Phase variable DNA repeats in Neisseria gonorrhoeae influence transcription, translation, and protein sequence variation.

There are many types of repeated DNA sequences in the genomes of the species of the genus Neisseria, from homopolymeric tracts to tandem repeats of hundreds of bases. Some of these have roles in the phase-variable expression of genes. When a repeat mediates phase variation, reversible switching between tract lengths occurs, which in the species of the genus Neisseria most often causes the gene to switch between on and off states through frame shifting of the open reading frame. Changes in repeat tract lengths may also influence the strength of transcription from a promoter. For phenotypes that can be readily observed, such as expression of the surface-expressed Opa proteins or pili, verification that repeats are mediating phase variation is relatively straightforward. For other genes, particularly those where the function has not been identified, gathering evidence of repeat tract changes can be more difficult. Here we present analysis of the repetitive sequences that could mediate phase variation in the Neisseria gonorrhoeae strain NCCP11945 genome sequence and compare these results with other gonococcal genome sequences. Evidence is presented for an updated phase-variable gene repertoire in this species, including a class of phase variation that causes amino acid changes at the C-terminus of the protein, not previously described in N. gonorrhoeae.

Sequence data for Neisseria gonorrhoeae strains investigated are available in GenBank under the following accession numbers: FA1090 (NC_002946.2; url - http://www.ncbi.nlm.nih.gov/nuccore/NC_002946.2); NCCP11945 (NC_011035.1; url – http://www.ncbi.nlm.nih.gov/nuccore/NC_011035.1; & CP001050.1; url - http://www.ncbi.nlm.nih.gov/nuccore/CP001050.1); MS11 (NC_022240.1; url -http://www.ncbi.nlm.nih.gov/nuccore/NC_022240.1); FA19 (NZ_CP012026.1; url – http://www.ncbi.nlm.nih.gov/nuccore/NZ_CP012026.1); FA6140 (NZ_CP012027.1; url – http://www.ncbi.nlm.nih.gov/nuccore/NZ_CP012027.1); 35/02 (NZ_CP012028.1; url – http://www.ncbi.nlm.nih.gov/nuccore/NZ_CP012028.1). These were accessed on the 15th of April 2016 for use in this study.

Sequence data were assessed via BLAST interrogation of the nr database restricted to the N. gonorrhoeae species (url – http://www.ncbi.nlm.nih.gov/).

Genome resequencing data for N. gonorrhoeae strain NCCP11945 has been deposited under BioProject PRJNA322254 (url – http://www.ncbi.nlm.nih.gov/bioproject/322254).

Genome resequencing data was assessed via Galaxy (url – usegalaxy.org).

Impact Statement

Phase variation plays a vital role in the ability of Neisseria gonorrhoeae to adapt to the various niche environments encountered. Through stochastic switching in the expression of key genes and regulatory systems, mediated by simple sequence repeats, the population of bacteria are diverse and readily able to survive in the face of selective pressures. Not all simple sequence repeats within the genome mediate phase variation. Previous investigations have sought to define the phase-variable repertoire of the species of the genus Neisseria and have identified a large number of candidates using a small number of genome sequences. With the availability of more genome sequence data and additional experimental data, we have refined the original repertoire to include those most likely to be phase-variable in N. gonorrhoeae. As these genes are important for survival, their definition as phase-variable is important for understanding pathogenesis and for potential future therapies. The advent of high-throughput sequencing has the potential to reveal additional cases of within-strain variations in repeat tracts, supporting phase-variable candidacy of genes.

Introduction

In Neisseria gonorrhoeae, the causative agent of gonorrhoea, DNA repeats are intimately linked to the biology of the organism. N. gonorrhoeae, and the closely related bacterial species Neisseria meningitidis, undergo phase-variable stochastic switching of gene expression for several surface structures, contributing to antigenic variation and immune evasion as well as niche adaptation in the course of infection (Bhat ; Moxon ; Carbonnelle ; Srikhanta ; Omer ). Phase variation is mediated by simple sequence repeats associated with genes. In the species of the genus Neisseria the vast majority contain homopolymeric tracts within the coding sequences (Snyder ).

Comparative sequence analysis between a single N. gonorrhoeae and several N. meningitidis genome sequences identified over 100 potentially phase-variable genes (Snyder ), some of which have later been demonstrated to be phase-variable experimentally (Jordan ). Transcriptional and translational phase variation have been extensively studied in the species of the genus Neisseria, however an additional class of simple sequence repeat-mediated phase variation has been described in Helicobacter canadensis following whole-genome analysis (Snyder ). Simple sequence repeat-mediated changes in the presence or absence of C-terminal cell wall attachment motifs has also been described in Streptococcus agalactiae (Janulczyk ). In N. meningitidis, a gene fusion between pglB2 and the downstream phosphoglycosyltransferase gene appears to be mediated by a poly-A repeat tract (Viburiene ).

With the availability of additional gonococcal genome sequences, the gonococcal phase-variable repertoire has here been re-assessed. As a result, phase variation in which repeats at the 3′ ends of genes mediate changes in the C-terminal sequence of the proteins is described as part of a refined phase-variable gene repertoire.

Methods

Identification of phase-variable genes.

