Literature DB >> 28332309

Effects of miR-145-5p through NRAS on the cell proliferation, apoptosis, migration, and invasion in melanoma by inhibiting MAPK and PI3K/AKT pathways.

Sha Liu1,2, Guozhen Gao2, Dexiong Yan2, Xiangjun Chen2, Xingwei Yao2, Shuzhong Guo1, Guirong Li3, Yu Zhao4.   

Abstract

We aimed to detect the effects of miR-145-5p on the cell proliferation, apoptosis, migration, and invasion in NRAS-mutant, BRAF-mutant, and wild-type melanoma cells, in order to figure out the potential mechanisms and provide a novel therapeutic target of melanoma. RT-qPCR and western blot were used to detect the expression of miR-145-5p and NRAS in melanoma tumor tissues and cells, respectively. Luciferase assay was performed to determine whether miR-145-5p directly targeted NRAS. After transfecting miR-145-5p mimics, miR-145-5p inhibitors, NRAS cDNA and NRAS siRNA into CHL-1, VMM917 and SK-mel-28 cells, functional assays were used to detect the proliferation, apoptosis, invasion and migration, including MTT, flow cytometry, Transwell and wound healing assays. In addition, xenograft models in nude mice were also conducted to verify the role of miR-145-5p in vivo. MiR-145-5p was able to suppress proliferation, invasion, and migration of VMM917 and CHL-1 cells and induce apoptosis by inhibiting MAPK and PI3K/AKT pathways. However, aberrant expression of miR-145-5p and NRAS has little impact on the viability and metastasis of BRAF-mutant melanoma. The higher expression of miR-145-5p in xenograft models repressed the VMM917-induced and CHL-1-induced tumor growth observably and has little effect on SK-mel-28-induced tumor growth which was consistent with the results in vitro. Through targeting NRAS, miR-145-5p could suppress cell proliferation, invasion, and migration and induce apoptosis of CHL-1 and VMM917 melanoma cells by inhibiting MAPK and PI3K/AKT pathways.
© 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Entities:  

Keywords:  zzm321990MAPKzzm321990; zzm321990NRASzzm321990; melanoma; miR-145-5p

Mesh:

Substances:

Year:  2017        PMID: 28332309      PMCID: PMC5387172          DOI: 10.1002/cam4.1030

Source DB:  PubMed          Journal:  Cancer Med        ISSN: 2045-7634            Impact factor:   4.711


Introduction

Melanoma is one of the most aggressive malignant tumors and causes most skin cancer‐related deaths worldwide 1, 2. The incidence of melanoma has grown rapidly in the past few decades, there is estimated to be 76380 new cases for melanoma in United States in 2016 3. The major risk factors of developing melanoma include ultraviolet exposure and fair feature like light hair, skin, and eye color 4. Currently, although the early‐stage melanoma could be treated with surgery effectively, the widespread metastatic potential and high‐resistance to most treatments of advanced tumors made the prognosis of melanoma remain poor 5. The median survival time of metastatic melanoma was 8–9 months and 3‐year survival rate was estimated <15% 6. BRAF, a member of the RAF kinase family of growth signal transduction protein kinase and NRAS, a member of the RAS superfamily of GTPases, were both upstream factors of MAPK (RAS/RAF/MEK/ERK) pathway which has been widely reported as an important role in controlling diverse biological functions including cell proliferation, differentiation, survival, and death 7. According to previous reports, activating mutations in BRAF and NRAS are the first which occur in 40–60% and second most common mutations in melanomas, respectively 8, 9. Both BRAF and NRAS mutations appear to confer a worse prognosis in the metastatic setting and cause more limitation in therapy compared with tumors without known driver mutations (WT) 10, 11, 12. In addition, NRAS directly stimulates phosphatidylinositol 3‐kinase (PI3K) and impacts PI3K/AKT pathways which also take charge of the cardinal signaling transduction and regulation for cellular process and played an important role in melanoma 13. Influencing each other in multiple intersection points, MAPK and PI3K/AKT pathways expressed positively or negatively at the same time suggesting a complex cross‐talk 13. In order to suppress the growth and improve angiogenesis of malignancy tumor, the two pathways should be specifically investigated as specific therapeutic targets 14. So far, various inhibitor combinations have shown preclinical efficiency and are currently being evaluated in trials, but the outcomes are only modest and the combinations are limited for serious adverse events 15, 16. MicroRNAs have emerged as critical mediators in cellular process through regulating gene expression 17. Growing evidences suggested that the small noncoding RNAs could affect the melanoma tumor development and metastasis via different mechanisms. For instance, Zhou et al. found that miR‐33a could suppress melanoma by targeting HIF‐1α 18. Ren et al. claimed that miR‐135 posttranscriptionally regulated FOX01 to promote the proliferation of malignant melanoma cells 19. Zehavi et al. presented that silencing of miR‐377 would unleash NF‐kB pathways through MAP3K7 thus promoting the metastatic potential and tumorigenic of melanoma cells 20. Recently, miR‐145(5p) was investigated as an efficient suppressor of malignant melanoma and the cellular mechanism has been illustrated differently in previous reports 21, 22. Li et al. demonstrated that miR‐145(5p) was downregulated in uveal melanoma (UM) cells and inhibited UM growth through regulating the expression of IRS‐1 23. However, according to our investigation, there has not been any report that explores the potential relationship between miR‐145‐5p and MAPK or PI3K/AKT pathway in wild‐type, NRAS‐mutant or BRAF‐mutant melanoma. In this study, we aimed to explore the antitumor effects of miR‐145‐5p and related mechanism in NRAS‐mutant, BRAF‐mutant, or wild‐type melanoma. We analyzed the relationship between the miR‐145‐5p expression and clinic pathological factors of melanoma. By dual luciferase experiment we confirmed NRAS as a target of miR‐145‐5p. By manipulating the expression of miR‐145‐5p and NRAS in VMM917, SK‐mel‐28, and CHL‐1, we verified the antitumor role of miR‐145‐5p and its suppressing impact on both MAPK and PI3K/AKT pathways in CHL‐1 and VMM917 cells which indicated that miR‐145‐5p might be one of the cross‐talk points among two pathways. Finally, we established a tumor xenograft model in BALB/c‐nude mice and confirmed the tumor‐suppressive role of miR‐145‐5p in NRAS‐mutant and wild‐type melanoma in vivo. Therefore, our results demonstrated the aberrant expression of miR‐145‐5p in NRAS‐mutant and wild‐type melanomas which correlated with MAPK and PI3K/AKT pathways and provided novel target for the therapy of NRAS‐mutant and wild‐type melanomas.

Materials and Methods

Patients

The melanoma tumor tissues and matched adjacent tissues were obtained from 83 patients (46 males and 37 females) aged from 24 to 72. These patients were admitted to the Fourth People's Hospital of Shaanxi Province and Xijing Hospital of Fourth Military Medical University from June, 2014 to March, 2016 on informed consent and approval by the local ethical committee. No patients included in this study had received any radiotherapy or chemotherapy before the surgery. The samples were frozen immediately and stored at −80°C. The study was approved by the ethics committee of the 253rd Hospital of PLA and all patients provided written informed consent.

