Literature DB >> 28348369

Novel molecular approach to define pest species status and tritrophic interactions from historical Bemisia specimens.

W T Tay1, S Elfekih2, A Polaszek3, L N Court2, G A Evans4, K H J Gordon2, P J De Barro5.   

Abstract

Museum specimens represent valuable genomic resources for understanding host-endosymbiont/parasitoid evolutionary relationships, resolving species complexes and nomenclatural problems. However, museum collections suffer DNA degradation, making them challenging for molecular-based studies. Here, the mitogenomes of a single 1912 Sri Lankan Bemisia emiliae cotype puparium, and of a 1942 Japanese Bemisia puparium are characterised using a Next-Generation Sequencing approach. Whiteflies are small sap-sucking insects including B. tabaci pest species complex. Bemisia emiliae's draft mitogenome showed a high degree of homology with published B. tabaci mitogenomes, and exhibited 98-100% partial mitochondrial DNA Cytochrome Oxidase I (mtCOI) gene identity with the B. tabaci species known as Asia II-7. The partial mtCOI gene of the Japanese specimen shared 99% sequence identity with the Bemisia 'JpL' genetic group. Metagenomic analysis identified bacterial sequences in both Bemisia specimens, while hymenopteran sequences were also identified in the Japanese Bemisia puparium, including complete mtCOI and rRNA genes, and various partial mtDNA genes. At 88-90% mtCOI sequence identity to Aphelinidae wasps, we concluded that the 1942 Bemisia nymph was parasitized by an Eretmocerus parasitoid wasp. Our approach enables the characterisation of genomes and associated metagenomic communities of museum specimens using 1.5 ng gDNA, and to infer historical tritrophic relationships in Bemisia whiteflies.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28348369      PMCID: PMC5428565          DOI: 10.1038/s41598-017-00528-7

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Since its description by Gennadius in 1889, the taxonomy of the whitefly Bemisia tabaci has proven a challenge. There had been various significant taxonomic revisions[1-3] within this nominal species, but the lack of unique morphological features associated with these led to all being synonymised under the name ‘B. tabaci’. The confusing nomenclature was revised using allozyme and DNA markers that indicated substantial sub-clustering, eventually giving rise to the biotype concept. This has more recently been superseded, by thorough integration of sequence and biological data which demonstrated that B. tabaci is in fact a complex of more than 43 cryptic biological species[4]. The recognition that B. tabaci is a species complex presented a further challenge, which is to link collection specimens (all tagged with the nomenclature at the time of identification) with the newly adopted genetically-based structure[5]. Tay et al. [6] determined the identity of the original 1889 Gennadius B. tabaci whitefly specimen through Sanger sequencing of multiple PCR products. Characterisation of the partial mitochondrial DNA cytochrome oxidase subunit I (mtCOI) gene from a single museum individual originally collected by Gennadius in 1889 subsequently showed that the Mediterranean (‘MED’) member of the complex was the true ‘B. tabaci’. Since then, there have been no further studies using museum specimens to address taxonomic issues in the remaining members of the B. tabaci complex. One of the most important concerns in working with historical specimens is the finite amount of material available. PCR primers for the partial mtCOI region[7] can be inefficient, due to the large diversity within B. tabaci clades[4, 8], and multiple PCR amplification attempts can rapidly deplete the sample with no guarantee of success. Attempts to overcome this have involved replacing the commonly-used universal primers developed by Simon et al. [9] with ones designed for a specific clade. For instance, partial mtCOI gene diversity ‘within species’ typically ranges between 0 to 3.4%, while it ranges from 3.1 to 5.5% between species within clades (e.g., MEAM1 vs MED), to 15.7% to 16.5% for species between clades (i.e., B. tabaci SSA4 vs MEAM1)[5]. However, in addition to primer design, factors such as the poor quality and low yield of the genomic DNA (gDNA) due to the specimen size, preservation methods and the age of the material, have all contributed to the difficulty of mtCOI genotyping. Work on historical Bemisia samples would therefore greatly benefit from novel, more efficient technologies. Next-generation sequencing (NGS) approaches are now routinely used to characterise mitogenomes from individual specimens (e.g., Arnemann et al. [10]), and including from a single Bemisia individual[11], although the method of Tay et al. [11] used at least 18 ng of double stranded gDNA for NGS library construction. Recently, Timmermans et al. [12] demonstrated that a large volume of both nuclear and mitochondrial DNA data could be generated and captured from single historical insect individuals using NGS platform. These NGS approaches not only bypassed primer binding efficacy issues, but offer vastly more effective utilisation of gDNA from individual specimens of interest. The NGS platform therefore represents an attractive option for studying historical Bemisia specimens, and will enable us to relate these individuals to our emerging understanding of challenging species complexes, associated metagenomics compositions, and host-parasitoid interactions. Here, we describe the draft mitogenomes of two historical Bemisia specimens, that of a 104 year-old B. emiliae Corbett 1926, previously synonymised with B. tabaci [2], and a 74 year-old whitefly specimen identified as ‘B. tabaci’ from Japan in 1942, prepared using a Nextera XT DNA library and sequenced using an Illumina MiSeq sequencer. The high-throughput sequence data allowed us to conduct a comparative genomics analysis between Bemisia species, to explore their metagenomic communities, and provide insights into the diversity of Bemisia parasitoid species.

Results

The single 1912 B. emiliae 4th instar nymph (“puparium”) yielded a total of 4.62ng of double stranded gDNA, and the 1942 ‘B. tabaci’ 4th instar from Japan yielded 27.85 ng of double stranded gDNA. The Illumina MiSeq run generated 4,520,563 pair-end sequence reads (i.e., 9,041,126 reads) for B. emiliae, and 2,906,587 pair-end sequence reads (i.e., 5,813,174 reads) for the Japanese ‘B. tabaci’. Pair-end sequences from both the 1912 B. emiliae and the Japanese ‘B. tabaci’ supported the mitogenomes as circular molecules. The draft mitogenomes of both museum specimens were assembled using the mitogenome of B. tabaci Asia I (KJ778614) as a reference. We recovered a complete mitogenome for B. emiliae (15,515 bp from 37,089 reads) (GenBank KX714967) and a partial mitogenome (GenBank KX714968) for the 1942 ‘B. tabaci’ individual from 2,607 NGS genomic fragments (Fig. 1). An estimated 3,635 bps distributed across six regions of the mitogenome were missing from the 1942 Bemisia specimen, impacting eight protein coding genes (PCGs), eight tRNAs, and one rRNA (Fig. 1; Supplementary Table 1). Alignment with the assembled B. tabaci Asia II-7 (Fig. 1, Supplementary Table 1) indicated that these missing mitogenome regions included regions spanning partial ATP8 to partial ND5, part of Cyt b, part of the large subunit rRNA and small subunit rRNA, missing tRNAAsn, tRNAArg, tRNAAla, ND3, tRNAGly, and also part of COIII. Gene orientation and gene order between the 1912 and 1942 Bemisia specimens were identical overall and as confirmed via the De Novo Assemble algorithm within Geneious version 8.0.5 (Biomatters Ltd, Auckland, NZ) (data not shown), although gene orientation for ATP6, ND3, and the missing tRNAs for the Japanese Bemisia specimen could not be ascertained. The assembled partial mitogenome of the Japanese Bemisia consisted of 2,255 sequences, with an estimated sequence genome length of 15,214 bp.
Figure 1

Diagrammatic representation of the complete mitochondrial DNA genome of Bemisia emiliae (black bar), showing orientation of protein coding genes (PCGs), tRNAs and rRNAs, with the mitochondrial DNA cytochrome oxidase (mtCOI) gene arbitrarily selected as a starting point. The mitochondrial DNA genome of the 1942 Japanese Bemisia sp. is aligned against that of B. emiliae, and gaps are introduced for alignment purposes. Predicted tRNAs, and partial PCGs of the 1942 Bemisia sp. are as detailed in Supplementary Table 1. Missing tRNAs and PCGs are shown in grey with corresponding orange segments on the mtDNA genome schematic diagram of the 1942 Bemisia species.