Using the previous phase-variable gene repertoires reported for N. gonorrhoeae and N. meningitidis (Snyder ; Martin ; Jordan ), the homologues in N. gonorrhoeae strain NCCP11945 were sought (CP00150.1; Chung ). In addition, pattern search in xBASE (Chaudhuri ) was used to identify other repeats, based on previous evidence of phase variation in the species of the genus Neisseria: ≥ (G)8; ≥ (C)8; ≥ (CAAACAC)3; ≥ (CAAATAC)3; ≥ (CCCAA)3; ≥ (GCCA)3; ≥ (A)9; ≥ (T)9; ≥ (AAGC)3; ≥ (TTCC)3; and ≥ (CTTCT)3. No other repeats have been demonstrated to cause phase variation in this species. Genome sequences for N. gonorrhoeae strains NCCP11945 (NC_011035.1), FA1090 (NC_002946.2), FA19 (NZ_CP012026.1), FA6140 (NZ_CP012027.1), 35/02 (NZ_CP012028.1), and MS11 (NC_022240.1) were downloaded on 15ththApril 2016 and compared using progressive Mauve v2.3.1 (Darling ) to identify orthologues (Table S1, available in the online Supplementary Material).

Identification of repeat variation within N. gonorrhoeae strain NCCP11945.

N. gonorrhoeae strain NCCP11945 was grown on GC agar (Oxoid) with Kellogg’s (Kellogg ) and 5 % Fe(NO3)3 supplements at 37 °C in a candle tin for a period of 8 weeks with passages to fresh agar plates every 2 days or at 37 °C 5 % CO2 for a period of 20 weeks with passages to fresh agar plates every 2–3 days. At each passage, cells were scraped from the plate and resuspended in 1 ml of GC broth to a turbidity equivalent to a 0.5 McFarland standard before inoculation onto fresh plates using a sterile cotton swab. DNA was extracted from such resuspensions using the Puregene Yeast/Bacterial kit (Qiagen). A sample (1 µg or 100 ng) of the DNA was genome sequenced using the Ion Personal Genome Machine, Ion Express Fragment Library kit, Ion Express Template kit, and Ion Sequencing kit (Life Technologies) or using the Illumina-based methods of the MicrobesNG service (microbesng.uk). Sequence read data was interpreted using Galaxy on usegalaxy.org (Afgan ). Briefly, the reference sequence (NC_011035.1), Ion Torrent data for eight-week passages (KU1-4, KU1-45), Ion Torrent data for 20-week passages (KU1-95, KU1-96), and Illumina data for 20-week passages (2928-NS1_1 & 2929-NS1_2 and 2929-NS2_1 & 2929-NS2_2) were uploaded to Galaxy. The Ion Torrent bam format files were converted to fastq format using BAMTools Convert (Barnett ). FASTQ Groomer was used on all NGS data (Blankenberg ). Bowtie2 was used to map the reads against the reference (Langmead ; Langmead ) before visualisation using the Integrated Genomics Viewer (Robinson ; Thorvaldsdóttir ).

Results and Discussion

Phase variable genes

The phase-variable gene repertoire of N. gonorrhoeae strain NCCP11945 was investigated and compared against gonococcal strains FA1090, FA19, FA6140, 35/02, and MS11 to assess the presence of similar repeat tracts across the species and variations in repeat tract lengths between strains.

Transcriptional phase variation is mediated by repeats within or associated with the promoter region (Fig. 1a). Changes in the repeat alters the level of transcription of the gene, as in fetA (frpB; NGK_2557) where differences in the length of the poly-C homopolymeric tract between the −10 and −35 promoter regions alters expression (Carson ). There are three transcriptional phase-variable genes in N. gonorrhoeae strain NCCP11945 (Table 1), fetA (NGK_2557), a lipoprotein (NGK_2186), and porA (NGK_0906/NGK_0907), yet in gonococci porA does not have an intact coding region. Variation in the repeats between gonococcal strains is found for all three transcriptional phase-variable genes (Table 1).

Fig. 1.

Illustrations of the types of phase variation in N. gonorrhoeae. (a): Transcriptional phase variation, in which changes in a repeat tract alter the facing and spacing of the −10 and −35 promoter elements and the level of transcription of the gene. Phase variation of fetA is used as an example, where it has been shown that differences in spacing of the −10 and −35 elements due to changes in the poly-C repeat tract alter expression levels, represented by the widths of the arrows (Carson ). (b): Translational phase variation, in which changes in a repeat tract towards the 5′ end of the coding sequence alter the reading frame of a coding region and switch expression on and off due to frame-shift. Phase variation of pilC is used as an example, where it has been shown that changes in the poly-G repeat tract generate frame-shifts which switch protein expression on and off (Jonsson ). (c): C-terminal phase variation, in which changes in a repeat tract towards the 3′ end of the coding sequence alter the reading frame of a coding region and switch the encoded C-terminal amino acids between the three reading frames. In the example NGK_1211, two of the reading frames result in different C-terminal ends to the protein, while the third generates a fusion with the downstream coding sequence, NGK_1212. Only some examples of C-terminal phase variation result in this type of fusion (Table 3).

Table 1.

