for CCL7 and CCL2, respectively, while stimulated hCMEC/D3 cells culture supernatants were diluted in assay diluent at ratios of 1/3 (v/v) or 1/50 (v/v) for CCL7 and CCL2, respectively. The optical density (OD) was measured using a FLUOstar Optima spectrometer (BMG LABTECH) at a wavelength of 450 nm. Mean absorbance in the wells with “blank” sample (assay diluent only) was subtracted from the absorbance of each sample and the standards (known concentration of protein). The concentration of chemokines was determined by interpolation from the standard curve.

Reverse transcription Real time-qPCR

For assessment of miR levels in cultured cells, total RNA was isolated from confluent cells using TRIzol® Reagent (Invitrogen) following the manufacturer’s protocol. cDNA was generated from total RNA using a TaqMan High Capacity cDNA Reverse Transcription kit (Applied Biosystem, Life Technologies, Warrington, UK) with specific primers for miR-126, 126* and for small nuclear RNA U6, 002228-4427975, 000451-4427975 and 001973-4427975 respectively (Applied Biosystems Foster City, USA). RT2-qPCR was performed using the TaqMan MicroRNA assay (Applied Biosystem Life Technologies, Warrington, UK) with specific primers according to the manufacturer’s protocol. Cellular miR levels were detected using the DNA Engine Opticon2 Real-Time System (MJ Research, St. Bruno, Canada) thermal cycler and Opticon Monitor software (MJ Research, St. Bruno, Canada) for data analysis. The relative amount of microRNA was calculated using the 2−ΔΔCt (delta-delta Ct) method70 and normalized with the commercially available internal control, the small nuclear RNA U6. The results of microRNA relative levels in treated and/or transfected hCMEC/D3 cells were expressed as fold increase over microRNA levels in unstimulated and control transfected hCMEC/D3 cells.

Immunocytochemistry

hCMEC/D3 cell monolayes in IbidÍ chambers were fixed for 10 min with 4% p-formaldehyde and then incubated with blocking solution, 5% goat serum. VCAM1 expression was detected using monoclonal anti-human mouse VCAM1 primary antibody (R&D SYSTEMS, Abingdon, UK) followed by the secondary antibodies Alexa Fluor® 488 Goat Anti-Mouse IgG. Cells were mounted using mounting media with DAPI. Pictures were acquired with a Zeiss microscope using axiophot prism filter set (λex − λem: blue 450–490 nm, green 395–440 nm) with X40 objective. The signal was quantified using the software, Image J (Java-based image processing program developed at the National Institutes of Health).

Bioinformatic analysis

Predicted mRNA targets for miR-126 and -126* were identified using eight well known microRNA target prediction programs/databases: Targetscan v5.0 (http://www.targetscan.org/), Miranda (http://www.microrna.org/microrna/home.do), Pictar (http://pictar.mdc-berlin.de/), Microcosm (http://www.ebi.ac.uk/enright-srv/microcosm/cgibin/targets/v5/search.pl), Tarbase (http://diana.cslab.ece.ntua.gr/tarbase/), DianaLab Microt (http://diana.cslab.ece.ntua.gr/microT/), Diana Lab (http://diana.cslab.ece.ntua.gr/mirgen/), Target Miner (http://www.isical.ac.in/~bioinfo_miu/), MirDB (http://mirdb.org/miRDB/). To generate the heatmap for miR-126 and miR-126*, raw data from public database Gene Expression Omnibus (GEO)-Geo accession GSE21350 were normalized and transformed into z-score data. TM4: MeV (Multiple Experiment Viewer), a Java tool for genomic data analysis was used to generate the heatmap with the z-score data. For each treatment, three replicates were analized.

Statistical analysis

All data are presented as mean ± SEM (standard error of the mean) from a number of independent experiments (n) with replicates specified in each legend. P values were calculated using unpaired Student’s t tests. Statistically significant differences are presented as probability levels of P < 0.05 (*), P < 0.01 (**), P < 0.001 (***). Calculations and figures were performed using the statistical software GraphPad Prism 5 (GraphPad Software).

