Literature DB >> 28335826

First establishment of microsatellite markers in clausiliid snails (Mollusca: Gastropoda: Clausiliidae).

Katharina Jaksch1,2,3, Luise Kruckenhauser4, Elisabeth Haring4,5, Zoltán Fehér6,7.   

Abstract

BACKGROUND: Clausiliidae (door snails) are gastropods with a very high diversity concerning shell morphology, especially of their complex closing apparatus, which provides the most important diagnostic traits for classification of taxa. Due to the high variability, a high number of taxa has been described, though their systematics and taxonomy is partially controversially discussed. Montenegrina is the second most speciose door snail genus in Europe. It is an obligate rock-dwelling land snail and has, compared to its complex systematics, a rather small distribution range in the western parts of the Balkan Peninsula. The different taxa themselves show a very narrow and patchy distribution range. As Montenegrina is comprehensively sampled over the whole distribution range, it is a perfect study system for general questions on speciation and morphological differentiation in land snails. To study the amount of gene flow between geographically close or co-occurring populations, highly polymorphic markers are needed.
RESULTS: Thirteen microsatellite loci with a tetranucleotid repeat were isolated and tested in three geographically close Montenegrina populations (two populations of M. dofleini prespaensis from the Prespa Lake, n = 35 and one population from M. stankovici from the Ohrid Lake, n = 20). The number of alleles per locus ranged from 2 to 27. No significant linkage disequilibria between the same two loci were found in all three tested populations. The deviation from Hardy-Weinberg equilibrium reveal only for two loci a significant deviation from HWE in more than one population (Mont_5483 and Mont_4477).
CONCLUSION: The 13 newly established genetic markers will help to gain better insights to the population genetic structure of Montenegrina and might reveal new results about speciation processes in co-occurring taxa. Furthermore, these microsatellite loci could also be tested in other clausiliid species.

Entities:  

Keywords:  Door snail; Microsatellite; Montenegrina; Speciation

Mesh:

Year:  2017        PMID: 28335826      PMCID: PMC5364716          DOI: 10.1186/s13104-017-2462-7

Source DB:  PubMed          Journal:  BMC Res Notes        ISSN: 1756-0500


Findings

The gastropod family Clausiliidae (door snails) is one of the most speciose among land snails and is distributed in four continents with diversity hot-spots in southern Europe, southeastern Asia and the northwestern part of South America [1]. Their eponymous closing apparatus shows several morphological structures (clausilium-plate, lunella-complex, lamellae and plicae), which are very important for discriminating taxa within this family. Due to the high morphological variability and the high number of described taxa, systematics and taxonomy is quite complicated and controversial. Although several clausiliid taxa have been intensively studied concerning phylogenetic [2, 3], phylogeographic [4] and even population genetic questions [5], no microsatellite markers have been applied so far in any of the door snail genera. Montenegrina is an obligate rock-dwelling door-snail genus comprising 106 taxa [6], which are morphologically very diverse. It is the second speciose door snail genus in Europe and has, compared to its complex systematics, a rather small distribution range in the western parts of the Balkan Peninsula. The different taxa show very patchy distribution ranges due to low dispersal ability and the insular occurrence of their calcareous rock habitats. Due to this narrow distribution range and well-known occurrences of many populations, a quite comprehensive sampling is possible, which makes Montenegrina a perfect study system for general questions on speciation and morphological diversification of rock-dwelling gastropods. Due to the high morphological variability species delimitation is sometimes challenging in Montenegrina, especially in the case of co-occurring morphotypes. Therefore, estimating the amount of gene flow is crucial. To test for possible gene flow between populations or morphotypes and to get insights into population structure in general, highly polymorphic nuclear genetic markers are needed, which can be applied to a high number of individuals at moderate cost. Therefore, we established 13 microsatellite loci for Montenegrina on the basis of next generation sequencing data and tested them in two species, which occur very close together (about 25 km apart). (1) Montenegrina dofleini prespaensis Nordsieck, 1988 occurs along the western and southern shores of the Prespa Lake (Albania, Greece). For this study we selected specimen from two populations that live in close vicinity: MprP from Psarades (15 specimens) and MprPE from Panagia Eleousa Cave (20 specimens). (2) Montenegrina stankovici (Urbański, 1960) lives along the eastern shore of Lake Ohrid (Macedonia). The studied population MstSV was collected in Sveti Naum (20 specimens). For DNA extraction we used the Qiagen spin column kit (Qiagen DNeasy Blood & Tissue Kit, Germany) and followed the manufacturer’s protocol. Microsatellite markers were established by ecogenics GmbH (Schlieren, Switzerland) based on seven individuals. Size-selected fragments from genomic DNA were enriched for SSR content by using magnetic streptavidin beads and biotin-labeled GTAT, GATA, AAAC and AAAG repeat oligonucleotides. The SSR-enriched library was analysed on an Illumina MiSeq platform using the Nano 2 × 250 v2 format. After assembly, 13,656 contigs or singlets contained a microsatellite insert with a tetra- or a trinucleotide of at least six repeat units or a dinucleotide of at least ten repeat units. Suitable primer design was possible in 2905 microsatellite candidates, of which 36 were positively tested for functionality and polymorphism. This was done with fluorescent labelled M13 tails that were added to the forward primers [7]. The primers for these 36 microsatellite loci were tested for consistency in PCR amplification and finally the 13 best loci were chosen for further testing in a larger set of individuals. Using the software Multiplex Manager 1.2 [8] these primer sets were then combined in three multiplex PCR reactions (Set1/2/3). For conducting multiplex analyses the forward primers were marked with fluorescent dyes. PCR was performed in 10 µl reaction volume using the Qiagen Multiplex-Kit (1 µl DNA, 2.5 µl Qiagen Multiplex PCR Mastermix, 1 µl primer mix, [1 µl Q-Solution in Set2], 5.5 µl AD [4.5 µl AD in Set2]). The two-step PCR profile started with an initial denaturation at 95 °C for 15 min, two cycles denaturation at 94 °C for 30 s, annealing at 61 °C (Set1) and 58 °C (Set2 and 3) for 90 s, extension at 72 °C for 60 s. For the following 35 cycles the same profile was used, except an altered annealing temperature of 58 °C (Set1) and 51 °C (Set2 and 3), respectively, and a final extension at 60 °C for 30 min. Positive PCR products were diluted 1:10 with AD. 1 µl of the PCR dilution was added to 9 µl of a Hi-Di formamide-Size Standard mixture (0.25 µl, Gene Scan 500 LIZ, Applied Biosystems, USA) and denatured at 94 °C for 4 min. The products were then analysed on a 3130xl Sequence Analyzer (Applied Biosystems, USA). The alleles obtained from the electropherograms were identified and binned using the software GENEMAPPER 5.0 (Applied Biosystems, USA) and checked manually. The multiplex PCR conditions for the 13 loci, the repeat motif and the primer sequences as well as the respective GenBank Accession numbers are given in Table 1.
Table 1