Transcriptional phase variable genes in N. gonorrhoeae

Gene	FA1090 locus*	Repeat in FA1090*	NCCP11945 locus†	Repeat in NCCP11945†	Repeat in FA19‡	Repeat in FA6140§	Repeat in 35/02||	Repeat in MS11¶	N. gonorrhoeae candidacy#	Reference
porA	NGO_04715	(T)11C(G)6T	NGK_0906 & NGK_0907**	(T)9C(G)6T	(T)8C(G)8T	(T)9C(G)6T	(T)9C(G)6T	(T)9C(G)6TT	Known	van der Ende et al. (1995)
Lipoprotein	NGO2047	(A)9	NGK_2186††	(A)8	(A)8	(A)9	(A)9	(A)8	Yes
fetA / frpB	NGO2093	(C)13	NGK_2557	(C)14	(C)10	(C)11	(C)11	(C)11	Known	Carson et al. (2000)

*From the N. gonorrhoeae strain FA1090 genome sequence (NC_002946.2).

†From the N. gonorrhoeae strain NCCP11945 genome sequence (CP00150.1).

‡From the N. gonorrhoeae strain FA19 genome sequence (NZ_CP012026.1).

§From the N. gonorrhoeae strain FA6140 genome sequence (NZ_CP012027.1).

||From the N. gonorrhoeae strain 35/02 genome sequence (NZ_CP012028.1).

¶From the N. gonorrhoeae strain MS11 genome sequence (NC_022240.1).

#Gene phase variation candidacy in N. gonorrhoeae. Known, phase variation has been reported in the literature. Yes, there is evidence of repeat tract variation between strains supporting phase variation.

**This coding sequenc appears to be frame-shifted and annotated as two coding sequences.

††NGK_2186 and NGO2047 annotations are on opposite strands.

Table 3.

C-terminal phase-variable genes in N. gonorrhoeae

Gene	FA1090 locus*	Repeat at in FA1090*	NCCP11945 locus†	Repeat in NCCP11945†	Amino acids after the repeat in each frame of NCCP11945‡‡‡			FA19§	FA6140||	35/02 ¶	MA11#	N. gonorrhoeae candidacy**
ispH	NGO0072	(G)8	NGK_0106	(G)8	26	50	61	(G)8	(G)8	(G)8	(G)8	(Yes)
Menbrane protein	NGO0691	(G)6	NGK_1211	(G)7	23	8	186^	(G)7	(G)6	(G)7	(G)7	Yes
m afB cassette	WX61_RS02820	(C)7	NGK_1624	(C)9	46	2	37	deletion††	(C)10	(C)8	(C)10	Yes
Pilin cassette	WX61_RS02820	CCGC	NGK_2161	(C)8	20	8	91¶	(C)5GCC	CCGCC	(C)5	CCT(C)5	Yes

*From the N. gonorrhoeae strain FA1090 genome sequence (NC_002946.2).

†From the N. gonorrhoeae strain NCCP11945 genome sequence (CP00150.1).

‡In each column are the number of amino acids encoded 3′ of the repeat before the closest termination codon in each of the three reading frames.

§From the N. gonorrhoeae strain FA19 genome sequence (NZ_CP012026.1).

||From the N. gonorrhoeae strain FA6140 genome sequence (NZ_CP012027.1).

¶From the N. gonorrhoeae strain 35/02 genome sequence (NZ_CP012028.1).

#From the N. gonorrhoeae strain MS11 genome sequence (NC_022240.1).

**Gene phase variation candidacy in N. gonorrhoeae. Yes, there is evidence of repeat tract variation between strains supporting phase variation. (Yes), although there is no variation between strains investigated here, tracts of this length vary in other genes (Chen ; Shafer ; Adamczyk-Poplawska ).

††There is a 400 bp deletion in this strain encompassing the region that would contain this repeat.

Most common in the species of the genus Neisseria is translational phase-variation where, as in pilC, the repeat is within the 5′ portion of the coding region of the gene (Fig. 1b). Changes in the repeat tract generate frame-shift mutations in two of the three open reading frames, with the gene only being translated into protein when the repeat tract length puts the gene in-frame. Whilst many phase-variable genes in the species of the genus Neisseria contain homopolymeric tracts, some experience copy number changes in repetitive sequences, such as the CTTCT repeat in opa (Muralidharan ; Bhat ) or the AAGC repeat in autA (Peak ; Arenas ). In the N. gonorrhoeae strains examined here, the AAGC repeat in virG (NGK_0804) is only present in two or three copies (Table 2), rather than several copies as in NGK_0831a and autA (NGK_2082). Although virG has low copy number for the repeat, variations between strains are observed and strains with many copies may yet be identified [there are currently none >(AAGC)3 in the NCBI nr/nt or wgs databases], therefore it is placed amongst the phase-variable genes even though this may be at low frequency or be a strain-specific effect. There are 36 translational phase-variable genes in N. gonorrhoeae based on the species examined (Table 2).

Table 2.

