Ming He1, Guangbin Wang1, Linlin Jiang2, Chuang Qiu1, Bin Li1, Jiashi Wang1, Yonghui Fu1. 1. Department of Orthopedic Surgery, Shengjing Hospital of China Medical University, Shenyang, Liaoning, P.R. China. 2. Department of Electrotheropy, Shenyang Medical College Affiliated Central Hospital, Shenyang, Liaoning, P.R. China.
Abstract
Osteosarcoma is one of the most highly malignant types of cancer in adolescents and young adults with a high mortality rate. Despite advances in surgery, radiation therapy and chemotherapy, the prognosis for patients with osteosarcoma has not significantly improved over the past several decades. It is necessary to find new indicators of prognosis and therapeutic targets of osteosarcoma. Through the analysis of 40 osteosarcoma tissues, we found that the expression of miR‑486 was low and the expression of PKC‑δ was high in osteosarcoma. Median survival of patients with low expression of miR-486 (30 months) was shorter than the patients with higher expression of miR‑486 (40 months). We further found that miR-486 can inhibit the targeting of PKC‑δ signaling pathways, and this inhibition can inhibit the growth and invasion of osteosarcoma cells. After transfection of miR‑486 for 24 h, the proliferation of osteosarcoma cells was inhibited by ~20%, and the migration was inhibited by ~15%. In the present investigation, we demonstrated that miR‑486 is negatively associated with the expression of PKC-δ and could regulate the development of osteosarcoma. miR-486 may be a potential target for the treatment of osteosarcoma.
Osteosarcoma is one of the most highly malignant types of cancer in adolescents and young adults with a high mortality rate. Despite advances in surgery, radiation therapy and chemotherapy, the prognosis for patients with osteosarcoma has not significantly improved over the past several decades. It is necessary to find new indicators of prognosis and therapeutic targets of osteosarcoma. Through the analysis of 40 osteosarcoma tissues, we found that the expression of miR‑486 was low and the expression of PKC‑δ was high in osteosarcoma. Median survival of patients with low expression of miR-486 (30 months) was shorter than the patients with higher expression of miR‑486 (40 months). We further found that miR-486 can inhibit the targeting of PKC‑δ signaling pathways, and this inhibition can inhibit the growth and invasion of osteosarcoma cells. After transfection of miR‑486 for 24 h, the proliferation of osteosarcoma cells was inhibited by ~20%, and the migration was inhibited by ~15%. In the present investigation, we demonstrated that miR‑486 is negatively associated with the expression of PKC-δ and could regulate the development of osteosarcoma. miR-486 may be a potential target for the treatment of osteosarcoma.
Osteosarcoma is the most common malignant tumor of the bone, osteosarcoma accounts for ~44.6% of bone tumors. It is regarded as a hotspot for research and difficult in clinical treatment because of its high malignant degree, metastasis rate and fatality rate. With the development of osteosarcoma therapy over the past several decades, including neoadjuvant and adjuvant chemotherapy coupled with local control, patient outcomes have been improved. However, it is still difficult to solve the two major problems, the recurrence and metastasis. Approximately 80–90% of the causes of death in patients with osteosarcoma are metastasis especially pulmonary metastasis (1–3). Therefore, it is extremely urgent to find effective early diagnostic tools and treatment in osteosarcoma.miRNAs are a class of endogenous non-coding small RNAs ~21–23 nucleotides in length. They negatively regulate their target gene expression post-transcriptionally by base-pairing with the complementary sites in the 3′-untranslated region (3′-UTR) of the mRNA of their cognate target mRNAs. Thousands of miRNA genes have been found since they were first discovered in 1993. Studies have demonstrated that miRNAs are associated with a series of the important processes of life including development, cell proliferation, differentiation and apoptosis. miRNAs are regarded as biomarkers and therapeutic targets for tumor and because they are associated with a variety of tumors and play a key role in controlling the metastasis