Diagrammatic representation of the complete mitochondrial DNA genome of Bemisia emiliae (black bar), showing orientation of protein coding genes (PCGs), tRNAs and rRNAs, with the mitochondrial DNA cytochrome oxidase (mtCOI) gene arbitrarily selected as a starting point. The mitochondrial DNA genome of the 1942 Japanese Bemisia sp. is aligned against that of B. emiliae, and gaps are introduced for alignment purposes. Predicted tRNAs, and partial PCGs of the 1942 Bemisia sp. are as detailed in Supplementary Table 1. Missing tRNAs and PCGs are shown in grey with corresponding orange segments on the mtDNA genome schematic diagram of the 1942 Bemisia species. The 1912 B. emiliae cotype specimen had a 100% partial mtCOI (657 bp) sequence identity to three members (i.e., GQ139492, AJ748378, DQ174523) of the B. tabaci Asia II-7 clade, and ranged between 98% (AY686075) and 99% sequence identity (AM408899, DQ174523, AJ748372, DQ116650, DQ116661, DQ116660, DQ174521, AJ748375, DQ116662, AY686064) with other B. tabaci Asia II-7 members. All reported Asia II-7 members were of Asian origin (e.g., India, Taiwan, China). Similarly, based on partial mtCOI sequence (777 bp) identity, the 1942 Bemisia specimen matched 99% with members of the Bemisia genetic group of ‘JpL’[13] (GenBank accession numbers AB308111, AB308114-AB308119, AB240967, accessed 02-Jun-2016), all of which are from Japan. Phylogenetic analysis[5, 13] based on the same partial mtCOI gene region indicated a basal position of the ‘JpL’ genetic group to the ‘B. tabaci’ species complex, providing support that this 1942 Japanese ‘B. tabaci’ was likely a non-‘tabaci’ species. Its basal position clusters with other members of Bemisia that were, until recently, members of Lipaleyrodes, which was synonymised with Bemisia in 2009[14]. Metagenomics analysis showed that 90.4% of B. emiliae sequences was of bacterial origin, of which 84.3% belonged to the Gram-negative Proteobacteria phylum, and only 6% to Arthropoda. This contrasted significantly with the metagenomic compositions of the 1942 Bemisia individual where only 26% was of bacterial origin and 61% of arthropod origin (Table 1). Interestingly, both B. emiliae and the 1942 Bemisia specimens had low (0.2% and 0.1%, respectively) sequences that matched to Bemisia, and is reflective of the absence of a Bemisia genome. A total of 1.5% of sequences from B. emiliae matched sequences corresponding to Hymenoptera (i.e., Nasonia, Harpegnathos, Camponotus, Apis), while this was 36.5% for the 1942 Bemisia specimen (Table 1). We detected the primary (P)-endosymbiont Candidatus Portiera aleyrodidarum in both hosts, as well as similar proportions of the facultative secondary (S)-endobacteria Cand. Hamiltonella and Rickettsia, and a higher proportion of Wolbachia was detected in the 1942 Bemisia than in B. emiliae. Finally, both Arsenophonus (Enterobacteriaceae) and Cand. Cardinium (Bacteroidaceae) were detected only in B. emiliae (Table 1).
Table 1

MiSeq input and post quality control (QC) data for metagenomic analysis via MG-Rast standard pipeline for the 1912 B. emiliae specimen (MG-Rast accession number: 4681440.3) and the 1942 Japanese Bemisia species (MG-Rast accession number: 4690946.3).

1912 B. emiliae %1942 Bemisia sp.%
Up-load count (bp)950,823,796870,198,516
up-load seq count9,041,1265,813,174
Upload: Mean Sequence Length (bp)105 ± 54149 ± 56
Post QC: Count (bp)848,681,21887.6839,130,41795.4
Post QC: Sequences Count7,921,1545,544,879
Post QC: Mean Sequence Length (bp)107 ± 54151 ± 55
Taxonomic Hits Distribution
Bacteria860,36690.4*75,32026
Proteobacteria803,37784.3*58,56720.2
Enterobacteriaceae 75,3417.913,3194.6
Cand. Hamiltonella 1,6130.24910.2
Cand. Portiera aleyrodidarum 5450.061,2280.4
Arsenophonus 5390.06n/an/a
Bacteroidaceae 1,6420.27030.2
Cand. Cardinium 87<0.01n/an/a
Alphaproteobacteria 142,24814.9*11,6404.0
Rickettsia 1,5270.29150.3
Wolbachia 1,4270.23,7431.3*
Comamonadaceae
Acidovorax 291,12330.1*6,9032.4
Eukaryota 86,6369.1211,85673.1*
 Arthropoda57,2426.1176,90361.0*
  Bemisia 2,0880.24290.1
  Nasonia 5,5270.664,60322.1*
  Harpegnathos 3,0640.315,3695.2*
  Camponotus 2,8580.317,3455.9*
  Apis 2,9310.39,5463.3*
Viruses2,0360.21,5220.5
Others1,9010.21,0060.3

A summary of taxonomic hits for Bacteria, Eukaryota, Viruses are provided. Hit abundances that differed greatly between B. emiliae and the 1942 Bemisia sp. are indicated in by ‘*’.

MiSeq input and post quality control (QC) data for metagenomic analysis via MG-Rast standard pipeline for the 1912 B. emiliae specimen (MG-Rast accession number: 4681440.3) and the 1942 Japanese Bemisia species (MG-Rast accession number: 4690946.3). A summary of taxonomic hits for Bacteria, Eukaryota, Viruses are provided. Hit abundances that differed greatly between B. emiliae and the 1942 Bemisia sp. are indicated in by ‘*’. High proportions of sequences matching Hymenoptera (Table 2) in the 1942 Bemisia suggested either contamination, or alternatively parasitism by a hymenopteran parasitoid wasp. Mining the NGS sequence data successfully assembled a DNA contig of 8,951 bp (from 3,410 DNA fragments) that spanned the complete 16 S to 28 s ribosomal RNA (rRNA) genes and included the intergenic spacer (ITS) 1, the 5.8 s rRNA, and the ITS2 region (GenBank KX714966). A DNA contig of 1,926 bp (GenBank KX714952) was also assembled that included the complete mtDNA COI gene (1,536 bp; 512 amino acids), and two tRNAs (tRNALys and tRNAMet) genes. The predicted tRNAMet is 68 bp (Fig. 2A) and is within the typical tRNA lengths of 60–80 bp in Hymenoptera[15, 16] and has the (TAT) anticodon. The tRNALys has the (TTT) anticodon reported in various Hymenoptera species including species within the Chalcidoidea superfamily (e.g., Encarsia formosa), and may represent mutation from the ancestral state of (CTT) anticodon[17]. Interestingly, this tRNALys is only predicted to be 48 bp in lengh and having a two-arms clover leaf secondary structure due to the absence of the TψC arm and loop (Fig. 2B). The prediction of this 48 bp tRNALys secondary structure is unlikely to have been affected by contig assemblies using short NGS DNA fragments due to its centrally located position within multiple pair-end sequences, some of which are 200 bp long and extended across to the mtDNA COI gene (Supplementary Fig. 1). Though unusual, two-arms clover leaf tRNA secondary structures are known in diverse organisms from mammals (e.g., bovine[18]) to arthropods (e.g., trnS1 and trnS2 of B. emiliae, trnS2 of the 1942 Japanese Bemisia sp., this study; Habronattus jumping spiders[19]; Scelionidae parasitic Hymenoptera[20]), while the missing part of the TψC arm and loop is, to our knowledge, the first to be reported in an Aphelinidae parasitoid wasp species (see below). Various hymenopteran mtDNA partial genes were further assembled and included COII (424 bp, GenBank KX714953), ATP6 (289 bp, GenBank KX714954), ATP6-COIII (524 bp, KX714955), COIII (333 bp, GenGank KX714956; 200 bp, GenBank KX714957), NADH5 (232 bp, GenBank KX714958; 263 bp, GenBank KX714959; 411 bp, GenBank KX714960), NADH4 (155 bp, GenBank KX714961), NADH4-tRNAArg (Fig. 2C) (243 bp, 60 bp; GenBank KX714962), tRNAThr-tRNAPro-NADH6 (61 bp (Fig. 2D), 69 bp (Fig. 2E), 371 bp, GenBank KX714963), and NADH6-Cyt b (112 bp, 1,054 bp, GenBank KX714964) (Fig. 1).
Table 2

Annotations of the detected mitochondrial DNA (mtDNA) genes of a parasitoid Eretmorcerus sp. from the gDNA of the ‘1942’ Japanese Bemisia specimen.