RT‐qPCR

Total RNAs were extracted from cell lines or tissues using TRIzol (Invitrogen, Carlsbad, CA). RNA was subjected to reverse transcription using the reagent kit (Promega,Madison,WI). The quantitative test kit (Invitrogen) was used for RT‐qPCR. The primers used in the study were designed, synthetized, and purified by Shanghai Genechem Co. Ltd. Primer sequences were listed in Table 1. All the procedures were in strict accordance with the manufacturer's instruction. Relative expression of miRNA was normalized against U6 snRNA, whereas mRNA was normalized against GAPDH.
Table 1

Primers used in reverse transcription‐polymerase chain reaction

cDNAForward primerReverse primer
MiR‐145‐3pGTCCAGTTTTCCCAGGAATCCCTTGGTGTCGTGGAGTCG
U6CTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT
KRASCCCAGGTTCAAGCGATTCTCGAGTGTAGTGCACACGCCTGTAA
GAPDHTGTGGGCATCAATGGATTTGGACACCATGTATTCCGGGTCAA

KRAS, kirsten rat sarcoma viral oncogene.

Primers used in reverse transcription‐polymerase chain reaction KRAS, kirsten rat sarcoma viral oncogene.

Mutation analysis

Mutations in the tissues were determined as it has been described before 24. Total DNA was extracted using proteinase K treatment followed by affinity‐purification using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) according to manufacturer's instructions and the concentration of the DNA samples was measured by NanoDrop ND‐1000(Thermo scientific, Wilmington, DE). Genomic DNA (20–100 ng) was amplified in a reaction volume of 25 μL containing 12.5 μL AmpliTaq Gold® 360 PCR Master Mix (Applied Biosystems, Foster City, CA). Primer sequences used are listed in Table 2. The PCR products were purified using Multiscreen‐HTS PCF Filter Plates (Merck, NJ) and then analyzed using ABI PRISM 3700 DNA analyzer (LifeTechnologies, Foster City, CA).
Table 2

Clinicopathological characteristics of miR‐145‐5p and NRAS levels (n = 83)

VariationMiR‐145‐5p levels P valuea NRAS levels P valuea
Low n (%)High n (%)Low n (%)High n (%)
Age0.5910.716
≥6015 (18.1)17 (20.5)17 (20.5)15 (18.1)
<6027 (32.5)24 (28.9)25 (30.1)26 (31.3)
Gender0.4470.573
Female17 (20.5)20 (24.1)20 (24.1)17 (20.5)
Male25 (30.1)21 (25.3)22 (26.5)24 (28.9)
Tumor thickness <0.001 < 0.001
≥4 mm29 (34.9)10 (12.1)9 (10.8)30 (36.1)
<4 mm13 (15.7)31 (37.3)33 (39.8)11 (13.3)
NRAS mutation 0.046 0.126
Mutant19 (22.9)10 (12.1)18 (21.7)11 (13.3)
Wild type23 (27.7)31 (37.3)24 (28.9)30 (36.1)
BRAF mutation0.7540.284
Mutant16 (19.3)17 (20.5)18 (21.7)15 (18.1)
Wild type26 (31.3)24 (28.9)24 (28.9)26 (31.3)
Tumor stage 0.021 0.012
I+II17 (20.5)27 (32.5)28 (33.7)16 (19.3)
III+IV25 (30.1)14 (16.9)14 (16.9)25 (30.1)

NRAS, neuroblastoma RAS viral [V‐ras] oncogene homolog; BRAF, V‐raf murine sarcoma viral oncogene homolog B1. Bold values if statistically significant (P < 0.05).

Chi‐square test.

Clinicopathological characteristics of miR‐145‐5p and NRAS levels (n = 83) NRAS, neuroblastoma RAS viral [V‐ras] oncogene homolog; BRAF, V‐raf murine sarcoma viral oncogene homolog B1. Bold values if statistically significant (P < 0.05). Chi‐square test.

Cell culture and transfection

HEK293T cell line was purchased from Culture Collection of the Chinese Academy of Sciences, and human malignant melanoma cell lines SK‐mel‐28 (BRAF V600E mutation), CHL‐1 (Wild type), VMM917 (NRAS mutation) and normal human epidermal melanocytes (NHEMs) from BeNa Culture Collection. The STR profiles of these cells were authenticated at Gegene Tech, Shanghai. All the cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with 15% fetal bovine serum (FBS) and 1% antibiotic and antimycotic solution at 37°C in an incubator (95% humidity, 5% CO2). MiR‐145‐5p mimics, miR‐145‐5p inhibitor, mimics control, NRAS cDNA, and NRAS siRNA were synthesized by Genepharma Inc. China. After genomic PCR amplification, they were, respectively, cloned into pCDH‐CMV‐MCS‐EF1‐copGFP (System Biosciences, Mountain View, CA) and verified by DNA sequencing. Recombinant lentiviruses were produced by transient transfection of HEK293T cells, along with package vectors, using Lipofectamine 2000 (Invitrogen). After transfection for 48 h, the viruses were harvested and viral titers were determined. Then, CHL‐1, VMM917, and SK‐mel‐28 cells were infected with lentiviruses at the multiplicity of infection (MOI) of 15, in the presence of 4 μg/mL polybrene (Sigma, St Louis, MO), followed by puromycin selection (2 μg/mL). 48 h after infection, the cells were, respectively, sorted by flow cytometry and the efficiency was measured using RT‐qPCR.

Dual luciferase reporter gene assay

XL Site‐directed Mutagenesis Kit (Qiagen, Germany) was used to construct the mutated 3' UTR of NRAS which did not contain the binding sites of miR‐145‐5p. The normal or mutant 3' UTR sequences of NRAS were inserted into psiCHECK‐2 luciferase vectors (Promega), respectively. After successfully constructed, the Luc‐NRAS and Luc‐NRAS‐mut vectors were transected to the 293T cells together with miR‐145‐5p mimics or mimics control (diagnosed as NC group) using liposome 2000 kit (Invitrogen). The relative luciferase activities were measured using Dual‐Luciferase Reporter Assay Kit (Promega) in strict accordance with the manufacturer's instructions.

Western blot

Proteins were extracted from samples using RIPA Kit (Beyotime Biotechnology, China). The protein concentration was quantified using Bradford method. Proteins were separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS‐PAGE) and thereafter transferred to PVDF membrane which was blocked in Tris‐Buffered Saline Tween (TBST) containing 0.1%Tween‐20 and 5% low‐fat milk for 1 h. The primary antibody was added and incubated overnight at 4°C and then the secondary antibodies were added and incubated at room temperature for 1 h. Lastly, the ECL solution was applied to the membranes, and the membranes together with a film were placed in a visualizer for further analysis. The ImageJ software was used to measure the intensities. Primary antibodies for NRAS (ab154291), BRAF (ab151286), MEK1/2 (ab178886), pMEK1/2 (phospho s218, s222 and s226, ab78132), ERK1/2 (ab17942), pERK1/2 (phospho thr202 and thr204, ab214362), and GAPDH (ab9485) were all purchased from Abcam, whereas antibodies for PI3K‐p110α (#4249), PI3K‐p110β (#3011s), AKT (#9272), pAKT‐ser473 (#4060), pAKT‐thr308 (#2965), PTEN (#4005), Cyclin D1 (#2926), and p27 (#3686) were purchased from Cell Signaling. HRP labeled goat anti‐mouse and goat anti‐rabbit as secondary antibodies were purchased from Beyotime Biotechnology.