of a tumor in addition to the high degree of scheduling, conservative and tissue specificity (1–6).At present, there is increasing interest in research related to miRNA in osteosarcoma. MiRNAs are proved to be related to the occurrence and the metastasis of osteosarcoma (1–3). miRNA expression in tumor cell lines and different clinical osteosarcoma samples were investigated and 22 differentially expressed miRNAs were found, among them the miRNAs miR-135b, miR-150, miR-542–5p and miR-652 have been verified and confirmed that may be involved in the tumor genesis of osteosarcoma (1). Through the comparison of different osteosarcoma cell line proliferation and metastasis ability it has been found that miR-93 may play an important role in the proliferation and invasion of osteosarcoma (7). It was also found that miR-143 could significantly reduce the metastatic ability of osteosarcoma through different metastatic osteosarcoma cell lines (8–11). Moreover, it was reported that miR-143 could promote apoptosis of osteosarcoma cells by acting on the target gene bcl-2, and inhibit the osteogenic ability of osteosarcoma cells (8–11). The expression level of miR-21 was downregulated in osteosarcoma cell line MG-63, so that the expression of its target tumor suppressor gene RECK was increased, so miR-21 could inhibit the migration and invasion of tumor cells through targeting RECK (12–15). Furthermore it was reported that miR-21 is closely related to apoptosis, proliferation and metastasis of osteosarcoma cells (12–15). Min et al (16) and Liu et al (17) reported that miR-199-3p expression was low in humanosteosarcoma cell line, it can significantly inhibit the proliferation and migration of osteosarcoma cells when it was overexpressed accompanied by decreased expression of TOR and Stats genes, suggesting that miR-199-3p may play an important role in osteosarcoma cells through the effects of these two genes. Fan et al showed that miR-145 could inhibit the migration and invasion of osteosarcoma cells by acting on VEGF (18). It has been reported that miR-34 was less expressed in osteosarcoma cells, and studies found that miR-34 can work on c-Met to inhibit the proliferation and metastasis of osteosarcoma cells SOSP-9607 (19–21). Huang et al confirmed that miR-20a in osteosarcoma cell line SAOS-2 can promote the transfer ability of cells by inhibiting the expression of Fas (22). Liu et al reported that miR-125b could inhibit the proliferation and migration of osteosarcoma cells by inhibiting the expression of STAT3 (23). Song et al found that miR-215 has a role in the methotrexate resistance of osteosarcoma (24). Therefore, many miRNAs may play an important role in the diagnosis or treatment of osteosarcoma. miR-486 has been shown to inhibit the growth and migration of osteosarcoma (25).In our study, we found that the expression of miR-486 in osteosarcoma was lower than that of adjacent tissue in 40 osteosarcomapatients. Also, further experimental results indicated that the expression of PKC-δ in osteosarcomapatients and the content of miR-486 had a correlation. Software was used for prediction that miR-486 can target PKC-δ and inhibits the activity of PKC-δ. Through a series of in vitro experiments, we confirmed that miR-486 can regulate the growth and metastasis of osteosarcoma cells by affecting PKC-δ.
Materials and methods
Ethics statement
For the use of clinical materials for research purposes, prior patients' written consent and approval were obtained from the Shenyang Medical College Affiliated Central Hospital according to institutional regulations. We have obtained consent to publish from the participant to report individual patient data.
Tissue specimens
Forty paired osteosarcoma tissues were histopathologically diagnosed from June 2005 to July 2010 in Shenyang Medical College Affiliated Central Hospital.
Real-time PCR
Total RNA from cultured cells and frozen tissue specimens was extracted using TRIzol (Invitrogen, USA) through the protocol. Real-time PCR analysis was performed according to the manufacturer's instructions (26). Primer sequences were synthesized as shown in Table I. The expression of miR-486 was detected with Stem-Loop RT-PCR assay as reported (27,28).
Table I
Primer sequences for detection of RNA expression.