Translational phase-variable genes in N. gonorrhoeae

Gene	FA1090 locus*	Repeat in FA1090*	NCCP11945 locus†	Repeat in NCCP11945†	Repeat in FA19‡	Repeat in FA6140§	Repeat in 35/02||	Repeat in MS11¶	N. gonorrhoeae candidacy#	Reference
pilC2	NGO0055	(G)13	NGK_0074	(G)9	(G)10	(G)13	(G)9CAGG	(G)12	Known	Jonsson et al., 1991
opa	NGO0066a	(CTTCT)13CTTCG	NGK_0096	(CTTCT)8CTTCC	(CTTCT)4CTTCC	CTT(CTTCT)10CTTCC	(CTTCT)6(CT TCC)2	(CTTCT)8CTT CC	Known	Stern & Meyer, 1987
opa	NGO0070	(CTTCT)9CTTCG	NGK_0102	(CTTCT)7CTTCC	(CTTCT)8CTTCC	(CTTCT)17CTTCC	(CTTCT)7CTT CC	(CTTCT)7CTT CC	Known	Stern & Meyer, 1987
pglH	NGO0086	(C)10	np	np	no repeat	no repeat	no repeat	np	Known	Power et al., 2003
pglG	NGO0087	A(C)7	np	np	A(C)9	A(C)6	A(C)6	np	Known	Power et al., 2003
pglE	NGO0207	(CAAACAC)4	NGK_0339	(CAAACAC)8 (CAAATAC)3	(CAAACAC)6CAAATACCAAACACCAAATAC	(CAAACAC)10CAAATACCAAACACCAAATACCAAACAC(CAAATAC)2	(CAAACAC)24 CAAATAC	(CAAACAC)15(CAAATAC)3	Known	Power et al., 2003
hsdS	NGO_02155	(G)7	NGK_0571	(G)7	(G)8	(G)9	(G)7	(G)7	Known	Adamczyk-Poplawska et al., 2011
Hypothetical	NGO0527	(C)6A(C)9GC	NGK_1405	(C)6A(C)8GC	(C)7A(C)4T(C )3GC	(C)7A(C)4T(C)3GC	(C)11A(C)8GC GC	(C)6A(C)14GC C	Yes
modB	NGO0545	(CCCAA)12	NGK_1384	(CCCAA)11	(CCCAA)12	(CCCAA)4	(CCCAA)11	(CCCAA)7	Known	Srikhanta et al., 2009
Replication initiation factor	NGO_06135	(C)8TTATCTAACA(G)7	NGK_1957	(C)11TTATCTAACA(G)8	(C)7TTATCTAACA(G)7	(C)6TTATCT AACA(G)5	(C)11TTATCT AACA(G)8	(C)10TTATCT AACA(G)7	Yes
modA	NGO0641	(GCCA)37	NGK_1272	(GCCA)18	(GCCA)24GTCA	(GCCA)24	(GCCA)19	(GCCA)24	Known	Srikhanta et al., 2009
Replication initiation factor	NGO_06695	(C)8TTATCTAACA(G)7	NGK_1486	(C)9TTATCTAACA(G)7	(C)7TTATCTAACA(G)7	(C)9TTATCT AACA(G)6	(C)11TTATCT AACA(G)8	(C)9TTATCTA ACA(G)7	Yes
opa	NGO0950a	(CTTCT)16CTTCC	NGK_0847	(CTTCT)19CTTCC	(CTTCT)13CTTCC	(CTTCT)16CTTCC	(CTTCT)8CTT CC	(CTTCT)4CTT CC	Known	Stern & Meyer, 1987
Hypothetical	NGO0964	(AAGC)4	NGK_0831a	(AAGC)8	(AAGC)15	(AAGC)7	(AAGC)9	(AAGC)7	Yes
virG	NGO0985	(AAGC)3	NGK_0804	(AAGC)3	(AAGC)2	(AAGC)3	(AAGC)3	(AAGC)3	Yes
opa	NGO1040a	(CTTCT)20CTTCC	NGK_0749	(CTTCT)20CTTCC	(CTTCT)10CTTCC	(CTTCT)7CTTCC	(CTTCT)12CT TCC	(CTTCT)13CT TCCCTTCT(C TTCC)2	Known	Stern & Meyer, 1987
opa	NGO1073a	(CTTCT)2CTTCC	NGK_0693	(CTTCT)10CTTCC	(CTTCT)11CTTCC	(CTTCT)12CTTCC	(CTTCT)18CT TCC	(CTTCT)7CTT CC	Known	Stern & Meyer, 1987
opa	NGO1277a	(CTTCT)11CTTCC	NGK_1495	(CTTCT)7CTTCC	CTT(CTTCT)11CTTCC	(CTTCT)11CTTCC	(CTTCT)7CTT CC	(CTTCT)8CTT CC	Known	Stern & Meyer, 1987
Adhesion	NGO1445	(CAAG)20CAAA	NGK_1705	(CAAG)12CAAA	(CAAG)12CAAA	(CAAG)6CAAA	(CAAG)9CAAA	(CAAG)6CAAA	Yes
opa	NGO1463a	(CTTCT)10CTTCC	NGK_1729	(CTTCT)7CTTCC	(CTTCT)11CTTCC	(CTTCT)12CTTCC	(CTTCT)12CT TCC	(CTTCT)10CT TCC	Known	Stern & Meyer, 1987
opa	NGO1513	(CTTCT)12CTTCG	NGK_1799	(CTTCT)14CTTCC	CTT(CTTCT)10CTTCC	np	(CTTCT)6CTT CG	(CTTCT)7CTT CG	Known	Stern & Meyer, 1987
opa	NGO1553a	(CTTCT)4CTTCC	NGK_1847	(CTTCT)9CT TCC	(CTTCT)17CTTCC	(CTTCT)8CTTCC	(CTTCT)8CTT CC	(CTTCT)14CT TCC	Known	Stern & Meyer, 1987
autA	NGO1689	(AAGC)3	NGK_2082	(AAGC)3	(AAGC)14	(AAGC)3	(AAGC)3	(AAGC)3	Known	Peak et al., 1999 ; Arenas et al., 2015
pgtA	NGO1765	(G)11	NGK_2516	GGGAGCGGG	(G)19	(G)19	GGGAGCGGG	GGGAGCGGG	Known	Banerjee et al., 2002
Repetitive large surface lipoprotein	NGO_09875 & NGO_09870**	(G)8	NGK_2422 & NGK_2423**	(G)7	(G)7	(G)7	(G)7	(G)7	Yes
opa	NGO1861a	(CTTCT)13CTTCC	NGK_2410	(CTTCT)11CTTCC	(CTTCT)13CTTCC	(CTTCT)2CTTCC	(CTTCT)13CT TCC	(CTTCT)30CT TCC	Known	Stern & Meyer, 1987
pilC1	NGO1912	(G)11	NGK_2342	(G)13	(G)11	GGGC(G)11	(G)15	(G)11	Known	Jonsson et al., 1991
Hypothetical	NGO1953	(C)8	NGK_2297	(C)8	(C)8	(C)8	(C)9	(C)8	Yes
Pyrimidine 5′- nucleotidase	NGO2055 & NGO2054**	(C)6	NGK_2176	CAAACCCC	CAAACCCC	CAAACCCC	(C)9	(C)10	Yes
opa	NGO2060a	(CTTCT)10CTTCG	np		np	np	(CTTCT)6CTT CC	(CTTCT)7CTT CC	Known	Stern & Meyer, 1987
opa	np		NGK_2170	(CTTCT)14CTTCC	np	np	np	np	Known	Stern & Meyer, 1987
lgtG	NGO2072	(C)11	NGK_2534 & NGK_2533**	(C)12	(C)10	(C)10	(C)10	(C)10	Known	Mackinnon et al., 2002
hpuA	NGO2110	(G)9	NGK_2581	(G)10	(G)9	(G)9	(G)8	(G)8	Known	Chen et al., 1998
lgtA	NGO11610	(G)11	NGK_2630	(G)11	(G)14A	(G)17A	(G)20A	(G)10A	Known	Erwin et al., 1996
lgtC	NGO2156	(G)14	NGK_2632	(G)13	(G)13	(G)10	(G)16	(G)8	Known	Shafer et al., 2002
lgtD	NGO2158	A(G)14	NGK_2634	A(G)16	(G)13	A(G)12	A(G)18	A(G)13	Known	Shafer et al., 2002