Additional Information

How to cite this article: Cerutti, C. et al. MiR-126 and miR-126* regulate shear-resistant firm leukocyte adhesion to human brain endothelium. Sci. Rep. 7, 45284; doi: 10.1038/srep45284 (2017). Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
  69 in total

Review 1.  Blood-brain barrier disruption in multiple sclerosis.

Authors:  Alireza Minagar; J Steven Alexander
Journal:  Mult Scler       Date:  2003-12       Impact factor: 6.312

2.  TNFalpha induces expression of transcription factors c-fos, Egr-1, and Ets-1 in vascular lesions through extracellular signal-regulated kinases 1/2.

Authors:  S Goetze; U Kintscher; K Kaneshiro; W P Meehan; A Collins; E Fleck; W A Hsueh; R E Law
Journal:  Atherosclerosis       Date:  2001-11       Impact factor: 5.162

Review 3.  MicroRNA control of signal transduction.

Authors:  Masafumi Inui; Graziano Martello; Stefano Piccolo
Journal:  Nat Rev Mol Cell Biol       Date:  2010-03-10       Impact factor: 94.444

4.  miR-126 is downregulated in cystic fibrosis airway epithelial cells and regulates TOM1 expression.

Authors:  Irene K Oglesby; Isabella M Bray; Sanjay H Chotirmall; Raymond L Stallings; Shane J O'Neill; Noel G McElvaney; Catherine M Greene
Journal:  J Immunol       Date:  2010-01-18       Impact factor: 5.422

5.  Unique microRNA molecular profiles in lung cancer diagnosis and prognosis.

Authors:  Nozomu Yanaihara; Natasha Caplen; Elise Bowman; Masahiro Seike; Kensuke Kumamoto; Ming Yi; Robert M Stephens; Aikou Okamoto; Jun Yokota; Tadao Tanaka; George Adrian Calin; Chang-Gong Liu; Carlo M Croce; Curtis C Harris
Journal:  Cancer Cell       Date:  2006-03       Impact factor: 31.743

6.  Mammalian microRNAs predominantly act to decrease target mRNA levels.

Authors:  Huili Guo; Nicholas T Ingolia; Jonathan S Weissman; David P Bartel
Journal:  Nature       Date:  2010-08-12       Impact factor: 49.962

7.  Ectopic expression of miR-126*, an intronic product of the vascular endothelial EGF-like 7 gene, regulates prostein translation and invasiveness of prostate cancer LNCaP cells.

Authors:  Alla Musiyenko; Vira Bitko; Sailen Barik
Journal:  J Mol Med (Berl)       Date:  2008-01-12       Impact factor: 4.599

8.  MicroRNA profiling of diverse endothelial cell types.

Authors:  Matthew N McCall; Oliver A Kent; Jianshi Yu; Karen Fox-Talbot; Ari L Zaiman; Marc K Halushka
Journal:  BMC Med Genomics       Date:  2011-11-02       Impact factor: 3.063

9.  Systemic delivery of miR-126 by miRNA-loaded Bubble liposomes for the treatment of hindlimb ischemia.

Authors:  Yoko Endo-Takahashi; Yoichi Negishi; Arisa Nakamura; Saori Ukai; Kotomi Ooaku; Yusuke Oda; Katsutoshi Sugimoto; Fuminori Moriyasu; Norio Takagi; Ryo Suzuki; Kazuo Maruyama; Yukihiko Aramaki
Journal:  Sci Rep       Date:  2014-01-24       Impact factor: 4.379

10.  E-selectin-targeting delivery of microRNAs by microparticles ameliorates endothelial inflammation and atherosclerosis.

Authors:  Shuangtao Ma; Xiao Yu Tian; Yunrong Zhang; Chaofeng Mu; Haifa Shen; Jean Bismuth; Henry J Pownall; Yu Huang; Wing Tak Wong
Journal:  Sci Rep       Date:  2016-03-09       Impact factor: 4.379

View more
  18 in total

Review 1.  The role of non-coding RNAs in neuroinflammatory process in multiple sclerosis.