Name
Forward primer (5′→3′)
Reverse primer (5′→3′)
miR-486
TGGGATCCATGAGGAAGGGACATGAAGA
ACCGAAGCTTAAAAAAGCTCGGTCCCAGAGTCAG
U6
CTCGCTTCGGCAGCACA
AACGCTTCACGAATTTGCGT
PKC
GGATCCCACCTCCCCAATTC
CTACAGTTGGCAGAGGAGCC
ERK
TCTGTAGGCTGCATTCTGGC
CAGGACCAGGGGTCAAGAAC
CDK4
CAGAGCTCTTAGCCGAGCGT
GGCACCGACACCAATTTCAG
CDK6
AGTCTGATTACCTGCTCCGC
CCTCGAAGCGAAGTCCTCAA
bcl-2
GGTGAACTGGGGGAGGATTG
GGCAGGCATGTTGACTTCAC
bax
AGCTGAGCGAGTGTCTCAAG
GTCCAATGTCCAGCCCATGA
mmp2
TGATCTTGACCAGAATACCATCG
GGCTTGCGAGGGAAGAAGTT
GAPDH
AACGACCCCTTCATTGAC
TCCACGACATACTCAGGGACAAC
Western blot analysis
Total proteins (100 µg) extracted from cell lines and tissues by RIPA lysis buffer (Sigma, USA) were analyzed by 10% SDS-PAGE and transferred onto nitrocellulose membrane (Corning, USA). Target proteins were probed with specific antibodies, PKC-δ (sc-213), ERK1/2 (sc-514302), CDK4 (sc-70832), CDK6 (sc-7961), bax (sc-4239), bcl-2 (sc-56015), mmp2 (sc-13594) and GAPDH (sc-365062) (Santa Cruz).
Dual luciferase reporter assay
The PKC 3′-UTR was cloned into the pGL3 Luciferase Report vector (ambion, USA). The pGL3-PKC mut 3′-UTR construct was generated by mutation of the complementary seed sequence to the miR-486 binding region. The primers were: PKC-wt, F: 5′-GGATCCCACCTCCCCAATTC-3′, R: 5′-CTACAGTTGGCAGAGGAGCC-3′, PKC-mut, F: 5′-CTGCAATAGAGCCTCTGGAGT-3′, R: 5′-CCAGAAGTGCAGGGATAGGG-3′. Cells were co-transfected with PKC wt or mut reporter vector and control plasmid in miR-486 mimic and miR-486 AS (anti-sense). Cells were incubated for 24 h and luciferase activity was assayed by an Orion II Microplate Illuminometer (Titertek-Berthold, USA) according to the manufacturer's instructions.
Cell culture
Humanosteosarcoma cell lines MG63 and U2OS were obtained from Chinese Academy of Medical Sciences. Cells were maintained at 37°C in a humidified air atmosphere containing 5% carbon dioxide in DMEM (Gibco, USA) supplemented with 10% FBS (Gibco).
Transfections
Cells were transfected with miR-486 mimic/mimic control (miR10004762-1-5/miR01201-1-5, Ruibo, China), miR-486 inhibitor/inhibitor control (miR20004762-1-5/miR02201-1-5, Ruibo) after 24 h by Lipofectamine 3000 (Invitrogen) according to the manufacturer's protocols. PKC and PKC mut were also transfected into cells by Lipofectamine 3000.
MTT assays
Cell proliferation was measured with 3-(4, 5-dimethylthiazolyl) 2,5-diphenyltetrazolium bromide (MTT). Briefly, after transfection, cells were plated in a 96-well microplate and incubated at 37°C in 5% CO2. Each data point was measured from 3 replicate wells. The optical densities were measured at 490 nm by Microplate Reader (Bio-Rad, USA).
Hoechst 33258 assay
After transfection, cells were plated in 6-well microplate for 24 h, add 1 µl (1 mg/ml) Hoechst 33258 was added for 10 min. Cells were observed by fluorescence microscopy.
