| Literature DB >> 28335826 |
Katharina Jaksch1,2,3, Luise Kruckenhauser4, Elisabeth Haring4,5, Zoltán Fehér6,7.
Abstract
BACKGROUND: Clausiliidae (door snails) are gastropods with a very high diversity concerning shell morphology, especially of their complex closing apparatus, which provides the most important diagnostic traits for classification of taxa. Due to the high variability, a high number of taxa has been described, though their systematics and taxonomy is partially controversially discussed. Montenegrina is the second most speciose door snail genus in Europe. It is an obligate rock-dwelling land snail and has, compared to its complex systematics, a rather small distribution range in the western parts of the Balkan Peninsula. The different taxa themselves show a very narrow and patchy distribution range. As Montenegrina is comprehensively sampled over the whole distribution range, it is a perfect study system for general questions on speciation and morphological differentiation in land snails. To study the amount of gene flow between geographically close or co-occurring populations, highly polymorphic markers are needed.Entities:
Keywords: Door snail; Microsatellite; Montenegrina; Speciation
Mesh:
Year: 2017 PMID: 28335826 PMCID: PMC5364716 DOI: 10.1186/s13104-017-2462-7
Source DB: PubMed Journal: BMC Res Notes ISSN: 1756-0500
13 Microsatellite loci, primer sequence, repeat motif, primer sets, PCR conditions and accession-numbers
| Locus name | Primer sequence (5′–3′) | Repeat motif | Multiplex reaction | Labelling dye | Primer conc. | TA | Accession-Nr |
|---|---|---|---|---|---|---|---|
| Mont_13187 | F: TGCCTGCAGTGCGTAGAG | CATA | R1 | VIC | 2 | 61/57 | KY094088 |
| R: TATTGATTTCGGACAGGGCG | |||||||
| Mont_13385 | F: GGTAAGCCAATAACGGTGGC | TCTT | R3 | PET | 2 | 58/51 | KY094089 |
| R: ATCTGCAACGCCAGTAAACG | |||||||
| Mont_17419 | F: ATAATGTGGGCAGAACAGGC | CAAA | R2 | 6-FAM | 0.5 | 58/51 | KY094090 |
| R: GTCTTGGGTCGCACAGAATG | |||||||
| Mont_2349 | F: TGACCCGCAGTGATCAAGTC | TTTC | R2 | VIC | 2 | 58/51 | KY094091 |
| R: ATCCTATTTCGGTCCCTGGC | |||||||
| Mont_2916 | F: CGTTGAATGAGTCACGGACG | GAAA | R3 | VIC | 3 | 58/51 | KY094092 |
| R: ACACTTGTAGGCCGTTGTTC | |||||||
| Mont_3056 | F: GAAAGAAGACCCCATTACGCC | AAAG | R1 | 6-FAM | 1 | 61/57 | KY094093 |
| R: ATAGCGCACGTCTTTTGTCC | |||||||
| Mont_3943 | F: CGATGATACAAGCAATGCGG | TCTT | R3 | NED | 2 | 58/51 | KY094094 |
| R: CCATAGCTGCGTGCTTACAG | |||||||
| Mont_4042 | F: AGCTAAAGTATCGTTGTATGGAGG | TCTT | R1 | PET | 2 | 61/57 | KY094095 |
| R: CTCCGAGCATGAGCTTTCTG | |||||||
| Mont_4196 | F: TCAGCCCTGCACAGATAGAC | AAGA | R2 | PET | 2 | 58/51 | KY094096 |
| R: ACCTGGACAGCAGTTCTACG | |||||||
| Mont_4477 | F: GTCTGACACAGGCAGCATAC | TTCT | R2 | 6-FAM | 4 | 58/51 | KY094097 |
| R: CGTTGGTCTCCCGATTTCAC | |||||||
| Mont_5483 | F: ATTCAATGTGCGCAAGTACG | TTTC | R1 | NED | 3 | 61/57 | KY094098 |
| R: TGTCATTGATAGCCCCCTCC | |||||||
| Mont_5717 | F: TATGGCCAACGAAACCAAGC | AATC | R3 | 6-FAM | 2 | 58/51 | KY094099 |
| R: GTTCCGCATGGGACATGATAC | |||||||
| Mont_5741 | F: TGGTATTGAGTGCATAGACGC | GTTT | R3 | 6-FAM | 2 | 58/51 | KY094100 |
| R: CATTCTGGCGGGGATAAAGC |
Primer Conc. primer concentration in pmol; T Annealing temperature (°C), 2-step thermoprofile (hot-start TA/regular TA); Labelling dye DS-33 dye set
Population genetic parameters of 13 microsatellite loci in Montenegrina
| Locus name | N MprP | N MprPE | N MstSV | Size (bp) | Nr. Alleles | He MprP | Ho MprP | HWE MprP | He MprPE | Ho MprPE | HWE MprPE | He MstSV | Ho MstSV | HWE MstSV |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mont_13187 | 15 | 20 | 20 | 272–448 | 11 |
|
| 0.000 | 77.8 | 80 | 0.975 | – | – | – |
| Mont_13385 | 15 | 20 | 20 | 213–227 | 6 | 72.9 | 86.7 | 0.185 | 42.4 | 45 | 0.771 | – | – | – |
| Mont_17419 | 15 | 20 | 20 | 181–267 | 6 | 28.7 | 33.3 | 1.000 |
|
| 0.000 | – | – | – |
| Mont_2349 | 15 | 20 | 20 | 105–253 | 18 | 43.4 | 26.7 | 0.122 | 82.4 | 85 | 0.701 | 81.7 | 85 | 0.628 |
| Mont_2916 | 15 | 20 | 20 | 128–272 | 25 | 81.1 | 60 | 0.003 | 81.3 | 85 | 0.242 |
|
| 0.286 |
| Mont_3056 | 15 | 20 | 20 | 178–360 | 27 | 64.4 | 53.3 | 0.058 |
|
| 0.004 | 85.6 | 85 | 0.514 |
| Mont_3943 | 15 | 20 | 20 | 180–444 | 17 | 80 | 73.3 | 0.069 | 48.8 | 45 | 0.354 | 68.6 | 55 | 0.077 |
| Mont_4042 | 15 | 20 | 20 | 172–496 | 21 | 78.4 | 86.7 | 0.735 |
|
| 0.084 | 65.8 | 80 | 0.751 |
| Mont_4196 | 15 | 20 | 20 | 133–297 | 18 | 81.4 | 80 | 0.282 | 76.9 | 60 | 0.244 |
|
| 0.000 |
| Mont_4477 | 15 | 20 | 20 | 294–506 | 23 |
|
| 0.000 |
|
| 0.000 | 9.7 | 5 | 0.045 |
| Mont_5483 | 15 | 20 | 20 | 128–304 | 17 |
|
| 0.000 |
|
| 0.000 | 53.9 | 45 | 0.409 |
| Mont_5717 | 15 | 20 | 20 | 99–107 | 2 | 0 | 0 | n.v. | 0 | 0 | n.v. | 0 | 0 | n.v. |
| Mont_5741 | 15 | 20 | 20 | 193–223 | 5 | 48 | 60 | 0.577 | 40.9 | 45 | 1.000 | 23.1 | 15 | 0.035 |
N number of individuals per population (Mpr M. d. prespaensis. MprP from Psarades. MprPE from Panagia Eleousa Cave). Size (bp) allele size. H expected Heterozygosity. H observed Heterozygosity. HWE p value for deviation from Hardy–Weinberg equilibrium. n.v. no value; italic numbers indicate potential null alleles