*From the N. gonorrhoeae strain FA1090 genome sequence (NC_002946.2).

†From the N. gonorrhoeae strain NCCP11945 genome sequence (CP00150.1).

‡From the N. gonorrhoeae strain FA19 genome sequence (NZ_CP012026.1).

§From the N. gonorrhoeae strain FA6140 genome sequence (NZ_CP012027.1).

||From the N. gonorrhoeae strain 35/02 genome sequence (NZ_CP012028.1).

¶From the N. gonorrhoeae strain MS11 genome sequence (NC_022240.1).

#Gene phase variation candidacy in N. gonorrhoeae. Known , phase variation has been reported in the literature. Yes, there is evidence of repeat tract variation between strains supporting phase variation.

**This coding sequence appears to be frame-shifted and annotated as two coding sequences.

np, The coding sequence is not present in this strain.

In addition, a third class of repeat-mediated phase-variable gene was identified (Snyder ). In these C-terminal phase-variable genes, a repeat tract towards the 3′ of the coding region is able to alter the sequence at the C-terminus of the encoded protein (Fig. 1c). In N. gonorrhoeae strain NCCP11945, four of these C-terminal phase-variable genes were identified (Table 3). It is likely that in the case of the pilin sequence (NGK_2161), changes in the repeat are causing pilus protein changes, mediating antigenic variation through a phase-variable mechanism. Comparisons also show repeat tract variation in a membrane protein (NGK_1211) and mafB cassette (NGK_1624), supporting C-terminal phase variation in the species of the genus Neisseria Variations in the products of mafB cassettes are believed to contribute to competition between species within the niche (Jamet ). Although no variation was observed in these strains in ispH (NGK_0106), (G)8 repeats are known to vary in lgtC (NGK_1632), hpuA (NGK_2581), and hsdS (NGK_0571) (Table 2), therefore it is highly likely that the repeat in ispH also has the capacity to vary.

A number of previously reported candidates are not supported by evidence of phase variation, based on the absence of tract length changes between the strains (Table 4). For example, although tract variation was reported for cvaA (NGK_0168), mafA-3 (NGK_2270), and dca (NGK_1830) in N. meningitidis (Martin ), there are no changes observed in the short (C)4 and (G)5 tracts in these genes in N. gonorrhoeae (Table 4). They are therefore unlikely to be phase-variable in this species. Likewise, neither of the dinucleotide-repeat-containing genes (NGK_1607 and NGK_2274) show variations (Table 4); dinucleotides are not likely to be phase-variable in the species of the genus Neisseria (Martin ). All of these genes contain short repeats that do not vary or alternative nucleotide sequences in the strains investigated (Table 4).