Transwell assay
To determine cell metastasis, after transfection, cells were plated in medium without serum in the top chamber of a Transwell (Corning), while the media containing 20% FBS was placed in the lower well. After 24-h incubation added crystal violet dye staining for 10 min and photographed under a microscope. Experiments were carried out at least three times.
Statistical analysis
All data were analyzed with PRISM 6.0 (GraphPad, Inc.). Group comparison and χ2 test were used to analyze the results. Statistical significance was defined as P<0.05.
Results
The expression of miR-486 and PKC-δ in osteosarcoma
The expression of miR-486 in 40 patients with osteosarcoma was detected by real-time PCR. The result showed that miR-486 was downregulated in osteosarcoma (Fig. 1A). Through the data analysis, we found the patients with low miR-486 have a worse survival than the patients with higher miR-486 (Fig. 1B). There was a correlation between miR-486 and the grade of osteosarcoma (Table II). Next, we analyzed the expression of PKC in osteosarcoma. The results showed that the content of PKC in osteosarcoma tissue was higher than that in adjacent tissues (Fig. 1C). Also, the survival time of patients with higher PKC expression was shorter (Fig. 1D). Further analysis showed that the content of PKC was related to the grade of osteosarcoma (Table III). We analyzed the content of miR-486 and PKC in osteosarcoma, and the results showed that miR-486 and PKC were negatively correlated in osteosarcoma (Fig. 1E).
Figure 1
The expression of miR-486 and PKC in osteosarcoma. (A) The levels of miR-486 in 40 samples of osteosarcoma tissues and adjacent tissues were detected by real-time PCR. There was lower expression of miR-486 in osteosarcoma tissues. Data are shown as mean ± SEM. **P<0.05 vs. adjacent tissues group. (B) The relationship between the content of miR-486 and the survival time of osteosarcoma patients. (C) The levels of PKC in 40 samples of osteosarcoma tissues and adjacent tissues were detected by real-time PCR. There was higher expression of PKC in osteosarcoma tissues. Data are shown as mean ± SEM. **P<0.05 vs. adjacent tissues group. (D) The relationship between the expression of PKC and the survival time of osteosarcoma patients. (E) Correlation between the expression of miR-486 and PKC. There was a negatively correlated with the expression of PKC and miR-486.
Table II
Correlation between the expression of miR-486 and clinicopathological features in osteosarcoma.
Parameters
Description
No. of patient
miR-486 expression
χ2
P-value
High
Low
Gender
Male
22
9
13
0.242
0.622
Female
18
6
12
Age (years)
<18
23
7
16
1.152
0.283
≥18
17
8
9
TNM stage
I–II
23
5
18
5.736
0.017*
III–IV
17
10
7
aP<0.05.
Table III
Correlation between the expression of PKC and clinicopathological features in osteosarcoma.
Parameters
Description
No. of patient
PKC expression
χ2
P-value
High
Low
Gender
Male
22
14
8
0.333
0.564
Female
18
13
5
Age (years)
<18
23
15
8
0.129
0.720
≥18
17
12
5
TNM stage
I–II
14
11
12
9.548
0.002a
III–IV
6
16
1
P<0.05.
The relationship of miR-486 and PKC-δ in osteosarcoma
MIRDB (http://www.mirdb.org/miRDB/) predicted that miR-486 has a targeting region in 3′-UTR of PKC (Fig. 2A). The luciferase reporter gene experiment proved that miR-486 can directly effect PKC (Fig. 2B). miR-486 was overexpressed in MG63 cells, the expression of PKC was detected by western blot and real-time PCR analyses (Fig. 2C and D). The results showed that miR-486 could inhibit the expression of PKC at protein and mRNA levels. In turn, we found that PKC expression was upregulated when miR-486 was inhibited in MG63 cells (Fig. 2E and F). Furthermore, we constructed MG63 cell lines with miR-486 mimic or inhibitor to detect the activity of PKC downstream pathway protein. Results showed that miR-486 could inhibit the phosphorylation of ERK without affecting the total ERK (Fig. 2G–J). Thel above showed that miR-486 can suppress the PKC pathway in osteosarcoma.