13 Microsatellite loci, primer sequence, repeat motif, primer sets, PCR conditions and accession-numbers

Locus namePrimer sequence (5′–3′)Repeat motifMultiplex reactionLabelling dyePrimer conc.TA Accession-Nr
Mont_13187F: TGCCTGCAGTGCGTAGAGCATAR1VIC261/57 KY094088
R: TATTGATTTCGGACAGGGCG
Mont_13385F: GGTAAGCCAATAACGGTGGCTCTTR3PET258/51 KY094089
R: ATCTGCAACGCCAGTAAACG
Mont_17419F: ATAATGTGGGCAGAACAGGCCAAAR26-FAM0.558/51 KY094090
R: GTCTTGGGTCGCACAGAATG
Mont_2349F: TGACCCGCAGTGATCAAGTCTTTCR2VIC258/51 KY094091
R: ATCCTATTTCGGTCCCTGGC
Mont_2916F: CGTTGAATGAGTCACGGACGGAAAR3VIC358/51 KY094092
R: ACACTTGTAGGCCGTTGTTC
Mont_3056F: GAAAGAAGACCCCATTACGCCAAAGR16-FAM161/57 KY094093
R: ATAGCGCACGTCTTTTGTCC
Mont_3943F: CGATGATACAAGCAATGCGGTCTTR3NED258/51 KY094094
R: CCATAGCTGCGTGCTTACAG
Mont_4042F: AGCTAAAGTATCGTTGTATGGAGGTCTTR1PET261/57 KY094095
R: CTCCGAGCATGAGCTTTCTG
Mont_4196F: TCAGCCCTGCACAGATAGACAAGAR2PET258/51 KY094096
R: ACCTGGACAGCAGTTCTACG
Mont_4477F: GTCTGACACAGGCAGCATACTTCTR26-FAM458/51 KY094097
R: CGTTGGTCTCCCGATTTCAC
Mont_5483F: ATTCAATGTGCGCAAGTACGTTTCR1NED361/57 KY094098
R: TGTCATTGATAGCCCCCTCC
Mont_5717F: TATGGCCAACGAAACCAAGCAATCR36-FAM258/51 KY094099
R: GTTCCGCATGGGACATGATAC
Mont_5741F: TGGTATTGAGTGCATAGACGCGTTTR36-FAM258/51 KY094100
R: CATTCTGGCGGGGATAAAGC

Primer Conc. primer concentration in pmol; T Annealing temperature (°C), 2-step thermoprofile (hot-start TA/regular TA); Labelling dye DS-33 dye set