Table 4.

Genes for which there is no evidence of phase variation in N. gonorrhoeae

Gene	FA1090 locus*	Repeat in FA1090*	NCCP11945 locus†	Repeat in NCCP11945†	Repeat in FA19‡	Repeat in FA6140§	Repeat in 35/02||	Repeat in MS11¶	N. gonorrhoeae candidacy#
Prolyl endopeptidase	NGO0026	GGGGCGG	NGK_0034	GGGGCGG	GGGGCGG	GGGGCGG	GGGGCGG	GGGGCGG	No. Replacement tract
pill/wbpC	NGO0065	C(G)6	NGK_0089**	C(G)6	C(G)6	C(G)6	C(G)6	C(G)6	No. No variation.
Phosphoesterase	NGO0081	(C)7	NGK_0 n 9	(C)7	(C)7	(C)7	(C)7	(C)7	No. No variation.
Hypothetical	NGO0121	(A)6	NGK_0167	(A)6	(A)6	(A)6	(A)6	(A)6	No. No variation.
cvaA	NGO0123	(C)4	NGK_0168	(C)4	(C)4	(C)4	(C)4	(C)4	No. No variation.
potD -2	NGO0206	AA(C)5	NGK_0338	AA(C)5	AA(C)5	AA(C)5	AA(C)5	AA(C)5	No. No variation.
Hypothetical	NGO0532	AACCGGCAAACA	NGK_1400	AACCGGCAAACA	AACCGGCAAACA	AACCGGCAAACA	AACCGGCAAACA	AACCGGCAAACA	No. Replacement tract
nifS	NGO0636	CCACACCC	NGK_1278	CCACACCC	CCACACCC	CCACACCC	CCACACCC	CCACACCC	No. Replacement tract
lldD	NGO0639	(G)7	NGK_1275	(G)7	(G)7	(G)7	(G)7	(G)7	No. No variation.
Methylase NlalV	NGO0676	(A)9	NGK_1230	(A)9	(A)9	(A)9	(A)9	(A)9	No. No variation.
dnaX	NGO0743	(C)7	NGK_1135	(C)7	(C)7	(C)7	(C)7	(C)7	No. No variation.
mobA	NGO0754	GGAAGG	NGK_1123	GGAAGG	GGAAGG	GGAAGG	GGAAGG	GGAAGG	No. Replacement tract
ppx	NGO1041	(C)7	NGK_0745	(C)7	(C)7	(C)7	(C)7	(07	No. No variation.
fxP/ccoP	NGO1371	(AT)5	NGK_1607	(AT)5	(AT)5	(AT)5	(AT)5	(AT)5	No. No variation.
Hypothetical	NGO1384	G(A)7	NGK_1622	(A)8	(A)8	(A)8	(A)8	G(A)7	No. No variation in length.
pntA	NGO1470	CCCTGCTGG	NGK_1735	CCCTGCTGG	CCCTGCTGG	CCCTGCTGG	CCCTGCTGG	CCCTGCTGG	No. Replacement tract
amiC	NGO1501	TTCGCCC	NGK_1783	TTCGCCC	TTCGCCC	TTCGCCC	TTCGCCC	TTCGCCC	No. Replacement tract
dca	NGO1540	TGTGGGGG	NGK_1830	TGTGGGGG	TGTGGGGG	TGTGGGGG	TGTGGGGG	TGTGGGGG	No. Replacement tract
anmK	NGO1583	(C)7	NGK_1884	(C)7	(C)7	(C)7	(C)7	(C)7	No. No variation.
dinG	NGO1708	(C)4T CC	NGK_2106	(C)4TCC	(C)4TCC	(C)4TCC	(C)4TCC	(C)4TCC	No. Replacement tract
rplK	NGO1855	(C)7	NGK_2416	(C)7	(C)7	(C)7	(C)7	(C)7	No. No variation.
Hypothetical	NGO1970	(TA)5	NGK_2274	(TA)5	(TA)5	(TA)5	(TA)5	(TA)5	No. No variation.
mafA -3	NGO1972	(G)5	NGK_2270	(G)5	(G)5	(G)5	(G)5	(G)5	No. No variation.
map	NGO1983	(C)6	NGK_2258	(C)6	(C)6	(C)6	(C)6	(C)6	No. No variation.
plsX	NGO2171	(TTCC)3	NGK_2652	(TTCC)3	(TTCC)3	(TTCC)3	(TTCC)3	(TTCC)3	No. No variation.
lbpA	NGO0260a	nr	NGK_0401	GGGGGCGG	GGGGGCGG	nr	nr	TGAAACGG	No. Replacement tract

*From the N. gonorrhoeae strain FA1090 genome sequence (NC_002946.2).

†From the N. gonorrhoeae strain NCCP11945 genome sequence (CP00150.1).

‡From the N. gonorrhoeae strain FA19 genome sequence (NZ_CP012026.1).