Eretmocerus sp. JAP1942GenBanknucleotide positionsBest matched organismGenBankAmino acid positionsIdentity (%)Number of reads
itRNAMet (M)KX71495259..126
iitRNALys (K)KX714952186..233
iiiCOIKX714952362..1,879 Nasonia longicornis ACH8176911..51682168A
ivCOIIKX7149533..422 Megaphragma amalphitanum YP_00917632567..2067440
vATP6KX714954102..314 Philotrypesis pilosa AEG253101..6732306
viATP6KX71495542..461 Philotrypesis pilosa AEG2531083..22271
viiCOIIIKX714955469..522 Philotrypesis pilosa AEG25309.12..1978139B
viiiCOIIIKX71495610..312 Nasonia longicornis ACH81765161..2617119
ixCOIIIKX7149571..198 Nasonia giraulti ACH8175460..125858
xNADH5KX7149582..229 Ceratosolen solmsi AEG67044.147..1226414
xiNADH5KX7149592..262 Nasonia giraulti ACH81759193..2798310
xiiNADH5KX7149602..409 Megaphragma amalphitanum YP_009176327304..439576
xiiiNADH4KX7149613..155 Nasonia vitripennis ACH81738.1268..318654
xivNADH4KX71496234..243 Nasonia vitripennis ACH81738.1187..25673
xvtRNAArg (R)KX714962278..337198C
xvitRNAThr (T)KX7149631..61
xviitRNAPro (P)KX71496367..135
xviiiNADH6-0KX714963220.. 447 Nasonia vitripennis ACH81751.129..104498D
xivNADH6-0KX7149648..112 Nasonia vitripennis ACH81751.1148..18251
xxCyt b KX714964114..1,166 Nasonia vitripennis ACH81741.12..3477674E

A total of 13 DNA fragments (GenBank accession numbers KX714952–KX714964) representing eight mtDNA protein coding genes and five tRNAs were detected. Amino acid positions of the best matched hymenopteran species within the Chalcidoidea superfamily and the percentage identity are also shown.

Note: (A) A total of 168 reads for the assembly of (i, ii, iii). (B) A total of 139 reads for the assembly of (vi, vii). (C) A total of 198 reads for the assembly of (xiv, xv). (D) A total of 8 reads for the assembly of (xv, xvi, xvii). (E) A total of 74 reads for the assembly of (xiv, xx).

Figure 2

tRNA secondary structures of the hymenopteran parasitoid from the 1942 Japanese Bemisia sp. (A) The 68 bp tRNAMet has an anticodon of (TAT) and is of the typical three clover leaf structure. (B) The tRNALys is predicted to be 48 bp and has the unusual (TTT) anticodon and is lacking the TψC arm and loop. The tRNAArg is 60 bp in length and has the (GCG) anticodone (C); the tRNAThr (D) is 61 bp in length, and the tRNAPro is 69 bp in length (E), and have the (TGT) and (TGG) anticodons, respectively.

Annotations of the detected mitochondrial DNA (mtDNA) genes of a parasitoid Eretmorcerus sp. from the gDNA of the ‘1942’ Japanese Bemisia specimen. A total of 13 DNA fragments (GenBank accession numbers KX714952–KX714964) representing eight mtDNA protein coding genes and five tRNAs were detected. Amino acid positions of the best matched hymenopteran species within the Chalcidoidea superfamily and the percentage identity are also shown. Note: (A) A total of 168 reads for the assembly of (i, ii, iii). (B) A total of 139 reads for the assembly of (vi, vii). (C) A total of 198 reads for the assembly of (xiv, xv). (D) A total of 8 reads for the assembly of (xv, xvi, xvii). (E) A total of 74 reads for the assembly of (xiv, xx). tRNA secondary structures of the hymenopteran parasitoid from the 1942 Japanese Bemisia sp. (A) The 68 bp tRNAMet has an anticodon of (TAT) and is of the typical three clover leaf structure. (B) The tRNALys is predicted to be 48 bp and has the unusual (TTT) anticodon and is lacking the TψC arm and loop. The tRNAArg is 60 bp in length and has the (GCG) anticodone (C); the tRNAThr (D) is 61 bp in length, and the tRNAPro is 69 bp in length (E), and have the (TGT) and (TGG) anticodons, respectively. Extensive local rearrangements and translocations within Hymenoptera mitogenomes are known[17], and while gene orders for tRNAThr-tRNAPro-NADH6-Cyt b were similar to those reported for various parasitoid hymenopteran wasp species[20, 21], identification of tRNAMet-tRNALys-COI, as well as the NADH4-tRNAArg gene orders would nevertheless suggest presence of novel mitogenome gene rearrangements in the parasitoid wasp, likely to be an Eretmocerus species (see below). Confirmation of such gene rearrangements will require future characterisation of the complete mtDNA genomes of Eretmocerus wasp species.

Phylogenetic analysis of Eretmocerus species

Sequence identity of the 779 bp partial mtDNA COI C-terminal region matched the Aleyrodidae parasitoid Eretmocerus cocois (EU017333) at 90% identity, and between 88–89% sequence identity with 10 other publicly available (ie., through GenBank) but unpublished reports of Eretmocerus species including Eret. desantisi, Eret. cocois, Eret. mundus, Eret. hayati, and an unnamed Eretmocerus sp. YBZ-2013 (sequence identity to Eret. hayati = 98%) from China Xinjiang province (KF859899). Phylogenetic analysis (best substitution model: HKY85+G+I+F, proportion of invariable sites: estimated (0.387); number of substitution rate categories: 6; Gamma shape parameter: estimated (0.319); Lkl: −5517.437; AIC: 11260.873; K = 113) of the aligned 657 bp partial mtCOI sequences, and included various Chalcidoidea wasp species indicated that our unknown hymenopteran entity was from a separate evolutionary lineage basal to the sister clade that included Eret. mundus, Eret. hayati, and Eret. sp. YBZ-2013. The two sister clades of Eret. mundus-Eret. hayati-Eret. sp. YBZ-2013, and the Japanese 1942 hymenopteran individual were clustered with 100% bootstrap node support that indicated a shared most recent common ancestor. A third Eretmocerus basal sister clade included the Caribbean/New World species of Eret. cocois and Eret. desantisi from the French overseas territory of Guadeloupe[22] (Fig. 3). All Aphelinidae wasps (i.e., Eretmocerus species including the unknown Japanese 1942 Hymenoptera, all Encarsia/Coccophagoides species) formed sister clades with each other and exhibited high (99.6%) bootstrap value.
Figure 3

Phylogenetic placement of the unknown hymenopteran entity detected in the gDNA of the 1942 Japan Bemisia sp. The Hymenoptera is likely a parasitoid wasp species of the Eretmocerus genus based on partial (657 bp) mtCOI gene phylogeny, being placed within the ‘Eretmocerus’ clade (indicated by a red branch). The Aphelinidae wasps (‘Encarsia/Coccophagoides’ and ‘Eretmocerus’ species) formed sister clades with 99.6% node confidence. Green coloured box indicates Coccophagoides moeris. Outgroups used are Eurytoma caninae (Eurytomidae), Nasonia species (Pteromalidae) and Philotrypesis species (Pteromalidae). Node confidence of ≥50% (estimated from 1,000 bootstrap replications) are indicated.