Figure 2
The relationship of miR-486 and PKC in osteosarcoma (A) miRDB predicted that miR-486 could target PKC. (B) The interaction between miR-486 and the PKC was examined by luciferase reporter assays. Data are shown as mean ± SEM. **P<0.05 vs. TK-PKC group. (C) After transfecting miR-486 mimic/control in MG63 cells, the protein level of PKC was detected by western blot analysis. Data are shown as mean ± SEM. **P<0.05. (D) After transfecting miR-486 mimic/control in MG63 cells, the mRNA level of PKC was detected by real-time PCR. Data are shown as mean ± SEM. **P<0.05. (E) After transfecting miR-486 inhibitor/control in MG63 cells, the protein level of PKC was detected by western blot analysis. Data are shown as mean ± SEM. **P<0.05. (F) After transfecting miR-486 inhibitor/control in MG63 cells, the mRNA level of PKC was detected by real-time PCR. Data are shown as mean ± SEM. **P<0.05. (G) After transfecting miR-486 mimic/control in MG63 cells, the protein level of PKC, p-ERK1/2 and ERK1/2 were detected by western blot analysis. Data are shown as mean ± SEM. **P<0.05. (H) After transfecting miR-486 mimic/control in MG63 cells, the mRNA level of PKC and ERK1/2 detected by real-time PCR. Data are shown as mean ± SEM. **P<0.05. (I) After transfecting miR-486 inhibitor/control in MG63 cells, the protein level of PKC, p-ERK1/2 and ERK1/2 detected by western blot analysis. Data are shown as mean ± SEM. **P<0.05. (J) After transfecting miR-486 inhibitor/control in MG63 cells, the mRNA level of PKC and ERK1/2 detected by real-time PCR. Data are shown as mean ± SEM. **P<0.05.
miR-486 can inhibit the proliferation of osteosarcoma cells
It is well known that PKC/ERK pathway can regulate cell proliferation. Since we know that miR-486 could inhibit the expression of PKC, we wonder whether miR-486 could inhibit the proliferation of osteosarcoma cells through targeting PKC. MTT assay was used to examine the effect of miR-486 to MG63 cells and U2OS cells. With the transfection of miR-486 mimic or inhibitor, we found that miR-486 can inhibit the proliferation of MG63 cells and U2OS cells (Fig. 3A and B). It is well known that PKC/ERK can affect the expression of CDK4/CDK6 to regulate cell proliferation. We detected the protein and mRNA level of CDK4 and CDK6 in MG63 cells, when miR-486 was overexpressed or inhibited in MG63 cells (Fig. 3C–F). The results showed that miR-486 could inhibit the expression of CDK4 and CDK6 which are downstream proteins of PKC.
Figure 3
miR-486 can inhibit the proliferation of osteosarcoma cells. (A) After overexpression of miR-486, MG63 and U2OS cell proliferation was detected by MTT assay. Data are shown as mean ± SEM. (B) After inhibiting the expression of miR-486, MG63 and U2OS cell proliferation was detected by MTT assay. Data are shown as mean ± SEM. (C) after transfecting miR-486 mimic/control in MG63 cells, the protein level of CDK4 and CDK6 were detected by western blot analysis. Data are shown as mean ± SEM. **P<0.05. (D) After transfecting miR-486 mimic/control in MG63 cells, the mRNA level of CDK4 and CDK6 were detected by real-time PCR. Data are shown as mean ± SEM. **P<0.05. (E) After transfecting miR-486 inhibitor/control in MG63 cells, the protein level of CDK4 and CDK6 were detected by western blot analysis. Data are shown as mean ± SEM. **P<0.05. (F) After transfecting miR-486 inhibitor/control in MG63 cells, the mRNA level of CDK4 and CDK6 were detected by real-time PCR. Data are shown as mean ± SEM. **P<0.05.