MTT assay

Twenty‐four hours after transfection, cells collected at logarithmic phase were seeded in 96‐well plates (5 × 103 cells per well) and incubated for 24–72 h after transfection, then 10 μL MTT solutions (10 mg/mL) were added to each well. After 4 h of incubation, 100 μL DMSO was added to dissolve the MTT. The optical density (OD) was measured at 570 nm after oscillated for 10 min at room temperature.

Cell apoptosis assay

Forty‐eight hours after transfection, Cell apoptosis was assessed using Annexin V‐FITC apoptosis detection kit (BD Pharmingen, CA). The cells were washed twice with PBS and resuspended in 1 × Binding Buffer at a concentration of 1 × 106 cells/mL. 100 μL cell suspension was incubated with 5 μL Annexin V‐FITC in the dark for 15 min at room temperature. The samples were analyzed on the flow cytometer after the addition of 400 μL of 1 × Binding Buffer.

Wound healing assay

Twenty‐four hours after transfection, cell samples collected at logarithmic phase were seeded in a 6‐well plate (2 × 105 cells per well) and incubated overnight. Sterile pipette tips (200 μL) were used to scratch a straight line on the surface of each cell culture in each well when cells grew to 80–90% confluence. The cells were washed by PBS for three times. Inverted microscope was used to observe the closure of scratches in different groups at time points 0 and 24 after incubation.

Transwell assay

At 24 h posttransfection in the 6‐well plate, cells in the logarithmic phase were digested into single cell suspension and incubated in the DMEM without FBS. The microporous membrane of Transwell chamber was coated with 20 μL artificial Matrigel (BD Biosciences, San Jose, CA, 0.5 g/L) and incubated at 37°C for 30 min until gelatinous. The lower chamber was filled with RPMI‐1640 supplemented with 10% FBS, whereas the upper chamber was filled with 200 μL cell suspension. After 36 h' incubation, the cells on the surface of the upper chamber were removed using cotton swabs. The membrane was then fixed using 4% paraformaldehyde and stained with 0.1% crystal violet. The lower surface of the membrane was photographed and the cell number on the lower surface was counted. The experiments in each group were repeated 3 times.

In vivo tumor growth assay

Thirty‐six 4‐week‐old male BALB/c nude mice weighted 16–18 g were purchased from laboratory animal center of Southern Medical University. The tumor growth models were constructed by injecting either CHL‐1, WMM917, or SK‐mel‐28 cell suspensions (3 × 106 cells) to the subcutaneous tissues of back of each mouse's neck (6 mice in each group). A week after cell injection, all the tumors were intratumorally injected with miR‐145‐5p mimics or mimics control (2 mice in each group, 1 × 108 units per mouse and twice a week for 2 weeks). The tumor volume was measured every two days and calculated as Volume = (D × d2)/2 (D represents the maximal diameter, d represents the minimal one). The mice were sacrificed 3 weeks after cell injection and all experiments were in accordance with the Guidelines for the Care and Use of Laboratory Animals, Ministry of Science and Technology, China. This study was approved by the Animal Care and Scientific Committee of the Fourth People's Hospital of Shaanxi Province and Xijing Hospital of Fourth Military Medical University.

Statistical analysis

All statistical analyses were performed with SPSS 21.0 program (SPSS Inc, USA). All measurement data were represented as the means ± standard deviation (SD). The differences between groups were analyzed using Student's t test (only two groups) or one‐way ANOVA (more than two groups). P < 0.05 was considered statistically significant.

Results

Aberrant expression of miR‐145‐5p and NRAS in both melanoma tumor tissues and cells

The expression of miR‐145‐5p and NRAS in both tumorous and adjacent tissue specimens from 83 patients were measured using RT‐qPCR. The miR‐145‐5p levels in melanoma tissues were lower than those in the matched adjacent normal tissues (P < 0.01, Fig. 1A). Inversely, the NRAS levels in melanoma tissues were higher than those in the matched adjacent normal tissues (P < 0.01, Fig. 1B). In addition, a negative correlation between miR‐145‐5p and NRAS was observed in melanoma tissues (P < 0.01, r 2 = 0.458, Fig. 1C). Then miR‐145‐5p and NRAS expression levels were evaluated in three melanoma cell lines including CHL‐1 (wild type), VMM917 (NRAS mutation), and SK‐mel‐28 (BRAF mutation), and normalized to normal human epidermal melanocytes (NHEMs), all the melanoma cell lines showed significantly lower levels of miR‐145‐5p with concurrent higher levels of NRAS (P < 0.01, Fig. 1D).
Figure 1

The expressions of miR‐145‐5p and NRAS mRNA in melanoma tumor tissues and cells. (A–B) Box‐whisker plots of relative miR‐145‐5p (A) and NRAS mRNA (B) expression in melanoma clinical specimens were determined by RT‐qPCR, respectively (bold lines represent median value). **P < 0.001 compared with expression in adjacent tissues. (C) Correlation of the expression levels of miR‐145‐5p and NRAS mRNA in melanoma tumor tissues. (D) Relative expression levels of miR‐145‐5p and NRAS mRNA in normal human epidermal melanocytes (NHEMs), and three melanoma cell lines (CHL‐1, VMM917, and SK‐mel‐28) were determined by RT‐qPCR. All data were presented as mean ± SD from three independent experiments. **P < 0.001 compared with miR‐145‐5p expression in NHEMs, ## P < 0.001 compared with NRAS expression in NHEMs. NHEMs, normal human epidermal melanocytes.

The expressions of miR‐145‐5p and NRAS mRNA in melanoma tumor tissues and cells. (A–B) Box‐whisker plots of relative miR‐145‐5p (A) and NRAS mRNA (B) expression in melanoma clinical specimens were determined by RT‐qPCR, respectively (bold lines represent median value). **P < 0.001 compared with expression in adjacent tissues. (C) Correlation of the expression levels of miR‐145‐5p and NRAS mRNA in melanoma tumor tissues. (D) Relative expression levels of miR‐145‐5p and NRAS mRNA in normal human epidermal melanocytes (NHEMs), and three melanoma cell lines (CHL‐1, VMM917, and SK‐mel‐28) were determined by RT‐qPCR. All data were presented as mean ± SD from three independent experiments. **P < 0.001 compared with miR‐145‐5p expression in NHEMs, ## P < 0.001 compared with NRAS expression in NHEMs. NHEMs, normal human epidermal melanocytes. Then the melanoma patients were divided into two groups according to the median value of relative miR‐145‐5p or NRAS expression level. The relationship between clinicopathological characteristics and miR‐145‐5p level or NRAS level was shown in Table 2. Chi‐square analysis revealed that miR‐145‐5p levels had little correlation with patients' age, gender, BRAF mutation but were significantly associated with tumor thickness, NRAS mutation, and tumor stage (P < 0.05). And the enhancive NRAS expression levels were also correlated inversely with increased tumor thickness and more severe tumor stage (P < 0.05). All these suggested a close connection among miR‐145‐5p, NRAS, and melanomas.