Phylogenetic placement of the unknown hymenopteran entity detected in the gDNA of the 1942 Japan Bemisia sp. The Hymenoptera is likely a parasitoid wasp species of the Eretmocerus genus based on partial (657 bp) mtCOI gene phylogeny, being placed within the ‘Eretmocerus’ clade (indicated by a red branch). The Aphelinidae wasps (‘Encarsia/Coccophagoides’ and ‘Eretmocerus’ species) formed sister clades with 99.6% node confidence. Green coloured box indicates Coccophagoides moeris. Outgroups used are Eurytoma caninae (Eurytomidae), Nasonia species (Pteromalidae) and Philotrypesis species (Pteromalidae). Node confidence of ≥50% (estimated from 1,000 bootstrap replications) are indicated.

Discussion

To our knowledge, this is the first investigation into tritrophic interactions in historical Bemisia specimens. This was made possible by developing a protocol using low amounts of input double stranded gDNA (only 1.5 ng). This novel approach offers enormous potential to resolve existing taxonomic questions and also contribute to genome-wide surveys of individual historical Bemisia specimens, and can potentially be adopted for solving nomenclatural and taxonomic confusion in other cryptic species complexes. Since the synonymising of Bemisia species including B. inconspicua Quaintance (1900; collected in Florida, USA, synonymised by Russell[3]), B. gossypiperda Misra & Singh (1929; from India, synonymised by Russell[3]), and B. emiliae Corbett (1927; collected from Sri Lanka, synonymised by Mound and Halsey[2] with ‘B. tabaci’; see also Martin and Mound[23]), genetic data based on partial mtDNA COI gene[4, 5, 8, 24], and mating behaviour studies[4, 25–28] have increasingly supported the recognition of B. tabaci as being a complex of cryptic species. By analysing historical specimens collected from the same geographic localities and at similar time frames prior to mass global commodity movements, it is possible to help ascertain historical species habitat boundaries, and ultimately contribute to rectify incorrectly synonymised species. In this respect, the cotype 1912 B. emiliae individual with partial mtCOI gene matching at high percentage (98–100%) with B. tabaci Asia II-7 may be seen as the next stage of solving Bemisia whitefly nomenclatural confusion, since the identification of the true B. tabaci [6]. We further provided an example of cryptic species misidentification in the 1942 Japanese Bemisia species, and highlighted the on-going challenges in understanding the genetic diversity and species status of this global agricultural pest species complex. Metagenomic compostions of various B. tabaci cryptic species have been investigated[29-31] using gene-specific primers, with secondary endosymbionts such as Arsenophonus, Cardinium, and Wolbachia reported in Chinese B. tabaci ‘Asia II-7’ samples[29, 31], while Bing et al. [29] also identified Rickettsia in their Asia II-7 material. In the 1912 B. emiliae individual, in addition to Arsenophonus, Cardinium, Rickettsia and Wolbachia, Hamiltonella was also detected. While we showed that both B. emiliae and the Japanese Bemisia species had, to a certain extent, similar P- and S-endobacterial compositions, there were also significant endosymbionts metagenomic profile differences. For example, the endosymbionts Arsenophonus and Cardinium were only detected in B. emiliae, as well as significant amount (14.9%) of Alphaproteobacteria, in contrast to only 4% detected in the 1942 Bemisia species (Table 2). We identified two regions of a partial wsp Wolbachia gene (106 bp and 230 bp; GenBank KX714969) that showed between 98% and 99% sequence identity, to the B. tabaci Asia II-7 Wolbachia wsp gene (KJ600634) as reported by Ahmed et al. [32]. The 230 bp partial wsp gene region from our historical 1942 specimen also showed high sequence homologies (99–100%) with diverse organisms, including a 99% sequence identity with the Wolbachia wsp gene from B. afer, and with native members of the B. tabaci species complex from China (e.g., Asia II3, Asia I, China I; Ji et al. [33]), although reduced sequence identity (81.12–93.91%) were also detected between the historical wsp partial gene sequence and the partial sequences of ‘B. tabaci’ Wolbachia W4 and W6 strains (Table 3)[33]. Similarly, the 106 bp partial wsp gene that were identified also shared 100% sequence identity with the Wolbachia wsp gene of B. afer (AJ291370), and between 98.11–100% with B. tabaci (GU968901, JN315980, HQ404797) (Table 3), all of which were clustered at 73% on the same W1/W2 phylogenetic branch[33]. A lower sequence identity of 87.74% was also shared with the Wolbachia wsp gene (AJ291379) (Table 3) from a B. tabaci host that was shown to be phylogenetically basal to the W1-W6 Wolbachia strains reported by Ji et al. [33], and highlighted the difficulty of pin-pointing the identity of the Wolbachia strain(s) in our 1942 Miseq sequence data due to the short sequence nature of this partial gene region.
Table 3

Percentage (%) sequence identity of Bemisia species Wolbachia endosymbionts wsp partial gene (230 bp).

Jap_1942KJ648499AJ291370JN315980FJ545748KJ648498HQ404797GU968901KJ648500AJ291379KJ648502KJ648503KJ648501
KJ64849999.13
AJ291370 98.7 (100)98.7
JN315980 98.7 (100)98.7100
FJ54574898.798.7100100
KJ64849898.798.7100100100
HQ404797 98.26 (100)98.2699.5799.5799.5799.57
GU968901 98.26 (98.11)98.2699.5799.5799.5799.5799.13
KJ64850095.6596.5296.9696.9696.9696.9696.5296.52
AJ291379 94.78 (87.74)95.6596.0996.0996.0996.0995.6595.6597.39
KJ64850293.9194.7895.2295.2295.2295.2294.7894.7896.5298.26
KJ64850393.9194.7895.2295.2295.2295.2294.7894.7896.5298.2697.39
KJ64850181.1281.1281.5581.5581.5581.5581.9781.1283.6983.6983.2683.69

The Wolbachia wsp partial gene from the historical 1942 Bemisia specimen (‘Jap_1942’) was most similar to KJ648499, which belonged to the W2 Wolbachia strain isolated from invasive (i.e., MED, MEAM1) and native (Asia I, Asia II3, China 2) B. tabaci cryptic species complex. ‘†’Indicates the five Wolbachia strains that had sufficient wsp gene sequence at the 5′ region to enable sequence identity comparison with the historical Japanese Wolbachia wsp gene (sequence identity acorss these 5′ end of 106 bp are indicated within parentheses).

Note: GenBank accession numbers provided for Wolbacia strains W1 (KJ648498), W2 (KJ648499), W3 (KJ648500), W4 (KJ648501), W5 (KJ648502), and W6 (KJ648503) are as reported by ref. 33.