miR-486 can promote the apoptosis of osteosarcoma cells
We investigated whether miR-486 can affect the apoptosis of osteosarcoma cells. We transfected miR-486 mimic into MG63 cells and found that miR-486 could promote apoptosis of MG63 cells (Fig. 4A). In contrast, apoptosis of MG63 cells was inhibited when miR-486 was inhibited in MG63 (Fig. 4B). Then we detected the expression of bcl-2 and bax in MG63 cells. The results showed that the protein and mRNA expression of bax was promoted, and the protein and mRNA expression level of bcl-2 was inhibited when miR-486 was overexpressed (Fig. 4C and D). When miR-486 was inhibited in MG63 cells, the expression of bax was downregulated and the expression of bcl-2 was upregulated (Fig. 4E and F). Since bcl-2 and bax can be regulated by PKC/ERK, we thought that the effect of miR-486 on the apoptosis of MG63 cells was achieved by its targeting of PKC.
Figure 4
miR-486 promotes apoptosis of osteosarcoma cells. (A) After overexpression of miR-486, MG63 cell apoptosis was detected by Hoechst 33258 assay. (B) After inhibiting the expression of miR-486, MG63 cell apoptosis was detected by Hoechst 33258 assay. (C) After overexpression of miR-486 in MG63 cells, the protein levels of bcl-2 and bax were detected by western blot analysis. Data are shown as mean ± SEM. **P<0.05. (D) After overexpression of miR-486 in MG63 cells, the mRNA levels of bcl-2 and bax were detected by real-time PCR. Data are shown as mean ± SEM. **P<0.05. (E) After transfection of miR-486 inhibitor/control in MG63 cells, the proteins levels of bcl-2 and bax were detected by western blot analysis. Data are shown as mean ± SEM. **P<0.05. (F) After transfecting miR-486 inhibitor/control in MG63 cells, the mRNA levels of bcl-2 and bax were detected by real-time PCR. Data are shown as mean ± SEM. **P<0.05.
miR-486 can inhibit the metastasis of osteosarcoma cells
Transwell assay (with or without Matrigel) were used to study whether miR-486 was involved in metastasis of MG63 cells and U2OS cells (Fig. 5A–F). miR-486 mimic/control or miR-486 inhibitor/control was transfected into MG63 cells and U2OS cells to detect the effect of miR-486 on metastasis of osteosarcoma cells. Results showed that the metastasis of MG63 cells and U2OS cells were significantly inhibited when the expression of miR-486 was overexpressed; however the metastasis of MG63 and U2OS cells were promoted when miR-486 expression was decreased. Furthermore, the level of mmp2 was detected by western blot and real-time PCR analyses after overexpression or inhibited miR-486 in MG63 cells (Fig. 5I–L). The results showed that mmp2 was significantly inhibited when miR-486 was overexpressed. These experiments confirmed that miR-486 could inhibit the metastasis of osteosarcoma cells by suppressing the PKC/ERK/mmp2 pathway.
Figure 5
miR-486 inhibits the metastasis of osteosarcoma cells. (A) After overexpression of miR-486 in MG63 cells, Transwell assay without Matrigel were performed. (B) After inhibiting miR-486 in MG63 cells, Transwell assay without Matrigel was performed. (C) After overexpression of miR-486 in MG63 cells, Transwell assay with Matrigel was performed. (D) After inhibiting miR-486 in MG63 cells, Transwell assay with Matrigel was performed. (E) After overexpression of miR-486 in U2OS cells, Transwell assay without Matrigel was performed. (F) After inhibiting miR-486 in U2OS cells, Transwell assay without Matrigel was performed. (G) After overexpression of miR-486 in U2OS cells, Transwell assay with Matrigel was performed. (H) After inhibition of miR-486 in U2OS cells, Transwell assay with Matrigel was performed. (I) After overexpression of miR-486 in MG63 cells, the protein level of mmp2 was detected by western blot analysis. Data are shown as mean ± SEM. **P<0.05. (J) After overexpression of miR-486 in MG63 cells, the mRNA level of mmp2 was detected by real-time PCR. Data are shown as mean ± SEM. **P<0.05. (K) After inhibiting miR-486 in MG63 cells, the protein level of mmp2 was detected by western blot analysis. Data are shown as mean ± SEM. **P<0.05. (L) After inhibiting miR-486 in MG63 cells, the mRNA level of mmp2 was detected by real-time PCR. Data are shown as mean ± SEM. **P<0.05.