MiR‐145‐5p directly targeted NRAS and suppressed the expression of NRAS in melanoma cells

In order to explore whether NRAS expression was affected by miR‐145‐5p, we transfected miR‐145‐5p mimics, miR‐145‐5p inhibitor, and mimics control, respectively, into CHL‐1, VMM917, and SK‐mel‐28 cells. Forty‐eight hours after lentivirus infection, miR‐145‐5p expression measured by RT‐qPCR was reduced by the miR‐145‐5p inhibitor lentivirus (in miR inhibitor group) with a variable knock‐down efficiency compared with cells infected by mimics control lentivirus (in NC group) or cells without any treatment (in empty group) and remarkably enhanced by the miR‐145‐5p mimics (in miR mimics group) in all cell lines (Fig. 2A). Meanwhile, it was found that expression of NRAS was significantly downregulated by overexpression of miR‐145‐5p in miR mimics group and upregulated by miR‐145‐5p inhibitor in miR inhibitor group compared with NC groups in CHL‐1, VMM917, and SK‐mel‐28 (P < 0.05,Fig. 2B).
Figure 2

MiR‐145‐5p directly targeted the 3'‐UTR of NRAS. (A) Human melanoma CHL‐1, VMM917, and SK‐mel‐28 cells were transfected with negative control, miR‐145‐5p mimics, and miR‐145‐5p inhibitor to manipulate the level of miR‐145‐5p. 48 h after infection and sorting, the transfection efficiency was examined by RT‐qPCR. (B) After transfection, the effect of miR‐145‐5p on NRAS expression was measured by RT‐qPCR. (C) Putative miR‐145‐5p complementary site in the 3'‐UTR of NRAS mRNA was shown. A mutated 3'‐UTR of NRAS mRNA for the miR‐145‐5p complementary site was generated. (D) HEK293T cells overexpressing miR‐145‐5p or negative control were cotransfected with luciferase reporter plasmid with either WT or MUT and luciferase reporter. 48 h later, luciferase activity was measured and luciferase activity was used as an internal reference. All data were presented as mean ± SD from three independent experiments. a,b,c P < 0.05 compared with empty group in CHL‐1, VMM917 and SK‐mel‐28 cells, respectively. d,e,f P < 0.05 compared with NC group in CHL‐1, VMM917, and SK‐mel‐28 cells, respectively. **P < 0.001 compared with NC group.

MiR‐145‐5p directly targeted the 3'‐UTR of NRAS. (A) Human melanoma CHL‐1, VMM917, and SK‐mel‐28 cells were transfected with negative control, miR‐145‐5p mimics, and miR‐145‐5p inhibitor to manipulate the level of miR‐145‐5p. 48 h after infection and sorting, the transfection efficiency was examined by RT‐qPCR. (B) After transfection, the effect of miR‐145‐5p on NRAS expression was measured by RT‐qPCR. (C) Putative miR‐145‐5p complementary site in the 3'‐UTR of NRAS mRNA was shown. A mutated 3'‐UTR of NRAS mRNA for the miR‐145‐5p complementary site was generated. (D) HEK293T cells overexpressing miR‐145‐5p or negative control were cotransfected with luciferase reporter plasmid with either WT or MUT and luciferase reporter. 48 h later, luciferase activity was measured and luciferase activity was used as an internal reference. All data were presented as mean ± SD from three independent experiments. a,b,c P < 0.05 compared with empty group in CHL‐1, VMM917 and SK‐mel‐28 cells, respectively. d,e,f P < 0.05 compared with NC group in CHL‐1, VMM917, and SK‐mel‐28 cells, respectively. **P < 0.001 compared with NC group. Next, we carried out dual luciferase reporter gene assay and verified the direct relationship between miR‐145‐5p and NRAS. The binding site in 3' UTR sequence of NRAS and the sequence of NRAS mutant were shown in Figure 2C. As shown in Figure 2D, the luciferase activity was significantly decreased in HEK293T cells cotransfected with miR‐145‐5p mimics and Luc‐NRAS vectors than NC group (P < 0.05). There was no difference in cells cotransfected with miR‐145‐5p mimics and Luc‐NRAS‐mut vectors compared with NC group (P > 0.05).

MiR‐145‐5p functions as a tumor suppressor in CHL‐1 and VMM917 melanoma cells

As previously described (Fig. 2A), the level of miR‐145‐5p was higher in miR mimics groups and lower in miR inhibitor groups compared with NC groups and empty groups in CHL‐1, VMM917, and SK‐mel‐28 cells. MTT assay was performed to investigate the role of miR‐145‐5p on melanoma cells' viability, OD values measured at 570 nm positively correlated with cell numbers. As shown in Figure 3A, overexpression of miR‐145‐5p significantly suppressed cell proliferation, whereas miR‐145‐5p knockdown enhanced the proliferation of CHL‐1 and VMM917 cells (P < 0.05). However, the changing expression of miR‐145‐5p had little impact on the proliferation of SK‐mel‐28 (P > 0.05), which suggested a resistance mechanism against miR‐145‐5p expression in SK‐mel‐28 cells. Furthermore, miR‐145‐5p overexpression resulted in increased population of apoptotic cells of CHL‐1 and VMM917, whereas miR‐145‐5p knockdown led to decrease in apoptosis of CHL‐1 and VMM917 (P < 0.05, Fig. 3B). Still no significant changes about apoptosis rate in SK‐mel‐28 could be observed (P > 0.05). The role of miR‐145‐5p in migration and invasion was also measured with wound healing assay and Transwell assay, respectively. As shown in Figure 3C–D, miR‐145‐5p mimics was able to significantly suppress the migration and invasion of CHL‐1 and VMM917 cells and downregulation of miR‐145‐5p significantly increased the number of migratory and invasive cells. However, different levels of miR‐145‐5p did not affect the migration or invasion of SK‐mel‐28 cells. Collectively, these results provided sufficient experimental evidences that miR‐145‐5p functioned as a tumor suppressor in wild‐type and NRAS‐mutant melanoma cells.
Figure 3

MiR‐145‐5p functions as a tumor suppressor in CHL‐1 and VMM917 melanoma cells. (A) After incubation with MTT, OD values of CHL‐1, VMM917, and SK‐mel‐28 cells were plotted against time series to determine the amount of MTT formazan. MiR‐145‐5p mimics repressed the cell proliferation in CHL‐1 and VMM917 cells, whereas the miR‐145‐5p inhibitor promoted. (B) Annexin V staining and Flow cytometry sorting was performed to detect the cell apoptosis rate of indicated cell lines. (C) Wound healing assay was used to detect migration of indicated cell lines. D Transwell assay was used to detect invasion of indicated cell lines. All data were presented as mean ± SD from three independent experiments. a P < 0.05 compared with empty group in CHL‐1 cells, b P < 0.05 compared with NC group in CHL‐1 cells, c P < 0.05 compared with empty group in VMM917 cells, d P < 0.05 compared with NC groups in VMM917 cells.