§From the N. gonorrhoeae strain FA6140 genome sequence (NZ_CP012027.1).

||From the N. gonorrhoeae strain 35/02 genome sequence (NZ_CP012028.1).

¶From the N. gonorrhoeae strain MS11 genome sequence (NC_022240.1).

#Gene phase variation candidacy in N. gonorrhoeae. No. Replacement tract: due to the replacement of the repeat tract with other nucleotides, this is not phase-variable. No. No variation: due to no observed variation in the repeat tract, this is not phase-variable. No. No variation in length: due to the equal length tract in all strains, this is not phase-variable.

**This coding sequence contains a point mutation, which generates a premature termination codon.

nr, The region of the coding sequence containing the repeat tract does not have homology to the aligned region in these strains.

This analysis identified 29 genes that are known to be phase variable (Tables 1, 2), either in N. gonorrhoeae or N. meningitidis including 12 paralogues of opa (11 in each strain; Muralidharan ; Bhat ) and 17 other known phase-variable genes (Stern ; Jonsson ; Van der Ende ; Erwin ; Chen ; Peak ; Carson ; Banerjee ; Mackinnon ; Shafer ; Power ; Srikhanta ; Adamczyk-Poplawska ; Arenas ). Thirteen additional genes have variations in the repeat tracts when the six N. gonorrhoeae genome sequences are compared, one transcriptional, nine translational, and three C-terminal repeats. Based on homology and presence of conserved domains, these genes are believed to encode two replication initiation factors, an adhesion protein, a pyrimidine 5′-nucleotidase, two lipoproteins, two membrane proteins, two secreted proteins, and three hypothetical proteins (Tables 1–3).

Combined with the previous data on repeat variation within and between gonococcal strains and demonstration of phase variation (Sparling ; Yang ; Lewis ; Snyder ; Power ; Jordan ; Srikhanta ), a revised repertoire of 43 transcriptional (Table 1), translational (Table 2), and C-terminal (Table 3) phase-variable genes is proposed for N. gonorrhoeae as a species. This is fewer than previous predictions (76 in Jordan ) and thus far two-thirds (67 %, 29 out of 43) have been experimentally demonstrated to be phase-variable (Tables 1, 2). The additional 14 genes, 13 of which show strain-to-strain repeat variation, require additional investigation.

Phase variable repeat copy number variation in vitro

Previously, for H. canadensis, 454 and Illumina genome sequence read data was used to support candidacy of phase-variable genes (Snyder ). In the present study, Ion Torrent and Illumina genome sequence read data from N. gonorrhoeae strain NCCP11945 that had been passaged in the laboratory for 8 weeks or for 20 weeks was analysed for changes to phase-variable repeats for the 14 genes for which there is no within-strain evidence of phase variation (Tables 1–3). Changes were observed in known phase-variable genes pilC1, opa, and fetA, suggesting that read data can support phase variability by demonstrating within-strain variation in tracts (Table 5). Of the 14 genes, only virG (NGK_0804) and the pyrimidine 5′-nucleotidase (NGK_2176) showed no changes in repeats (Table 5). Probably, the virG (AAGC)3 copy number is too low to vary, however there may be strains with greater copy number in which it would. Likewise, the poly-C repeat in NGK_2176 has been replaced with CAAACCCC in strain NCCP11945 and therefore would not be expected to phase vary in this strain, however phase variation is likely in strain MS11, for example.

Table 5.

Genes for which there is sequencing-based evidence of phase variation in N. gonorrhoeae strain NCCP11945