Percentage (%) sequence identity of Bemisia species Wolbachia endosymbionts wsp partial gene (230 bp). The Wolbachia wsp partial gene from the historical 1942 Bemisia specimen (‘Jap_1942’) was most similar to KJ648499, which belonged to the W2 Wolbachia strain isolated from invasive (i.e., MED, MEAM1) and native (Asia I, Asia II3, China 2) B. tabaci cryptic species complex. ‘†’Indicates the five Wolbachia strains that had sufficient wsp gene sequence at the 5′ region to enable sequence identity comparison with the historical Japanese Wolbachia wsp gene (sequence identity acorss these 5′ end of 106 bp are indicated within parentheses). Note: GenBank accession numbers provided for Wolbacia strains W1 (KJ648498), W2 (KJ648499), W3 (KJ648500), W4 (KJ648501), W5 (KJ648502), and W6 (KJ648503) are as reported by ref. 33. Alternatively, it is also possible that the Eretmocerus parasitoid larva within the 1942 Bemisia nymph was itself infected with a different Wolbachia strain. Exploring the MiSeq data indentified a 189 bp coxA sequence (GenBank KX714965) that shared between 91% and 94.7% sequence identity with the majority of B. tabaci cryptic species Wolbachia coxA gene[32, 34] but 100% sequence identity with B. afer coxA ST382 at this 189 bp region, as well as 100% sequence identity with the coxA partial gene of Wolbachia isolated from six diverse species including Philaenus spumarius (Hemiptera, Aphrophoridae) (KM377724), Hypoponera ant (Hymenoptera, Formicidae) (KF490396), Macrosteles fascifrons (Hemiptera, Cicadellidae) (HQ404763), Sogatella furcifera (Hemiptera, Delphacidae) (FJ713762), Teleogryllus taiwanemma (Orthoptera, Gryllidae) (DQ842303), and Acraea encedon (Lepidoptera, Nymphalidae) (DQ842269) (data not shown). Horizontal transfer of Wolbachia strains between phylogenetically distantly related arthropods has been reported previously[35-37], and our partial coxA gene shared 100% sequence identity with the hemipteran (i.e., P. spumarius, S. furcifera) and orthopteran (i.e., T. taiwanemma) hosts that were also known to be present in Japan. The coxA locus between Bemisia species including B. tabaci cryptic species complex and B. afer species have been characterised (e.g., Ghosh et al. [34]) and are highly similar. The 189 bp coxA partial gene from the 1942 Bemisia specimen captured only 23 SNPs of the total 40 SNPs present in the characterised coxA gene across a diverse groups of B. tabaci cryptic species, and shared 100% SNP identity with B. afer ST382 (Table 4). Given the partial coxA gene sequence matched both B. afer’s Wolbachia partial coxA ST382 sequence as well as non-Bemisia hosts, it suggests that the increase in Wolbachia sequences detected in the 1942 Bemisia specimen may well be due to infections in both the Bemisia nymph and the parasitoid larva.
Table 4

Comparison of single nucleotide polymorphism (SNP) profile of the Wolbachia coxA gene between known Bemisia tabaci cryptic species, B. afer, and the Japanese 1942 (JAP1942) Bemisia specimen.

Nucleotide position
15212430335260120123130135141165189246249252255258259
Consensus sequenceTGCGGGAAACTTCCCTACAG
coxA 14.AA.AACCTTTCTTTCCTGA
B. afer (ST382)CA.A....T......C..GA
JAP1942 coxA ? ? ? ? ? ? ? ? ? ? ? ? ? ..C..GA
261 264 276 288 294 299 300 303 307 315 324 331 333 339 342 357 375 384 394 402
consensus sequenceCGCTTAGAACTGATTCAAGC
coxA 14T.TA.T..G.AAGCC.GGAT
B. afer (ST382)TA.AC.AGGT...C.TG..T
1942 coxA TA.AC.AGGT...C.T ? ? ? ?

coxA-14 sequences include B. tabaci SSA1-SG1, and B. tabaci SSA1-SG2 and are as reported in ref. 34. Consensus sequence identies are noted below. coxA missing regions for the 1942 Japanese Bemisia speciemen are between nucleotide positions 1 and 174, and from 364 to 402. Unknown SNP porfiles are indicated by ‘?’.

Note: consensus sequence SNP profiles were from identical coxA_88 seqeunce. coxA sequences aligned included: HQ404793, JQ013511, B. tabaci Q(ST116), B. tabaci Asia-I (ST378, ST385, ST395), B. tabaci Asia II-1 (ST389, ST390, ST391, ST392), B. tabaci Asia II-3 (ST396), B. tabaci Asia Ii-6 (ST393, ST394), B. tabaci Asia II-7 (ST378), B. tabaci Asia II-9 (ST384), B. tabaci China-1 (ST377, ST379, ST383), B. tabaci SSA1-SG5 (coxA 88), B. tabaci SSA1-SG3 (ST424, 425), B. tabaci Australia (ST380), and B. afer NG (ST427).