miR-486 can adjust the osteosarcoma cell proliferation and metastasis by targeting PKC
The previous experiments showed that miR-486 can target PKC and acts on the PKC/ERK pathway. miR-486 inhibits growth and metastasis of osteosarcoma cells by targeting PKC. Next we confirmed our experiment from the opposite direction. We transfected miR-486 and PKC into osteosarcoma cells and found that the inhibition of miR-486 on the proliferation of osteosarcoma cells was weaken (Fig. 6A). Moreover, when miR-486 and PKC were co-transfected into osteosarcoma cells, the inhibitory effect of miR-486 on the metastasis of osteosarcoma cells almost disappeared (Fig. 6B–E). We found that miR-486 could affect the downstream protein expression by affecting PKC (Fig. 6F). Our results show that the regulation of miR-486 on the growth and invasion and metastasis of osteosarcoma cells may be, to a certain extent, by the inhibitory effect of miR-486 on PKC.
Figure 6
miR-486 can adjust the osteosarcoma cell proliferation and metastasis by targeting PKC. (A) After co-transfecting miR-486 and PKC, MG63 and U2OS cell proliferation was detected by MTT assay. Data are shown as mean ± SEM. (B–E) After co transfecting miR-486 and PKC in MG63 and U2OS cells, Transwell assay with or without Matrigel was performed. (F) After co-transfecting miR-486 and PKC, western blot analysis was used to show the protein dynamic changes in expression levels.
Discussion
Although in recent years, the overall survival rate of patients with osteosarcoma has significantly improved, the survival rate of the osteosarcomapatients with metastasis is still poor. The metastasis and recurrence of osteosarcoma are still the most important factors influencing the survival rate of osteosarcomapatients. Therefore, it is urgent to find a new target for the diagnosis and treatment of osteosarcoma, which can predict or inhibit the proliferation and metastasis of osteosarcoma, so as to improve the survival of osteosarcomapatients.miRNA re expression technology is expected to be a new osteosarcoma treatment. Therefore, to further explore the reduction of osteosarcoma related expression of miRNA is expected to screen out a new target for personalized therapy in osteosarcoma.miR-486 is often aberrantly expressed in humancancers and has been reported as a tumor suppressor in various cancers. Many reports suggest that miR-486 could be a biomarker and play a suppressor gene in NSCLC, and shown the effect of miR-486 on inhibition of the development and growth of NSCLC in mouse models (29,30). Other research found that miR-486 had a low content in esophageal squamous cell carcinomas and gastric adenocarcinomas so it might be an independent tumor marker for evaluating prognosis in patients with squamous cell carcinomas or gastric adenocarcinomas. miR-486 is frequently downregulated in hepatocellular carcinoma tissues and hepatocellular carcinoma cell lines; it can inhibit proliferation, invasion, and chemosensitivity to sorafenib of hepatocellular carcinoma cells. Deregulation of miR-486-5p is also be a common event in both benign and malignant humanbreast tumors (31). miR-486attenuates tumor growth and lymphangiogenesis by targeting neuropilin-2 in colorectal carcinoma (32). Although miR-486 has been proved to be closely related to the occurrence and development of various tumors (33), its role in osteosarcoma is not yet clear.In this study, we collected specimens from 40 patients with osteosarcoma. Through the real-time PCR experiments of these osteosarcoma tissues and adjacent tissues, we found that the content of miR-486 in the osteosarcoma tissue was lower than that in the adjacent tissues. Through the analysis, we found that the prognosis of patients with high