Gene	FA1090 locus*	Repeat in FA1090*	NCCP11945 locus†	Repeat in NCCP11945†	Repeat in FA19‡	Repeat in FA6140§	Repeat in 35/02||	Repeat in MS11¶	N. gonorrhoeae candidacy#	Ion Torrent* *	Illumina††
ispH	NGO0072	(G)8	NGK_0106	(G)8	(G)8	(G)8	(G)8	(G)8	(yes)	Repeat varies	Repeat does not vary
virG	NGO0985	(AAGC)3	NGK_0804	(AAGC)3	(AAGC)2	(AAGC)3	(AAGC)3	(AAGC)3	Yes	Repeat does not vary	Repeat does not vary
Hypothetical	NGO0964	(AAGC)4	NGK_0831a	(AAGC)8	(AAGC)15	(AAGC)7	(AAGC)9	(AAGC)7	Yes	Repeat varies	Repeat varies
Membrane protein	NGO0691	(G)6	NGK_1211	(G)7	(G)7	(G)6	(G)7	(G)7	Yes	Repeat varies	Repeat does not vary
Hypothetical	NGO0527	(C)6A(C)9GC	NGK_1405	(C)6A(C)8GC	(C)7A(C)4T(C)3GC	(C)7A(C)4T(C)3GC	(C)11A(C)8GCGC	(C)6A(C)14GCC	Yes	Repeat varies	Repeat does not vary
Replication initiation factor	NGO_06695	(C)8TTATCTAACA(G)7	NGK1486	(C)9TTATCTAACA(G)7	(C)7TTATCTAACA(G)7	(C)9TTATCTAACA(G)6	(C)11TT ATCTAACA(G)8	(C)9T T AT CT AACA(G)7	Yes	Repeat varies	Repeat varies
mafB cassette	NGO1386	(C)7	NGK_1624	(C)9	{deletion}	(C)10	(C)8	(C)10	Yes	Repeat varies	Repeat varies
Adhesion	NGO1445	(CAAG)20CAAA	NGK_1705	(CAAG)12CAAA	(CAAG)12CAAA	(CAAG)6CAAA	(CAAG)9CAAA	(CAAG)6CAA A	Yes	Repeat varies	Repeat varies
Replication initiation factor	NGO_06135	(C)8TTATCTAACA(G)7	NGK_1957	(C)11TTATCTAACA(G)8	(C)7TTATCTAACA(G)7	(C)6TTATCTAACA(G)5	(C)11TTATCTAACA(G)8	(C)10T TAT C TAACA(G)7	Yes	Repeat varies	Repeat varies
Pilin cassette	NGO_11140	CCGC	NGK_2161	(C)8	(C)5GCC	CCGCC	(C)5	CCT (C)5	Yes	Repeat varies	Repeat varies
Pyrimidine 5′-nucleotidase	NGO2055 & NGO2054II	(C)6	NGK_2176	CAAACCCC	CAAACCCC	CAAACCCC	(C)9	(C)10	Yes	No repeat	No repeat
Lipoprotein	NGO2047	(A)9	NGK_2186§§	(A)8	(A)8	(A)9	(A)9	(A)8	Yes	Repeat varies	Repeat varies
Hypothetical	NGO1953	(C)8	NGK_2297	(C)8	(C)8	(C)8	(C)9	(C)8	Yes	Repeat varies	Repeat does not vary
Repetitive large surface lipoprotein	NGO_09875 & NGO_09870II	(G)8	NGK_2422 & NGK_2423||	(G)7	(G)7	(G)7	(G)7	(G)7	Yes	Repeat varies	Repeat does not vary
fetA / frpB	NGO2093	(C)13	NGK_2557	(C)14	(C)10	(C)11	(C)11	(C)11	Known	Repeat varies	Repeat varies
pilC 1	NGO1912	(G)11	NGK_2342	(G)13	(G)11	GGGC(G)11	(G)15	(G)11	Known	Repeat varies	Repeat varies
opa	NGO0950a	(CTTCT)16CTTCC	NGK_0847	(CTTCT)19CTTCC	(CTTCT)13CTTCC	(CTTCT)16CTTCC	(CTTCT)8CTTCC	(CT T CT )4CT TCC	Known	No reads through repeat	Repeat varies

*From the N. gonorrhoeae strain FA1090 genome sequence (NC_002946.2).

†From the N. gonorrhoeae strain NCCP11945 genome sequence (CP00150.1).

‡From the N. gonorrhoeae strain FA19 genome sequence (NZ_CP012026.1).

§From the N. gonorrhoeae strain FA6140 genome sequence (NZ_CP012027.1).

||From the N. gonorrhoeae strain 35/02 genome sequence (NZ_CP012028.1).

¶From the N. gonorrhoeae strain MS11 genome sequence (NC_022240.1).

#Gene phase variation candidacy in N. gonorrhoeae. Known, phase variation has been reported in the literature. Yes, there is evidence of repeat tract variation between strains supporting phase variation. (Yes), although there is no variation between strains investigated here, tracts of this length vary on other genes (Chen ; Shafer ; Adamczyk-Poplawska ).

**Based on Ion Torrent sequencing data from cultures grown with passage for 8 weeks and from cultures grown with passage for 20 weeks (accession numbers SRR3547950, SRR3547951, SRR3547952, SRR3547953).

††Based on Illumina sequencing data from cultures grown with passage for 20 weeks (accession numbers SRR3547954, SRR3547955, SRR3547956, SRR3547957).

‡‡There is a 400 bp deletion in this strain encompassing the region that would contain this repeat.

§§NGK_2186 and NGO2047 annotations are on opposite strands.

||||This coding sequence appears to be frame-shifted and annotated as two coding sequences.

The Ion Torrent sequencing technology has been criticised for generating homopolymer-associated indels (Loman ) and that the tracts can be incorrect at more than eight bases (Quail ), the optimal length for phase variation. Homopolymeric tracts in Illumina data are believed to be less error prone (Schirmer ). However, repeat sequence data from Illumina often agreed with Ion Torrent on the presence of variation (9 of 14 genes with variation in Ion Torrent, Table 5). When the Illumina data did not show repeat variation, this often corresponded to relatively low read coverage of the region compared to the Ion Torrent data (Table S2).

It is currently impossible to differentiate genuine biologically induced indels from sequencing errors (Narzisi & Schatz, 2015). We may find that what we ascribe to errors can also be subtle changes that are constantly being generated within the bacterial population. From this data, the expected biological variation supporting phase variation appears to be present in N. gonorrhoeae strain NCCP11945 for 12 as yet unexplored genes.

Conclusion

In conclusion, N. gonorrhoeae possesses three different mechanisms for phase variation: transcriptional; translational; and C-terminal. Stochastic systems obviously play important roles in the biology of the organism given the variety and number of genes involved. The functions of previously unexplored phase-variable genes, including one transcriptional phase-variable gene, nine translational phase-variable genes, and four C-terminal phase-variable genes require further investigation.