MiR‐145‐5p functions as a tumor suppressor in CHL‐1 and VMM917 melanoma cells. (A) After incubation with MTT, OD values of CHL‐1, VMM917, and SK‐mel‐28 cells were plotted against time series to determine the amount of MTT formazan. MiR‐145‐5p mimics repressed the cell proliferation in CHL‐1 and VMM917 cells, whereas the miR‐145‐5p inhibitor promoted. (B) Annexin V staining and Flow cytometry sorting was performed to detect the cell apoptosis rate of indicated cell lines. (C) Wound healing assay was used to detect migration of indicated cell lines. D Transwell assay was used to detect invasion of indicated cell lines. All data were presented as mean ± SD from three independent experiments. a P < 0.05 compared with empty group in CHL‐1 cells, b P < 0.05 compared with NC group in CHL‐1 cells, c P < 0.05 compared with empty group in VMM917 cells, d P < 0.05 compared with NC groups in VMM917 cells.

The antitumor effect of miR‐145‐5p in CHL‐1 and VMM917 melanoma cells is mediated by NRAS

To verify the effect of NRAS on the antitumor effect of miR‐145‐5p in both CHL‐1 and VMM917 cells, the expression of NRAS was manipulated using plasmid overexpressing NRAS or containing NRAS siRNA. Both CHL‐1 and VMM917 cells were randomly divided into five groups: negative control group (NC group, transfected with mimics control), miR mimics group (transfected with miR‐145‐5p mimics), miR inhibitor group (transfected with miR‐145‐5p inhibitor), mimics+NRAS group(cotransfected with miR‐145‐5p mimics and NRAS cDNA) and inhibitor+siNRAS group (cotransfected with miR‐145‐5p inhibitor and NRAS siRNA). Measured by RT‐qPCR, the expression of NRAS was effectively upregulated by NRAS and downregulated by siNRAS compared with miR mimics or miR inhibitor groups, respectively (P < 0.05, Fig. 4A). Next, the effect of NRAS knockdown or NRAS overexpression in CHL‐1 and VMM917 cells was examined using the methods described previously. As shown in Figure 4B–E, the promoting effect of miR‐145‐5p inhibitor on proliferation, migration, and invasion as well as the suppressing effect of miR‐145‐5p inhibitor on apoptosis was almost completely abrogated by NRAS siRNA. In addition, the ectopic overexpression of NRAS significantly attenuated the suppression of cell viability, proliferation, migration, and invasion, and enhanced apoptosis of CHL‐1 and VMM917 induced by miR‐145‐5p mimics. Taken together, the antitumor effects of miR‐145‐5p in CHL‐1 and VNN917 was effectively mediated by NRAS.
Figure 4

The antitumor effect of miR‐145‐5p in CHL‐1and VMM917 melanoma cells is mediated by NRAS. By cotransfecting NRAS cRNA with miR‐145‐5p mimics or NRAS siRNA with miR‐145‐5p inhibitor into CHL‐1 and VMM917 cells, the expression of NRAS was manipulated and the effects of NRAS expression on CHL‐1 and VMM917 cells were detected. (A) 48 hours after infection and sorting, the expression level of NRAS was measured using RT‐qPCR. (B) MTT assay was performed to detect the proliferation of indicated cell lines. (C) Annexin V staining and Flow cytometry sorting was performed to detect the cell apoptosis rate of indicated cell lines. (D) Wound healing assay was used to detect migration of indicated cell lines. (E) Transwell assay was used to detect invasion of indicated cell lines. All data were presented as mean ± SD from three independent experiments. a,b,c P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in CHL‐1 cells, respectively. d,e,f P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in VMM917 cells, respectively.

The antitumor effect of miR‐145‐5p in CHL‐1and VMM917 melanoma cells is mediated by NRAS. By cotransfecting NRAS cRNA with miR‐145‐5p mimics or NRAS siRNA with miR‐145‐5p inhibitor into CHL‐1 and VMM917 cells, the expression of NRAS was manipulated and the effects of NRAS expression on CHL‐1 and VMM917 cells were detected. (A) 48 hours after infection and sorting, the expression level of NRAS was measured using RT‐qPCR. (B) MTT assay was performed to detect the proliferation of indicated cell lines. (C) Annexin V staining and Flow cytometry sorting was performed to detect the cell apoptosis rate of indicated cell lines. (D) Wound healing assay was used to detect migration of indicated cell lines. (E) Transwell assay was used to detect invasion of indicated cell lines. All data were presented as mean ± SD from three independent experiments. a,b,c P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in CHL‐1 cells, respectively. d,e,f P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in VMM917 cells, respectively.

The role of miR‐145‐5p on the MAPK and PI3K/AKT pathways in CHL‐1 and VMM917

To investigate the molecular mechanism associated with the antitumor role of miR‐145‐5p, Western blot analysis was performed and cellular environment was studied. After transfected with negative control, miR‐145‐5p mimics, miR‐145‐5p inhibitor, or cotransfected with miR‐145‐5p and NRS cDNA or miR‐145‐5p inhibitor and NRAS siRNA, cells were harvested 48 hours later and divided into five groups including NC group, miR mimics group, miR inhibitor group, mimics+NRAS group, and inhibitor+siNRAS group as previously described. Total proteins were extracted and protein levels related to MAPK and PI3K/AKT pathway were measured. As shown in Figure 5, the levels of NRAS and BRAF significantly decreased in miR mimics and increased in miR inhibitor group compared with NC group (P < 0.05). Albeit the level of ERK1/2 and MEK1/2 had little difference among NC group, mimics group, and miR inhibitor group, the phosphorylation of ERK1/2 and MEK1/2 was attenuated in miR mimics group and enhanced in miR inhibitor group (P < 0.05). However, the influences of miR 145‐5p mimics and inhibitor could be impaired by overexpression of NRAS or knockout of NRAS, respectively. According to the semiquantitative results, the protein levels had little change among NC group, mimics+NRAS group and inhibitor+siNRAS groups which also verified the mediating role of NRAS in miR‐145‐5p's functions (P > 0.05). In conclusion, miR‐145‐5p efficiently suppressed the MAPK pathway by directly downregulating NRAS and then abrogating the phosphorylation of MEK1/2 and ERK1/2.
Figure 5

MiR‐145‐5p suppressed NRAS/BRAF/MEK/ERK pathway by targeting NRAS in CHL‐1 and VMM917 melanoma cells. (A) Western Blot analysis demonstrated that the levels of proteins in NRAS/BRAF/MEK/ERK pathway including NRAS, BRAF, MEK1/2, phosphorylation of MEK1/2, ERK1/2 and phosphorylation of ERK1/2 in indicated groups of CHL‐1 cells was regulated by miR‐145‐5p and NRAS. (B) Western Blot demonstrated that the levels of proteins in NRAS/BRAF/MEK/ERK pathway in indicated groups of VMM 917 cells was regulated by miR‐145‐5p and NRAS. (C–D) Semiquantitative analysis of the expression of proteins using ImageJ. All data were presented as mean ± SD from three independent experiments. a,b,c P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in CHL‐1 cells, respectively. d,e,f P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in VMM917 cells, respectively.