13 Microsatellite loci, primer sequence, repeat motif, primer sets, PCR conditions and accession-numbers Primer Conc. primer concentration in pmol; T Annealing temperature (°C), 2-step thermoprofile (hot-start TA/regular TA); Labelling dye DS-33 dye set In total 55 individuals—35 of M. d. prespaensis and 20 of M. stankovici—were genotyped. For each locus the observed (Ho) and the expected (He) heterozygosity as well as linkage disequilibria and the deviation from Hardy–Weinberg-equilibrium (HWE) was calculated per population in Genepop 4.2 [9] (Table 2). The number of alleles per locus ranged from 2 to 27. No significant linkage disequilibria between the same two loci were found in all three tested populations, two loci pairs show linkage disequilibrium but only in one population (Mont_2349/Mont_4477 in MprPE; Mont_17419/Mont_5483 in MprP). The deviation from the Hardy–Weinberg equilibrium is significant for four loci in MprP, four in MprPE and three in MstSV. However, checking the results per locus in all populations, reveal only in two cases a significant deviation from HWE over two (Mont_5483) or even all three populations (Mont_4477). The high deficiency of heterozygotes over several loci has already been reported in other gastropod species and could be due to self-fertilization or the patchy distribution leading to drift effects due to restricted gene flow, single loci could be affected by allele scoring artefacts or the presence of null alleles [10]. Thus, the potential presence of null alleles was tested using MICRO-CHECKER 2.2.3 [11]. The results revealed three potential null alleles in the MprP population five in the MprPE population and two in the MstSV population. The loci Mont_4477 and Mont_5483 have potential null alleles in the MprP and in the MprPE population. However, in MstSV these loci give no hint for null alleles and were therefore not excluded from the analysis. At the locus Mont_5717 only one allele per population was found, yet in preliminary tests with other Montenegrina species, further alleles are found at this locus. Consequently, the 13 microsatellite markers are suitable for population genetic studies in the rock-dwelling land snail genus Montenegrina.
Table 2

Population genetic parameters of 13 microsatellite loci in Montenegrina

Locus nameN MprPN MprPEN MstSVSize (bp)Nr. AllelesHe MprPHo MprPHWE MprPHe MprPEHo MprPEHWE MprPEHe MstSVHo MstSVHWE MstSV
Mont_13187152020272–44811 64.7 26.7 0.00077.8800.975
Mont_13385152020213–227672.986.70.18542.4450.771
Mont_17419152020181–267628.733.31.000 65 20 0.000
Mont_2349152020105–2531843.426.70.12282.4850.70181.7850.628
Mont_2916152020128–2722581.1600.00381.3850.242 82.7 60 0.286
Mont_3056152020178–3602764.453.30.058 88.8 60 0.00485.6850.514
Mont_3943152020180–444178073.30.06948.8450.35468.6550.077
Mont_4042152020172–4962178.486.70.735 79.2 55 0.08465.8800.751
Mont_4196152020133–2971881.4800.28276.9600.244 70.3 30 0.000
Mont_4477152020294–50623 84.7 40 0.000 91.7 55 0.0009.750.045
Mont_5483152020128–30417 52.3 20 0.000 58.6 20 0.00053.9450.409
Mont_571715202099–107200n.v.00n.v.00n.v.
Mont_5741152020193–223548600.57740.9451.00023.1150.035

N number of individuals per population (Mpr M. d. prespaensis. MprP from Psarades. MprPE from Panagia Eleousa Cave). Size (bp) allele size. H expected Heterozygosity. H observed Heterozygosity. HWE p value for deviation from Hardy–Weinberg equilibrium. n.v. no value; italic numbers indicate potential null alleles

Population genetic parameters of 13 microsatellite loci in Montenegrina N number of individuals per population (Mpr M. d. prespaensis. MprP from Psarades. MprPE from Panagia Eleousa Cave). Size (bp) allele size. H expected Heterozygosity. H observed Heterozygosity. HWE p value for deviation from Hardy–Weinberg equilibrium. n.v. no value; italic numbers indicate potential null alleles The newly established genetic markers will be useful in many further investigations within Montenegrina. We expect to test gene flow between syntopically occurring congeners, as well as among parapatric and allopatric populations of conspecific taxa. We hope that this will promote the better understanding of speciation patterns and speciation processes in obligate rock-dwelling gastropods. Furthermore, they could also be tested in other clausiliid species.
  6 in total

1.  An economic method for the fluorescent labeling of PCR fragments.

Authors:  M Schuelke
Journal:  Nat Biotechnol       Date:  2000-02       Impact factor: 54.908

2.  Survival and differentiation of subspecies of the land snail Charpentieria itala in mountain refuges in the Southern Alps.

Authors:  Bettina M Scheel; Bernhard Hausdorf
Journal:  Mol Ecol       Date:  2012-05-31       Impact factor: 6.185

3.  genepop'007: a complete re-implementation of the genepop software for Windows and Linux.

Authors:  François Rousset
Journal:  Mol Ecol Resour       Date:  2008-01       Impact factor: 7.090

4.  Multiplex Manager 1.0: a cross-platform computer program that plans and optimizes multiplex PCR.

Authors:  Clare E Holleley; Paul G Geerts
Journal:  Biotechniques       Date:  2009-06       Impact factor: 1.993

5.  Phylogeny of the land snail family Clausiliidae (Gastropoda: Pulmonata).

Authors:  Dennis R Uit de Weerd; Edmund Gittenberger
Journal:  Mol Phylogenet Evol       Date:  2013-01-26       Impact factor: 4.286

6.  Taxonomic revision of the rock-dwelling door snail genus Montenegrina Boettger, 1877 (Mollusca, Gastropoda, Clausiliidae).

Authors:  Zoltán Fehér; Miklós Szekeres
Journal:  Zookeys       Date:  2016-06-16       Impact factor: 1.546

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.