| Literature DB >> 28326072 |
Pavan K Pesingi1, Manoj Kumawat2, Pranatee Behera2, Sunil K Dixit3, Rajesh K Agarwal4, Tapas K Goswami3, Manish Mahawar2.
Abstract
Poultry birds are asymptomatic reservoir of Salmonella Typhimurium (S. Typhimurium) but act as source of human infection for this bacterium. Inside the poultry, S. Typhimurium experiences several stresses, 42°C body temperature of birds is one of them. Proteins are highly susceptible to temperature mediated damage. Conversion of protein bound aspartate (Asp) residues to iso-aspartate (iso-Asp) is one of such modifications that occur at elevated temperature. Iso-Asp formation has been linked to protein inactivation and compromised cellular survival. Protein-L-isoaspartyl methyltransferase (PIMT) can repair iso-Asp back to Asp, thus enhances the cellular survival at elevated temperature. Here, we show that the pimt gene deletion strain of S. Typhimurium (Δpimt mutant strain) is hypersensitive to 42°C in vitro. The hypersusceptibility of Δpimt strain is partially reversed by plasmid based complementation (trans-complementation) of Δpimt strain. Following oral inoculation, Δpimt strain showed defective colonization in poultry caecum, and compromised dissemination to spleen and liver. Interestingly, we have observed three and half folds induction of the PIMT protein following exposure of S. Typhimurium to 42°C. Our data suggest a novel role of pimt gene in the survival of S. Typhimurium at elevated temperature and virulence.Entities:
Keywords: 42°C; PIMT; Salmonella; isoaspartate; poultry
Year: 2017 PMID: 28326072 PMCID: PMC5339242 DOI: 10.3389/fmicb.2017.00361
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Details of the primers used in current study.
| Purpose | Primer name | Sequence (5′–3′) | Size of the product (bp) | Reference |
|---|---|---|---|---|
| Construction of | 1600 | |||
| AGTTGGCACGCAGTAGGCTGGAGCTGCTTC | ||||
| TTTGCAGGGCAAACATATGAATATCCTCCTTA | ||||
| 872 | ||||
Polymerase chain reaction (PCR) conditions used for amplification of different genes.
| S. No. | Gene/purpose | Initial denaturation (temp/time) | Denaturation (temp/time) | Annealing (temp/time) | Extension (temp/time) | Final extension (temp/time) |
|---|---|---|---|---|---|---|
| 1 | 95°C/5 min | 95°C/30 s | 42°C/30 s | 72°C/1 min | 72°C/10 min | |
| 2 | 95°C/30 s | 95°C/30 s | 60°C/30 s | 72°C/90 s | 72°C/10 min |
The number of positive/infected birds on different days post-infection.
| Days (post-infection) | WT inoculated birds | |
|---|---|---|
| 7 | 4/4 (100%) | 3/4 (75%) |
| 14 | 5/5 (100%) | 3/5 (60%) |
| 21 | 4/4 (100%) | 0/4 (0%) |
| 28 | 5/5 (100%) | 0/5 (0%) |