MiR‐145‐5p suppressed NRAS/BRAF/MEK/ERK pathway by targeting NRAS in CHL‐1 and VMM917 melanoma cells. (A) Western Blot analysis demonstrated that the levels of proteins in NRAS/BRAF/MEK/ERK pathway including NRAS, BRAF, MEK1/2, phosphorylation of MEK1/2, ERK1/2 and phosphorylation of ERK1/2 in indicated groups of CHL‐1 cells was regulated by miR‐145‐5p and NRAS. (B) Western Blot demonstrated that the levels of proteins in NRAS/BRAF/MEK/ERK pathway in indicated groups of VMM 917 cells was regulated by miR‐145‐5p and NRAS. (C–D) Semiquantitative analysis of the expression of proteins using ImageJ. All data were presented as mean ± SD from three independent experiments. a,b,c P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in CHL‐1 cells, respectively. d,e,f P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in VMM917 cells, respectively. Next, we detected the expression levels of PI3K, AKT, PTEN and the corresponding phosphorylated proteins in CHL‐1and VMM917, and showed the results in Figure 6. Although the level of PI3K (p100β) and AKT had no significant difference among groups, expressions of pAKT (both ser473 and thr308) and PI3K (p100α) significantly decreased in miR mimics group and increased in miR inhibitor group compared with NC group (P < 0.05). The expression of PTEN showed the reverse outcome that PTEN was upregulated in miR mimics group and downregulated in miR inhibitor group compared with NC group (P < 0.05). Interestingly, NRAS cDNA or NRAS siRNA could attenuate the effects of miR‐145‐5p mimics or inhibitor, respectively. The collective data suggested that miR‐145‐5p acted as a tumor suppressor via suppressing the expression of NRAS and attenuating the activation of MAPK and PI3K/AKT signaling pathways in CHL‐1 and VMM917 cells.
Figure 6

MiR‐145‐5p suppressed PI3K/AKT pathway by targeting NRAS in CHL‐1 and VMM917 melanoma cells. (A) Western Blot analysis demonstrated that the levels of proteins in PI3K/AKT pathway including PI3K(p110α), PI3K(p110β), AKT, phosphorylation of AKT(ser473 and thr308) and PTEN in indicated groups of CHL‐1 cells was regulated by miR‐145‐5p and NRAS. (B) Western Blot demonstrated that the levels of proteins in PI3K/AKT pathway in indicated groups of VMM 917 cells was regulated by miR‐145‐5p and NRAS. (C–D) Semiquantitative analysis of the expression of proteins using ImageJ. All data were presented as mean ± SD from three independent experiments. a,b,c P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in CHL‐1 cells, respectively. d,e,f P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in VMM917 cells, respectively.

MiR‐145‐5p suppressed PI3K/AKT pathway by targeting NRAS in CHL‐1 and VMM917 melanoma cells. (A) Western Blot analysis demonstrated that the levels of proteins in PI3K/AKT pathway including PI3K(p110α), PI3K(p110β), AKT, phosphorylation of AKT(ser473 and thr308) and PTEN in indicated groups of CHL‐1 cells was regulated by miR‐145‐5p and NRAS. (B) Western Blot demonstrated that the levels of proteins in PI3K/AKT pathway in indicated groups of VMM 917 cells was regulated by miR‐145‐5p and NRAS. (C–D) Semiquantitative analysis of the expression of proteins using ImageJ. All data were presented as mean ± SD from three independent experiments. a,b,c P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in CHL‐1 cells, respectively. d,e,f P < 0.05 compared with NC group, mimics+NRAS group, and inhibitor+siNRAS group in VMM917 cells, respectively.

The role of miR‐145‐5p on tumor growth in vivo

To determine the effects of miR‐145‐5p on tumorigenesis in vivo, we injected CHL‐1, VMM917, and SK‐mel‐28 cells subcutaneously into nude mice for xeno‐plantation. After tumor formation, miR‐145‐5p mimics or mimics control was intratumorally injected into mices and diagnosed as mimics group or NC group, respectively. The visible tumors which were constructed with CHL‐1 and VMM917 cells showed the reduction in tumor size in mimics groups compared with NC group. The tumor growth rate of miR mimics group in CHL‐1‐injected or VMM917‐injected mices was remarkably lower compared with that of NC group after 13 days or 11 days, respectively (P < 0.05, Fig. 7A). However, there were no significant differences in mices constructed with SK‐mel‐28 cells. Western blot results (Fig. 7B) also confirmed the decreasing phosphorylation of ERK and AKT by injecting miR‐145‐5p mimics in CHL‐1‐induced and VMM917‐induced tumor tissues, whereas no difference was observed in SK‐mel‐28‐induced tumors. Taken together, miR‐145‐5p could suppress the wild‐type and NRAS‐mutant melanoma, but could not affect BRAF‐mutant melanoma in vivo, which was consistent with our findings in vitro.
Figure 7

The role of miR‐145‐5p on tumor growth in vivo. After CHL‐1‐induced, VMM917‐induced and SK‐mel‐28‐induced tumor formed in nude mices, miR‐145‐5p mimics, and negative control was injected intratumorally. (A) Tumor volume was measured every 2 days and tumors excised at day 21. Compared with NC groups, miR‐145‐5p efficiently decreased the tumor growth which was induced by CHL‐1 and VMM917 but could not affect SK‐mel‐28‐induced tumor growth. Scale bar = 1 cm. *P < 0.05 compared with CHL‐1‐induced NC group, whereas # P < 0.05 compared with VMM917‐induced NC group. All data were presented as mean ± SD from three independent experiments. (B) Mices were sacrificed at 21 days. Tumor was isolated and total protein was extracted from tumor issues. Western blot analysis was performed to measure the protein levels of NRAS, AKT, phosphorylation of AKT (ser473 and thr308), ERK1/2 and phosphorylation of ERK1/2. MiR‐145‐5p downregulated the expression of NRAS and attenuated phosphorylation of AKT and ERK1/2 in CHL‐1 and VMM917‐induced tumors.

The role of miR‐145‐5p on tumor growth in vivo. After CHL‐1‐induced, VMM917‐induced and SK‐mel‐28‐induced tumor formed in nude mices, miR‐145‐5p mimics, and negative control was injected intratumorally. (A) Tumor volume was measured every 2 days and tumors excised at day 21. Compared with NC groups, miR‐145‐5p efficiently decreased the tumor growth which was induced by CHL‐1 and VMM917 but could not affect SK‐mel‐28‐induced tumor growth. Scale bar = 1 cm. *P < 0.05 compared with CHL‐1‐induced NC group, whereas # P < 0.05 compared with VMM917‐induced NC group. All data were presented as mean ± SD from three independent experiments. (B) Mices were sacrificed at 21 days. Tumor was isolated and total protein was extracted from tumor issues. Western blot analysis was performed to measure the protein levels of NRAS, AKT, phosphorylation of AKT (ser473 and thr308), ERK1/2 and phosphorylation of ERK1/2. MiR‐145‐5p downregulated the expression of NRAS and attenuated phosphorylation of AKT and ERK1/2 in CHL‐1 and VMM917‐induced tumors.