Authors:  Anna Nowak; Zofia Wicik; Marta Wolska; Andleeb Shahzadi; Piotr Szwed; Joanna Jarosz-Popek; Jeffrey Palatini; Marek Postula; Anna Czlonkowska; Dagmara Mirowska-Guzel; Ceren Eyileten
Journal:  Mol Neurobiol       Date:  2022-05-19       Impact factor: 5.682

2.  Blood-brain barrier disruption in diabetic mice is linked to Nrf2 signaling deficits: Role of ABCB10?

Authors:  Ravi K Sajja; Shikha Prasad; Suni Tang; Mohammad A Kaisar; Luca Cucullo
Journal:  Neurosci Lett       Date:  2017-05-29       Impact factor: 3.046

3.  Asiaticoside Attenuates Cell Growth Inhibition and Apoptosis Induced by Aβ1-42 via Inhibiting the TLR4/NF-κB Signaling Pathway in Human Brain Microvascular Endothelial Cells.

Authors:  Daqiang Song; Xian Jiang; Yiliu Liu; Yuhong Sun; Shousong Cao; Zhuo Zhang
Journal:  Front Pharmacol       Date:  2018-01-30       Impact factor: 5.810

4.  CSF microRNAs discriminate MS activity and share similarity to other neuroinflammatory disorders.

Authors:  Océane Perdaens; Hong Anh Dang; Ludovic D'Auria; Vincent van Pesch
Journal:  Neurol Neuroimmunol Neuroinflamm       Date:  2020-02-07

5.  Effective silencing of miR-126 after ischemic stroke by means of intravenous α-tocopherol-conjugated heteroduplex oligonucleotide in mice.

Authors:  Motohiro Suzuki; Satoru Ishibashi; Eri Iwasawa; Takahiro Oguma; Yasuhiro Saito; Fuying Li; Shinichi Otsu; Keiko Ichinose; Kotaro Yoshioka; Tetsuya Nagata; Takanori Yokota
Journal:  Sci Rep       Date:  2021-07-09       Impact factor: 4.379

Review 6.  Involvement of miR-126 in autoimmune disorders.

Authors:  Marco Casciaro; Eleonora Di Salvo; Teresa Brizzi; Carmelo Rodolico; Sebastiano Gangemi
Journal:  Clin Mol Allergy       Date:  2018-05-02

7.  MicroRNAs as Potential Mediators for Cigarette Smoking Induced Atherosclerosis.

Authors:  Yuka Yokoyama; Nathan Mise; Yuka Suzuki; Saeko Tada-Oikawa; Kiyora Izuoka; Lingyi Zhang; Cai Zong; Akira Takai; Yoshiji Yamada; Sahoko Ichihara
Journal:  Int J Mol Sci       Date:  2018-04-06       Impact factor: 5.923

8.  Current research into brain barriers and the delivery of therapeutics for neurological diseases: a report on CNS barrier congress London, UK, 2017.

Authors:  John Greenwood; Margareta Hammarlund-Udenaes; Hazel C Jones; Alan W Stitt; Roosmarijn E Vandenbroucke; Ignacio A Romero; Matthew Campbell; Gert Fricker; Birger Brodin; Heiko Manninga; Pieter J Gaillard; Markus Schwaninger; Carl Webster; Krzysztof B Wicher; Michel Khrestchatisky
Journal:  Fluids Barriers CNS       Date:  2017-11-07

Review 9.  Effect of exosomal miRNA on cancer biology and clinical applications.

Authors:  Zhenqiang Sun; Ke Shi; Shuaixi Yang; Jinbo Liu; Quanbo Zhou; Guixian Wang; Junmin Song; Zhen Li; Zhiyong Zhang; Weitang Yuan
Journal:  Mol Cancer       Date:  2018-10-11       Impact factor: 27.401

Review 10.  Hypoxia-Inducible Factor-1α: The Master Regulator of Endothelial Cell Senescence in Vascular Aging.

Authors:  Matilde Alique; Elsa Sánchez-López; Guillermo Bodega; Chiara Giannarelli; Julia Carracedo; Rafael Ramírez
Journal:  Cells       Date:  2020-01-13       Impact factor: 6.600

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.