Comparison of single nucleotide polymorphism (SNP) profile of the Wolbachia coxA gene between known Bemisia tabaci cryptic species, B. afer, and the Japanese 1942 (JAP1942) Bemisia specimen. coxA-14 sequences include B. tabaci SSA1-SG1, and B. tabaci SSA1-SG2 and are as reported in ref. 34. Consensus sequence identies are noted below. coxA missing regions for the 1942 Japanese Bemisia speciemen are between nucleotide positions 1 and 174, and from 364 to 402. Unknown SNP porfiles are indicated by ‘?’. Note: consensus sequence SNP profiles were from identical coxA_88 seqeunce. coxA sequences aligned included: HQ404793, JQ013511, B. tabaci Q(ST116), B. tabaci Asia-I (ST378, ST385, ST395), B. tabaci Asia II-1 (ST389, ST390, ST391, ST392), B. tabaci Asia II-3 (ST396), B. tabaci Asia Ii-6 (ST393, ST394), B. tabaci Asia II-7 (ST378), B. tabaci Asia II-9 (ST384), B. tabaci China-1 (ST377, ST379, ST383), B. tabaci SSA1-SG5 (coxA 88), B. tabaci SSA1-SG3 (ST424, 425), B. tabaci Australia (ST380), and B. afer NG (ST427). Primer efficacy issues may have contributed to the lack of detection of Hamiltonella by Bing et al. [29] and Zchori-Fein et al. [31], although host plant utilisation and environmental factors including adaptation to pesticides could also play a role in influencing endobacterial communities in Bemisia [38-40]. Hamiltonella from B. tabaci MED/MEAM1 has been proposed to present no parasitoid-resistance due the inactivation of the APSE phage[41]. However, it can enhance hosts’ survival rates through an endosymbiont-mediated defense against parasitoid wasps in aphids[42], In addition, Hamiltonella can also increase host growth rates in nutrient-poor environments[40], or enhance reproductive rates and nymph growth rates, as reported for the invasive B. tabaci MED[39]. It is possible that host association with the Hamiltonella endosymbiont may therefore diminish in nutrient-rich environments (i.e., applications of crop fertilisers). Similary, applications of pesticides could result in the reduction of beneficial insects including parasitoids, and therefore reduce the benefits provided by this endosymbiont to its host (i.e., defense against parasitoid wasps). These anthropogenic factors often associated with the green revolution could have potential and indirect effects that contributed to the non-detection of Hamiltonella in present-day non-invasive B. tabaci Asia II-7 hosts as compared to the historical B. emiliae specimen. Given our current understanding, and the uncertainty about whether there are different strains of Hamiltonella being detected, it remains possible that this endosymbiont may be important for both nutrient benefit and parasitoid resistance, however, complete genome and the phylogenetic positions of Hamiltonella from Bemisia cryptic species including that from B. emiliae would be needed to better test the hypothesis postulated above. We would like to emphasise that our hypothesis has been postulated based on our very limited NGS data that were derived from very small historical samples. Globally, the near fixation of Hamiltonella has been reported in both the B. tabaci MEAM 1 and MED cryptic species[43] within the ‘Africa/Middle East/Asia Minor’ clade[43], however the level of association between Hamiltonella and other B. tabaci cryptic species lacks this level of knowledge. This hypothesis should be further tested through the analysis of additional museum Bemisia samples, especially via NGS methods as demonstrated from this study. While the endosymbiont Fritschea bemisiae (Chlamydiales) had been reported in the B. tabaci ‘New World’ species complex (previously Biotype A)[43], this endosymbiont was not detected in both museum specimens analysed in this study. This again suggested potential differences in endobacterial metagenomic signatures between B. tabaci cryptic species from evolutionary diverse clades, as well as reflecting potential impact from both antropogenic (e.g. agricultural) activities and/or environmental/climatic differences. Within the bacterial sequences from B. emiliae, a total of 291,123 sequences (30.1%) showed high homology to the proteobacteria Acidovorax genus, a genus that included highly-damaging agricultural species capable of damaging seeds and fruit crop (e.g., A. citrulli is capable of causing seeding blight and bacterial fruit blotch in cucurbits[44, 45]). The metagenomic analysis also identified a total of 40,391 sequences (4.2%) with homology to Verminephrobacter species (MR-RAST ID 4661244.3 and 4690946.3), which was closely related to Acidovorax bacteria. Verminephrobacter species has been reported only in the Lumbricidae earthworm Eisenia foetida so far. It is difficult to provide plausible explanations for the detection of significant number (i.e., greater number of sequences than the p-endosymbiont Cand. P. aleyrodidarum) of such sequences. Although environmental contamination remained a possibility, the 4th instar B. emiliae larva was immersed in 100% ethanol for 24 hours prior to gDNA extraction, a process that would likely have reduced potential bacterial contaminations on the surface of the whitelfy nymph. This metagenomic bacterial signature is absent in the 1942 Bemisia specimen, and its detection in B. emiliae could be due environmental to factors or possibly of saprophytic origins. The family Aphelinidae are predominantly parasitoid wasps of hemipteran sap-sucking insects, and includes the genera Encarsia and Eretmocerus that have Bemisia species among their hosts[22, 46–50]. Despite their importance as biological control agents of Bemisia whiteflies, species diversity in both Encarsia and Eretmocerus genera are likely to be underestimated. With >450 Encarsia species described (including 435 valid species at present) in this genus[51], only 95 partial Encarsia mtCOI sequences (included 10 named Encarsia species: En. luteola, En. formosa, En. hispida, En. citrina, En. vandrieschei, En. normarki, En. brimblecombei, En. schmidti, En. protransvena, En. inaron, and five unnamed Encarsia species: En. sp. 1373B KF778422, Aphelinidae sp. 1378 A KF778427, En. sp. 1382 A KF778401, En. sp. 1369 A KF778420, En. sp. 1475 A KF778470) have been characterised at our aligned region (i.e., C-terminal region/3′-end) and are publicly available (GenBank nucleotide database, access 01-June-2016). Similary, only 18 mtDNA COI partial sequences representing seven (i.e., Eret. hayati, Eret. mundus, Eret. emeritis, Eret. orchamoplati, Eret. cocois, Eret. desantisi, Eret. sp. YBZ-2013) of 81 valid Eretmocerus species have been reported (GenBank nucleotide database, access 01-June-2016), and none originated from Japan, the likely origin of the Eretmocerus species detected in the 1942 Bemisia nymph host. Of these 18 reported Eretmocerus species mtCOI sequences, two belonged to Eret. eremicus (FM210161, FM210163) and six to Eret. orchamoplati (HQ660514, JF750711 to JF750715), and had the N-terminal region (i.e., 5′-end) of the mtCOI gene characterised at 460–651 bp. Sequence identities between the 1942 Japanese Eretmocerus species and Eret. eremicus or Eret. orchamoplati were both at 85% for this 5′-end partial mtCOI gene region, further ruling out them as candidates. Three species of Eretmocerus are currently known from Japan[51]: Eret. aleurolobi (Ishii 1938), Eret. furuhashii (Rose and Zolnerowich 1994) and Eret. serius (Silvestri 1927), but none has yet been sequenced for mtCOI genes. Eret. aleurolobi has only been recorded from Aleurolobus marlatti. Eret. serius is a well-known parasitoid of Aleurocanthus species in the Oriental region, with two published records from B. tabaci, neither of which appears to be reliable[52, 53]. The third species, Eret. furuhashii is known only from Parabemisia myricae. However, Hoelmer and Goolsby[54] record ‘Eret. near furuhashii’ as one of the species introduced from Taiwan into USA against B. tabaci. This identification would have been made by Rose, who clearly considered this B. tabaci parasitoid close to, but distinct from, Eret. furuhashii which he had co-described in 1994. There is thus strong circumstantial evidence that our historical Eret. sp. from Japan is this undescribed species from Taiwan that Rose designated ‘near furuhashii’. In China, at least 19 aphelinid wasps have been recorded to parasitise Bemisia, with Eret. sp. nr. furuhashii being the most abundant, followed by En. bimaculata (Heraty and Polaszek), being responsible for 15–87.3% parasitisim in agricultural crops[55-57]. Given that the partial mtCOI phylogeny did not support our unknown parasitoid as being an Encarsia species, it would rule out En. bimaculata, leaving Eret. sp. nr. furuhashii (Fig. 4) as the most probable candidate. Two further pieces of supporting evidence that Eret. sp. near furuhashii is the likely candidate came from the partial mtCOII (cytochrome oxidae subunit II) gene (424 bp; GenBank KX714953) and the 28 s rRNA gene (GenBank KX714966) assembled and identified from the 1942 Japanese Bemisia nymph specimen, where these two partial hymenopteran genes (i.e., mtCOII, 28 s rRNA) matched Eret. sp. nr. furuhashii from Sanya China, between the mtCOII at nucleotide positions 64 and 332 (i.e., JF820015, 266 bp) with 98.14% sequence identity, and between the 28 s rRNA at nucleotide positions 4,348 and 4,804 (i.e., JF899345, 457 bp) with 100% sequence identity.
Figure 4

Eretmocerus furuhashii Rose: composite image from 4 female paratype specimens (Irvine 108, Orange Co. California, USA. 29.vii.1982 ex Parabemisia myricae. Ferrentino + Woolley col. BMNH(E) 1996-136). Scale bar = 0.1 mm. The image was produced using AutoMontage (Synoptics Ltd, Cambridge, UK) stacking imaging software on a set of images taken with a Q-Imaging RoHS camera and processed using Adobe Photoshop CC version.

Eretmocerus furuhashii Rose: composite image from 4 female paratype specimens (Irvine 108, Orange Co. California, USA. 29.vii.1982 ex Parabemisia myricae. Ferrentino + Woolley col. BMNH(E) 1996-136). Scale bar = 0.1 mm. The image was produced using AutoMontage (Synoptics Ltd, Cambridge, UK) stacking imaging software on a set of images taken with a Q-Imaging RoHS camera and processed using Adobe Photoshop CC version. Although intriguing, it remains to be seen whether the 1942 Japanese native Bemisia species is a natural host of Eret. sp. nr. furuhashii, and whether the abundance of this aphelinid wasp is the same in Japan as in China. The identity of the Eretmocerus species that parasitized the Japanese 1942 Bemisia nymph will for now remain unconfirmed and intra-species genetic diversity survey, followed by morphological and molecular characterisation of aphelinid wasps in this native Japanese Bemisia species will be needed for its future identification. Our study demonstrated the possibility of investigating tritrophic interactions between host, parasitoid and endosymbionts in museum specimens from just 1.5 ng of double stranded gDNA. While Tin et al. [58] demonstrated between 14–220 ng of gDNA would be sufficient for genome-wide SNP analysis via the Restriction-Associated DNA sequencing (i.e., RAD-Tag/RADseq) method for museum specimens (collected from 1910 to 1976), our protocol further reduced the required gDNA for NGS methods to approximately one-tenth of the 14 ng used by Tin et al. [58]. Our method also overcame the challenge of working with highly fragmented gDNA starting material without performing an initial ‘end-repair’ step[59] that may lead to the loss of gDNA. Although non-destructive extraction of gDNA is possible from a range of small insects[60] including Aphelinidae wasps[47], it was not attempted for these Bemisia museum specimens, and could be adopted to provide a non-destructive NGS protocol for the recovery of these historical specimens. Our method described here will offer significantly improved opportunity to better investigate the genomics of historical specimens, and together with new genome-wide SNP generating methodologies that have been developed[58], will deepen our knowledge regarding how current ecological and climatic conditions as well as anthropogenic factors have impacted on species historical distributional range and their bacterial metacommunity compositions.