Discussion

Dysregulation of miRNA frequently occurs in many types of tumors including melanoma. It has been widely studied that aberrant miRNA expression contributes to melanoma carcinogenesis and development via directly downregulating multiple target genes. Poell et al. 25 proved that miR‐16 and miR‐203 suppressed melanoma cells proliferation in vitro and reduced tumor growth in vivo. Fan et al. 26 demonstrated that miR‐542‐3p is downregulated in melanoma cell lines and clinical tissues, inhibits cell migration, invasion, and epithelial mesenchymal transition (EMT) in vitro, and delays metastasis in vivo via downregulating the proto‐oncogene serine/threonine protein kinase, PIM1. Recent studies suggested that miR‐145(5p) was downregulated and could serve the function of a tumor suppressor in several cancer types, such as prostate cancer 27, colon cancer 28, gastric cancer 29, and oral squamous cell carcinoma (OSCC) 30, as well as in malignant melanoma 31. Potential mechanisms have been investigated as miR‐145(5p) regulated tumorigenesis by modulating various signal pathways. Zheng et al. 32 proved miR‐145 acts as a tumor suppressor and its downregulation in tumor tissues may contribute to the progression of breast cancer through a mechanism involving ROCK1. Zou et al. 33 and Yu et al. 34 proved that miR‐145 could target NRAS signaling to suppress tumor angiogenesis and growth in breast cancer and colorectal cancer, respectively. However, the regulation mechanism of miR‐145 in melanoma has not been fully understood. Noguchi et al. 22 found that the suppression role of miR‐145 in malignant melanoma might be fulfilled by decreasing c‐MYC and FSCN1 expression. Interestingly, Dynoodt et al. 35 illustrated the suppression role of miR‐145 without targeting FSCN1 in melanoma, and indicated that the genes and pathways which are independent from FSCN1 would be possibly involved in migration and invasion of melanoma cells. In this study, we found that miR‐145‐5p was significantly downregulated in melanoma tumors and cell lines including CHL‐1, VMM917, and SK‐mel‐28 cells. By manipulating the miR‐145‐5p levels in these cell lines, we proved the antitumor role of miR‐145‐5p on the growth and metastasis of CHL‐1 and VMM917 cells, suppressing tumor proliferation, enhancing apoptosis, attenuating migration, and invasion which was consistent with previous studies. Using mice models, we also verified that miR‐145‐5p efficiently inhibited tumor growth in vivo which was induced by CHL‐1 and VMM917. Then we examined the expression of NRAS at mRNA levels in melanoma tissues, and the result showed that NRAS was expressed at a higher level in tumor tissues compared with adjacent tissues. Using dual luciferase reporting assay, we confirmed miR‐145‐5p directly targeted NRAS and downregulated NRAS expression. Mutations in NRAS are found not only in 15–20% of malignant melanomas, but also in several other cancer types 36, 37, 38. The NRAS protein constitutively activates downstream signaling pathways including the MAPK, PI3K/AKT/mTOR and Ral pathways, associated with uncontrolled cell proliferation and tumor growth 9, 39. By regulating NRAS expression levels in CHL‐1 and VMM917, the tumor suppressing effect of miR‐145‐5p mimics was abrogated with overexpression of NRAS and the tumor promoting effect of miR‐145‐5p inhibitor was attenuated with knockout of NRAS. All these suggested the antitumor role of miR‐145‐5p was mediated by NRAS. This result was consistent with the research of Kent et al. who reported this tumor‐promoting feel‐forward pathway between miR‐145 and RAS in RAS‐mutant pancreatic cancer, and the downregulation of miR‐145 required the RAS‐responsive element‐binding protein (RREB1), which repressed the miR‐145 promoter 40. To further investigate the regulatory function of miR‐145‐5p on MAPK and PI3K/AKT pathway, we also investigated the level of involved proteins in CHL‐1 and VMM917 cells with different treatments and found overexpression of miR‐145‐5p a decrease on PI3K (p100α) and phosphorylation of ERK1/2, MEK1/2, and AKT, also an increase on PTEN level. The proposed mechanism was shown in Figure 8. In serval types of tumors, MAPK and PI3K/AKT pathways served partially overlapping functions and cooperate to promote resistance to apoptosis and tumor progression 41. It is known that the two pathways are interconnected through “vertical” and “lateral” feedback loops occurring at multiple levels along the signaling cascades, and their dysregulation through genetic and epigenetic mechanisms could cooperate in the transformation and progression of experimental and human tumors. Based on those mechanisms, the combination of PI3K and MAPK inhibitors was introduced as a potential therapeutic in various cancers, which means that miR‐145‐5p could be an efficient target for the melanoma therapy 42, 43.
Figure 8

Proposed mechanism on how miR‐145‐5p impacts on MAPK and PI3K/AKT pathways. Red lines represent the activating functions, whereas green lines show the inhibition. Straight lines represent direct effect, whereas curves act on phosphorylation.

Proposed mechanism on how miR‐145‐5p impacts on MAPK and PI3K/AKT pathways. Red lines represent the activating functions, whereas green lines show the inhibition. Straight lines represent direct effect, whereas curves act on phosphorylation. Intriguingly in our study, the variation in miR‐145‐5p had little change in the SK‐mel‐28 (BRAF mutant) cell line. Oncogenic mutations in the BRAF gene has been found in approximately 50–70% of metastatic melanoma and leads to a hyperactive BRAF kinase which results in uncontrolled cell proliferation and oncogene addiction 44, 45. It has been accepted that targeted therapy for metastatic melanoma hinges on BRAF mutational status 46. There used to be an era before BRAF inhibitor the presence of a BRAF mutation in the setting of metastatic disease has been associated with a poorer prognosis compared with patients whose tumors lack BRAF mutations 47. The strong activation of BRAF mutation and the resistance to single modification may explain the little effect of miR‐145‐5p in SK‐mel‐28 cells. Overall, despite the unknown mechanism of how miR‐145‐5p interacts with different pathways in SK‐mel‐28, we proved that miR‐145‐5p could suppress the viability, proliferation, migration, and invasion of CHL‐1 and VMM917 cells and inhibit the MAPK and PI3K/AKT pathways by regulating NRAS. We recommend miR‐145‐5p as a potential therapeutic target with melanoma clinically.

Conflict of Interest

None declared.
  48 in total

1.  MicroRNA 145 may play an important role in uveal melanoma cell growth by potentially targeting insulin receptor substrate-1.

Authors:  Yang Li; Qiming Huang; Xuehui Shi; Xiang Jin; Li Shen; Xiaolin Xu; Wenbin Wei
Journal:  Chin Med J (Engl)       Date:  2014       Impact factor: 2.628

2.  Dabrafenib in BRAF-mutated metastatic melanoma: a multicentre, open-label, phase 3 randomised controlled trial.

Authors:  Axel Hauschild; Jean-Jacques Grob; Lev V Demidov; Thomas Jouary; Ralf Gutzmer; Michael Millward; Piotr Rutkowski; Christian U Blank; Wilson H Miller; Eckhart Kaempgen; Salvador Martín-Algarra; Boguslawa Karaszewska; Cornelia Mauch; Vanna Chiarion-Sileni; Anne-Marie Martin; Suzanne Swann; Patricia Haney; Beloo Mirakhur; Mary E Guckert; Vicki Goodman; Paul B Chapman
Journal:  Lancet       Date:  2012-06-25       Impact factor: 79.321

Review 3.  Hyperactive Ras in developmental disorders and cancer.