expression of miR-486 was better than that of patients with low expression of miR-486 (Fig. 1). Also, there was a certain correlation between miR-486 and the grade of osteosarcoma. Then we examined the content of PKC-δ in osteosarcoma that is thought to play an important role in a variety of tumors. The results showed that the expression of PKC-δ in osteosarcoma was higher than that in adjacent tissues, and the survival time of osteosarcomapatients with high expression of PKC-δ was shorter than that with lower expression of PKC-δ. Then we found that the expression of miR-486 and PKC-δ in these patients with osteosarcoma was negatively correlated (Fig. 1). Correlation formula for y=−0.4462x+0.1047 R2=0.0983. Thus we concluded that miR-486 may be involved in the regulation of PKC-δ expression in osteosarcoma. We confirmed our conjecture by luciferase reporter gene experiments, and found that miR-486 could directly act on the 3′-UTR region of PKC-δ and inhibit the activity of PKC. Since miR-486 and PKC-δ play an important role in many kinds of tumors, we tested the effect of miR-486 on PKC-δ at the cellular level. The results indicated that miR-486 could significantly reduce the expression of PKC-δ in osteosarcoma cells, and inhibited the activity of PKC-δ pathway (Fig. 2). After that, we confirmed the effect of miR-486 on the biological function of humanosteosarcoma cells from proliferation, apoptosis and invasion and metastasis (Figs. 3–6). We constructed the miR-486 overexpression and low expression osteosarcoma cell lines, and found that miR-486 can significantly inhibit the proliferation of osteosarcoma cells through MTT. After the western blot and real-time PCR analyses, we proved that miR-486 can inhibit the proliferation of osteosarcoma cells by inhibiting CDK4 and CDK6. As we knew that CDK4 and CDK6 are functional proteins downstream of PKC-δ, we confirmed that miR-486 promoted apoptosis of MG63 cells by detecting apoptosis of MG63 cells which were overexpressed or low expressed of miR-486. Moreover, miR-486 can also regulate the expression of bcl-2 and bax. miR-486 can inhibit the proliferation of osteosarcoma cells by promoting apoptosis of osteosarcoma cells to achieve inhibition of growth of osteosarcoma cells. Next, we examined the effects of miR-486 on the metastasis of MG63 and U2OS cells. The results showed that miR-486 could significantly inhibit the metastasis of osteosarcoma cells. The inhibitory effect of miR-486 on the invasion and migration of osteosarcoma cells was achieved by the inhibition of miR-486 on MMP2. Since these proteins are functional downstream of the PKC-δ pathway, we concluded that the regulation of miR-486 on these proteins is achieved by the inhibition of miR-486 to PKC-δ. Finally, we found that when miR-486 and PKC-δ were co-transfected into osteosarcoma cells, the inhibitory effect of miR-486 on the proliferation and metastasis of osteosarcoma cells was significantly decreased. It was confirmed that miR-486 inhibited the growth and metastasis of osteosarcoma cells by inhibiting the PKC pathway.In conclusion, through a series of experiments, we found that miR-486 was associated with the grading and prognosis of osteosarcoma. miR-486 can inhibit the occurrence and development of osteosarcoma by influencing the expression of PKC to a certain extent. It provides a new theoretical basis for targeted therapy of osteosarcoma.
Authors: Bo Song; Yuan Wang; Matthew A Titmus; Galina Botchkina; Andrea Formentini; Marko Kornmann; Jingfang Ju Journal: Mol Cancer Date: 2010-04-30 Impact factor: 27.401
Authors: G M Viera; K B Salomao; G R de Sousa; M Baroni; L E A Delsin; J A Pezuk; M S Brassesco Journal: Clin Transl Oncol Date: 2019-04-04 Impact factor: 3.405