Material and Methods

A single Bemisia emiliae pupa (cotype) was collected from Hakgala, Sri Lanka (formerly Ceylon), by E. E. Green in May 1912. It was formerly described 14 years later[61]. The specimen was deposited at the Smithsonian Institution, Washington D.C. The second sample is a single whitefly 4th instar nymph collected by S. Kanda in Muroto, Shikoku, Japan on 08-Aug-1942 and morphologically identified as B. tabaci. All samples were made available for use in this study by Greg Evans, USDA APHIS NIS. The extraction protocol consisted of first placing the pupa in 1,000 µL of analytical grade 99.9% ethanol for 24 hours in a sterile 1.5 mL Eppendorf tube. The ethanol was then removed and the specimen and air-dried for 15 minutes at room temperature. Once dried, the pupa was crushed in a sealed P200 sterile pipette tip and extracted using a modified protocol that combined the Qiagen Blood and tissue DNA extraction kit and the Zymo Research DNA concentrator protocol. The protocol was modified to improve the quality and yield of DNA extracted. It involved digesting the crushed pupa in 196 µL of AL (Qiagen) and 4 µL of proteinase K (Qiagen; >600 mAU/mL) for 24 hours at 56 °C. At the end of the digestion step, 4 µL of RNase A (Qiagen; 100 mg/mL) was added and incubated at room temperature for 5 minutes. The digestion buffer with the pupa was pulse-spun and 200 µL of wash buffer AW1 (Qiagen) was added. The liquid was then transferred to the Zymo Research genomic DNA concentrator column, and centrifuged as per the Zymo Research genomic DNA concentrator protocol (10,000 g, 1 min). The washing step was repeated and the gDNA was finally eluted in 15 µL of Buffer EB (Qiagen, Cat. # 19086). We used 2 µL of the eluted gDNA to estimate DNA concentration using Qubit v2.0 (Life Technologies, Grand Island, NY) dsDNA HS assay. The remaining amount of eluted gDNA (ca. 3.98 ng (B. emiliae); ca. 24.01 ng (1942 ‘Bemisia’)) in Elution Buffer (~12.5 µL) was allowed to evaporate at room temperature for 16 hours (in a sterile fume hood, uncapped, but loosely covered by a piece of clean Kimwipe tissue). The dried gDNA from the pupa was then re-suspended in 5 µL nuclease-free water (Qiagen, Cat.129114) for 60 minutes at room temperature.

Preparation and normalisation of Nextera XT library to 2 nM of amplicon molecules

Although the Nextera XT protocol recommended only 1.0 ng of double stranded gDNA as starting input material, we used 1.5 ng of double stranded gDNA for very small museum specimens such as Bemisia nymphs, to compensate for the likely presence of very fragmented gDNA (i.e., <50 bp) and to allow for targeting of slightly larger fragments for 2 × 300 bp PE sequencing. The amount of 1.5 ng of double stranded gDNA was sampled from each of B. emiliae and the 1942 Bemisia specimens and processed using the Nextera XT DNA Library Preparation kit (Illumina, Cat. # FC-131-1096). Individual Bemisia pupae gDNA was tagmented (tagged and fragmented) by the Nextera XT transposome. The tagmented gDNA was amplified in a limited cycle PCR reaction to add indexes and Illumina adapter sequences (Illumina, Cat. # FC-131-2003) for sample tracking and cluster formation. For each Bemisia specimen, the amplified library was purified and size-selected using AMPureXP beads (Beckman Coulter, Cat. # A63881). Purified libraries were then quantified by Qubit dsDNA HS assay and the size distribution checked by HS D1000 screentape assay (Agilent, Cat. # 5067–5584) on an Agilent 2200 Tapestation. The insert sizes of our gDNA libraries were determined to range between 160–500 bp for B. emiliae and between 154–1,234 bp for the 1942 ‘JpL’ Bemisia species, and both have a peak fragment size of 256 bp. The Illumina Nextera XT libraries were then normalized to a final concentration of 2 nM, denatured and diluted to a final concentration of 10 pM and combined with a Phi X control library (Illumina, Cat. # FC-110-3001), spiked in at 2.5%. The Illumina libraries were then sequenced on an Illumina MiSeq sequencer using a MiSeq reagent kit v3, 600 cycles (Illumina, Cat. # MS-102-3003) to perform a 2 × 301 bp paired-end sequencing run. We used Geneious version 8.0.5 (Biomatters Ltd, Auckland, NZ) to assemble of the full mitogenome of B. emiliae, using the Bemisia tabaci cryptic species Asia I mitogenome (KJ778614)[11] as a reference. We used Illumina reads with quality checking performed within Geneious version 8.0.5 for mitogenome assembly and annotations. The assembly parameters consisted of 10% maximum mismatches per read, minimum overlap of 25 bp, maximum gap size of 3 bp, and minimum overlap identify of 80%. The mitogenome annotation was conducted using MITOS[62], with manual fine-tuning of putative start codon position for all protein coding genes within Geneious. Pairwise mitogenome alignments between the 1942 ‘B. tabaci’, B. emiliae, and B. tabaci Asia I (KJ778614) were performed using MAFFT v7.017[63] within the Geneious version 8.0.5 program and implementing default parameters (Algorithm: Auto; Scoring matrix: 200 PAM/k = 2; Gap open penalty: 1.53; Offset value: 0.123). To quantify microbial community compostions in the gDNA of both historical Bemisia specimens, paired-end sequence reads were analysed using MG-RAST metagenomic analysis server version 3.6. Analyses of gDNA from both 1912 B. emiliae and 1942 ‘B. tabaci’ samples were carried out using the default settings. Output sequences best matching hymenopteran mtDNA genes were used as template for re-assembly of contigs in Geneious version 8.0.5. MG-RAST metagenomic analysis results can be accessed from the MG-RAST website http://metagenomics.anl.gov using the accession numbers 4681440.3 and 4690946.3 for the 1912 B. emiliae and the 1942 Bemisia species, respectively. We conducted a phylogenetic analysis to infer species relationships of the unknown Hymenoptera to selected Chalcidoidea parasitoid wasp species belonging to six genera (i.e., Eretmocerus, Nasonia, Philotrypesis, Coccophagoides, Encarsia, Eurytoma; Supplementary Table 2), based on partial mtCOI gene as obtained from GenBank nucleotide database (accessed 01-Jun-2016). Sequences were imported into CLC Sequence Viewer version 7.6 (Qiagen Aarhus A/S) and followed by alignment using default settings (Gap open cost = 10; Gap extension = 1.0). Alignment of the partial mtCOI gene is generally straight forward across diverse insect groups as it typically does not involve INDELs. Trimming of sequences therefore only involved removal of flanking 5′ and 3′ regions that extended beyond the region and length of interest. Trimmed sequences (657 bp) were used to generate a Maximum Likelihood phylogenetic tree using PhyML 3.0 http://atgc-montpellier.fr/phyml/, using the ‘automatic model selection’ option, followed by 1,000 bootstrap replications to estimate node confidence. The phylogenetic tree was then visualized in Dendroscope (Hudson and Scornavacca 2012) version 3.2.10 www.dendroscope.org.

Identification of Wolbachia coxA and wsp partial gene sequences

The two regions of the Wolbachia wsp partial gene (106 bp, 230 bp: GenBank KX714969) were compared to sequences available in GenBank using Blastn search, and aligned and trimmed in Geneious version 8.0.5 prior to estimating the leve of sequence identity (Table 3). The coxA database was accessed (9-July-2016) and aligned with the 189 bp partial coxA gene sequence (GenBank KX714965) identified from the 1942 Bemisia specimen using Geneious version 8.0.5 to identify SNP patterns (Table 4).