Authors:  Suzanne Schubbert; Kevin Shannon; Gideon Bollag
Journal:  Nat Rev Cancer       Date:  2007-04       Impact factor: 60.716

4.  Trametinib radiosensitises RAS- and BRAF-mutated melanoma by perturbing cell cycle and inducing senescence.

Authors:  Ulrike Schick; Joan Kyula; Holly Barker; Radhika Patel; Shane Zaidi; Claire Gregory; Hind Hafsi; Victoria Roulstone; Eric Deutsch; Martin McLaughlin; Kevin Harrington
Journal:  Radiother Oncol       Date:  2015-07-08       Impact factor: 6.280

5.  Inhibition of SW620 human colon cancer cells by upregulating miRNA-145.

Authors:  Chen Li; Na Xu; Yu-Qiang Li; Yu Wang; Zhi-Tu Zhu
Journal:  World J Gastroenterol       Date:  2016-03-07       Impact factor: 5.742

Review 6.  Molecular pathways: targeting NRAS in melanoma and acute myelogenous leukemia.

Authors:  Douglas B Johnson; Keiran S M Smalley; Jeffrey A Sosman
Journal:  Clin Cancer Res       Date:  2014-06-03       Impact factor: 12.531

7.  Characteristics of lung cancers harboring NRAS mutations.

Authors:  Kadoaki Ohashi; Lecia V Sequist; Maria E Arcila; Christine M Lovly; Xi Chen; Charles M Rudin; Teresa Moran; David Ross Camidge; Cindy L Vnencak-Jones; Lynne Berry; Yumei Pan; Hidefumi Sasaki; Jeffrey A Engelman; Edward B Garon; Steven M Dubinett; Wilbur A Franklin; Gregory J Riely; Martin L Sos; Mark G Kris; Dora Dias-Santagata; Marc Ladanyi; Paul A Bunn; William Pao
Journal:  Clin Cancer Res       Date:  2013-03-20       Impact factor: 12.531

Review 8.  Targeting RAS signalling pathways in cancer therapy.

Authors:  Julian Downward
Journal:  Nat Rev Cancer       Date:  2003-01       Impact factor: 60.716

9.  Antitumor activity of the ERK inhibitor SCH772984 [corrected] against BRAF mutant, NRAS mutant and wild-type melanoma.

Authors:  Deborah J L Wong; Lidia Robert; Mohammad S Atefi; Amanda Lassen; Geetha Avarappatt; Michael Cerniglia; Earl Avramis; Jennifer Tsoi; David Foulad; Thomas G Graeber; Begonya Comin-Anduix; Ahmed Samatar; Roger S Lo; Antoni Ribas
Journal:  Mol Cancer       Date:  2014-08-20       Impact factor: 27.401

10.  MiR-145 inhibits oral squamous cell carcinoma (OSCC) cell growth by targeting c-Myc and Cdk6.

Authors:  Yuan Shao; Yiping Qu; Siwen Dang; Bowen Yao; Meiju Ji
Journal:  Cancer Cell Int       Date:  2013-05-28       Impact factor: 5.722

View more
  31 in total

Review 1.  Emerging roles of non-coding RNAs in the pathogenesis, diagnosis and prognosis of osteosarcoma.

Authors:  Chongchong Wang; Juehua Jing; Li Cheng
Journal:  Invest New Drugs       Date:  2018-08-06       Impact factor: 3.850

2.  Diagnostic and prognostic significance of serum miR-145-5p expression in glioblastoma.

Authors:  Yao Zhang; Wei-Wei Ta; Peng-Fei Sun; Yi-Fan Meng; Cheng-Zong Zhao
Journal:  Int J Clin Exp Pathol       Date:  2019-07-01

Review 3.  MiR-145: a potential biomarker of cancer migration and invasion.

Authors:  Wen-Xiu Xu; Zhen Liu; Fei Deng; Dan-Dan Wang; Xing-Wang Li; Tian Tian; Jian Zhang; Jin-Hai Tang
Journal:  Am J Transl Res       Date:  2019-11-15       Impact factor: 4.060

Review 4.  MicroRNA heterogeneity in melanoma progression.

Authors:  Anita Thyagarajan; Kenneth Y Tsai; Ravi P Sahu
Journal:  Semin Cancer Biol       Date:  2019-06-01       Impact factor: 15.707

5.  Hypoxia-inducible miR-196a modulates glioblastoma cell proliferation and migration through complex regulation of NRAS.

Authors:  Sonam Takkar; Vikas Sharma; Sourabh Ghosh; Ashish Suri; Chitra Sarkar; Ritu Kulshreshtha
Journal:  Cell Oncol (Dordr)       Date:  2021-01-19       Impact factor: 6.730

6.  Hyperphosphorylation of HDAC2 promotes drug resistance in a novel dual drug resistant mouse melanoma cell line model: an in vitro study.

Authors:  Bhuvanesh Sukhlal Kalal; Prashant Kumar Modi; Mohd Altaf Najar; Santosh Kumar Behera; Dinesh Upadhya; Thottethodi Subrahmanya Keshava Prasad; Vinitha Ramanath Pai
Journal:  Am J Cancer Res       Date:  2021-12-15       Impact factor: 6.166

Review 7.  MicroRNA Signature in Melanoma: Biomarkers and Therapeutic Targets.

Authors:  Soudeh Ghafouri-Fard; Mahdi Gholipour; Mohammad Taheri
Journal:  Front Oncol       Date:  2021-04-22       Impact factor: 6.244

8.  Modulation of miR-26a-5p and miR-15b-5p Exosomal Expression Associated with Clopidogrel-Induced Hepatotoxicity in HepG2 Cells.

Authors:  Renata C Costa de Freitas; Raul H Bortolin; Mariana B Lopes; Letícia Tamborlin; Letícia Meneguello; Vivian N Silbiger; Rosario D C Hirata; Mário H Hirata; Augusto D Luchessi; André D Luchessi
Journal:  Front Pharmacol       Date:  2017-12-12       Impact factor: 5.810

9.  FUT8-AS1 Inhibits the Malignancy of Melanoma Through Promoting miR-145-5p Biogenesis and Suppressing NRAS/MAPK Signaling.

Authors:  Xiang-Jun Chen; Sha Liu; Dong-Mei Han; De-Zhi Han; Wei-Jing Sun; Xiao-Chun Zhao; Jun-Qing Liang; Li Yu
Journal:  Front Oncol       Date:  2021-05-19       Impact factor: 6.244

10.  Bergamottin Induces DNA Damage and Inhibits Malignant Progression in Melanoma by Modulating miR-145/Cyclin D1 Axis.

Authors:  Zhongfang Zhao; Nong Liao
Journal:  Onco Targets Ther       Date:  2021-06-17       Impact factor: 4.147

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.