Identification of the parasitoid mtDNA and ribosomal (18S–28S) gene sequences

We assembled the complete 18 s rRNA/ITS1/5.8 s rRNA/ITS2/28 s rRNA genes of the parasitoid larva from the 1942 Bemisia 4th instar nymph by using the Eret. sp. nr. furuhashii partial 28 s rRNA sequence (JF820005) from GenBank as reference sequence. The contig obtained was characterised for ribosomal RNA subunits using the web-based RNAmmer 1.2 Server[64] to predict the presence of 5 s/8 s, 16 s/18 s and 23 s/28 s ribosomal RNA. Contig assembly for various mtDNA genes were based on partial hymenopteran mtDNA gene regions identified by MG-RAST. These partial gene regions were subsequently used as reference sequences for contig assembly in Geneious version 8.0.5, using default settings as described for the assembly of the 1912 B. emiliae and the 1942 Bemisia mitogenomes. To ensure that as many of as possible of known Chalcidoidea mtDNA genes were identified in our 1942 Bemisia specimen MiSeq Nextera XT library, we also used the Nasonia longicornis partial mtDNA genome (EU746612) previously reported by Oliveira et al. [65] as a reference genome in mining for mitochondrial DNA genes.

Ascertaining historical Bemisia gDNA quality against published B. tabaci genome

The paired-end reads corresponding respectively to B. emiliae and B. sp. ‘JpL’ were mapped to the B. tabaci (MEAM1) genome http://www.whiteflygenomics.org/cgi-bin/bta/blast.cgi (last accessed 14-November-2016) using the Burrows-Wheeler Aligner BWA v.0.7.12[66], with the defaults parameters. The mapped reads were converted from sam to bam format and checked for mapping quality using SAMtools[67]. The percentage of read mapping in the case of B. emiliae is 80.04%, from which 77.44% of reads were properly paired, whereas it was respectively 53.92% and 49.95% for B. sp. ‘JpL’.
  42 in total

1.  Novel chlamydiae in whiteflies and scale insects: endosymbionts 'Candidatus Fritschea bemisiae' strain Falk and 'Candidatus Fritschea eriococci' strain Elm.

Authors:  Karin D E Everett; MyLo Thao; Matthias Horn; Glen E Dyszynski; Paul Baumann
Journal:  Int J Syst Evol Microbiol       Date:  2005-07       Impact factor: 2.747

2.  Draft genome sequence of "Candidatus Hamiltonella defensa," an endosymbiont of the whitefly Bemisia tabaci.

Authors:  Qiong Rao; Shuang Wang; Yun-Lin Su; Xiao-Li Bing; Shu-Sheng Liu; Xiao-Wei Wang
Journal:  J Bacteriol       Date:  2012-07       Impact factor: 3.490

3.  Phylogenetic evidence for horizontal transmission of Wolbachia in host-parasitoid associations.

Authors:  F Vavre; F Fleury; D Lepetit; P Fouillet; M Boulétreau
Journal:  Mol Biol Evol       Date:  1999-12       Impact factor: 16.240

Review 4.  Bemisia tabaci: a statement of species status.

Authors:  Paul J De Barro; Shu-Sheng Liu; Laura M Boykin; Adam B Dinsdale
Journal:  Annu Rev Entomol       Date:  2011       Impact factor: 19.686

5.  Improved DNA barcoding method for Bemisia tabaci and related Aleyrodidae: development of universal and Bemisia tabaci biotype-specific mitochondrial cytochrome c oxidase I polymerase chain reaction primers.

Authors:  Robert G Shatters; Charles A Powell; Laura M Boykin; He Liansheng; C L McKenzie
Journal:  J Econ Entomol       Date:  2009-04       Impact factor: 2.381

6.  MITOS: improved de novo metazoan mitochondrial genome annotation.

Authors:  Matthias Bernt; Alexander Donath; Frank Jühling; Fabian Externbrink; Catherine Florentz; Guido Fritzsch; Joern Pütz; Martin Middendorf; Peter F Stadler
Journal:  Mol Phylogenet Evol       Date:  2012-09-07       Impact factor: 4.286

7.  Biology and use of the whitefly parasitoid Encarsia formosa.

Authors:  M S Hoddle; R G Van Driesche; J P Sanderson
Journal:  Annu Rev Entomol       Date:  1998       Impact factor: 19.686

8.  The intracellular bacterium Wolbachia uses parasitoid wasps as phoretic vectors for efficient horizontal transmission.

Authors:  Muhammad Z Ahmed; Shao-Jian Li; Xia Xue; Xiang-Jie Yin; Shun-Xiang Ren; Francis M Jiggins; Jaco M Greeff; Bao-Li Qiu
Journal:  PLoS Pathog       Date:  2015-02-12       Impact factor: 6.823

9.  Comparative and phylogenetic analysis of the mitochondrial genomes in basal hymenopterans.

Authors:  Sheng-Nan Song; Pu Tang; Shu-Jun Wei; Xue-Xin Chen
Journal:  Sci Rep       Date:  2016-02-16       Impact factor: 4.379

10.  Is agriculture driving the diversification of the Bemisia tabaci species complex (Hemiptera: Sternorrhyncha: Aleyrodidae)?: Dating, diversification and biogeographic evidence revealed.

Authors:  Laura M Boykin; Charles D Bell; Gregory Evans; Ian Small; Paul J De Barro
Journal:  BMC Evol Biol       Date:  2013-10-18       Impact factor: 3.260

View more
  7 in total

1.  Draft mitogenomes of the invasive ant Lepisiota frauenfeldi (Mayr 1855) (Hymenoptera: Formicidae).

Authors:  W T Tay; L N Court; B D Hoffmann; A Polaszek
Journal:  Mitochondrial DNA B Resour       Date:  2022-06-28       Impact factor: 0.610

2.  Genome-wide analyses of the Bemisia tabaci species complex reveal contrasting patterns of admixture and complex demographic histories.

Authors:  S Elfekih; P Etter; W T Tay; M Fumagalli; K Gordon; E Johnson; P De Barro
Journal:  PLoS One       Date:  2018-01-24       Impact factor: 3.240

3.  An integrative approach to discovering cryptic species within the Bemisia tabaci whitefly species complex.

Authors:  Soňa Vyskočilová; Wee Tek Tay; Sharon van Brunschot; Susan Seal; John Colvin
Journal:  Sci Rep       Date:  2018-07-18       Impact factor: 4.379

4.  Comparative transcriptome analysis reveals genetic diversity in the endosymbiont Hamiltonella between native and exotic populations of Bemisia tabaci from Brazil.

Authors:  Bruno Rossitto De Marchi; Tonny Kinene; James Mbora Wainaina; Renate Krause-Sakate; Laura Boykin
Journal:  PLoS One       Date:  2018-07-27       Impact factor: 3.240

5.  Global population genomic signature of Spodoptera frugiperda (fall armyworm) supports complex introduction events across the Old World.

Authors:  Wee Tek Tay; Rahul V Rane; Amanda Padovan; Tom K Walsh; Samia Elfekih; Sharon Downes; Kiwong Nam; Emmanuelle d'Alençon; Jianpeng Zhang; Yidong Wu; Nicolas Nègre; Daniele Kunz; Darren J Kriticos; Cecilia Czepak; Michael H Otim; Karl H J Gordon
Journal:  Commun Biol       Date:  2022-04-07

6.  The Trouble with MEAM2: Implications of Pseudogenes on Species Delimitation in the Globally Invasive Bemisia tabaci (Hemiptera: Aleyrodidae) Cryptic Species Complex.

Authors:  Wee Tek Tay; Samia Elfekih; Leon N Court; Karl H J Gordon; Hélène Delatte; Paul J De Barro
Journal:  Genome Biol Evol       Date:  2017-10-01       Impact factor: 3.416

7.  Unamplified, Long-Read Metagenomic Sequencing Approach to Close Endosymbiont Genomes of Low-Biomass Insect Populations.

Authors:  Joseph R Petrone; Alam Muñoz-Beristain; Paula Rios Glusberger; Jordan T Russell; Eric W Triplett
Journal:  Microorganisms       Date:  2022-02-26
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.