Literature DB >> 28282438

A new Caenorhabditis elegans model of human huntingtin 513 aggregation and toxicity in body wall muscles.

Amy L Lee1, Hailey M Ung1, L Paul Sands1, Elise A Kikis1.   

Abstract

Expanded polyglutamine repeats in different proteins are the known determinants of at least nine progressive neurodegenerative disorders whose symptoms include cognitive and motor impairment that worsen as patients age. One such disorder is Huntington's Disease (HD) that is caused by a polyglutamine expansion in the human huntingtin protein (htt). The polyglutamine expansion destabilizes htt leading to protein misfolding, which in turn triggers neurodegeneration and the disruption of energy metabolism in muscle cells. However, the molecular mechanisms that underlie htt proteotoxicity have been somewhat elusive, and the muscle phenotypes have not been well studied. To generate tools to elucidate the basis for muscle dysfunction, we engineered Caenorhabditis elegans to express a disease-associated 513 amino acid fragment of human htt in body wall muscle cells. We show that this htt fragment aggregates in C. elegans in a polyglutamine length-dependent manner and is toxic. Toxicity manifests as motor impairment and a shortened lifespan. Compared to previous models, the data suggest that the protein context in which a polyglutamine tract is embedded alters aggregation propensity and toxicity, likely by affecting interactions with the muscle cell environment.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28282438      PMCID: PMC5345860          DOI: 10.1371/journal.pone.0173644

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

George Huntington first described what subsequently became known as Huntington’s Disease (HD) in 1872 in a paper titled “On Chorea” [1]. In that landmark paper, Huntington described disease symptoms as dance-like spasmodic movements that typically manifest at around 40 years of age. He also noted that HD leaves the affected patient “but a quivering wreck of his former self” due to neurodegeneration and concomitant cognitive decline before causing premature death [1]. In 1993, the single autosomal gene that causes HD became the first human disease locus to be precisely identified. The locus was revealed via map-based cloning and the HD-associated dominant allele was shown to contain an expanded trinucleotide repeat [2]. This trinucloetide repeat encodes a destabilizing expansion of a polyglutamine (polyQ) tract in the huntingtin (htt) protein. Examination of post-mortem brain tissue obtained from affected individuals revealed the conversion of the normally soluble htt protein monomers into insoluble inclusions of aggregated htt [3]. Similar aggregates, albeit of different proteins, are also hallmarks of other polyQ disorders including various spinal cerebellar ataxias and spinal and bulbar muscular atrophy. Furthermore, Alzheimer’s Disease, Parkinson’s Disease, Amyotrophic Lateral Sclerosis, and others are also characterized by the aggregation and toxicity of damaged or misfolded protein. The similarities in the nature of these diseases led to the coining of the general term “conformational diseases” to describe those caused in some way by protein misfolding [4]. The aggregation and associated htt proteotoxicity begins in mid to late life, when disease symptoms are first experienced. This suggests that aging is an important risk factor for disease and a likely trigger for htt protein aggregation/toxicity. The ability of cells and organisms to buffer against protein misfolding is thought to decline over time resulting in an impaired ability of older neurons to mitigate the toxic effects of the polyQ-expanded htt protein [5-7]. Considerable evidence demonstrates that the overexpression of molecular chaperones or the induction of the heat shock response can at least partially alleviate the toxicity of proteins with an expanded polyQ tract [8-15]. The polyQ-expanded form of the htt protein may trigger cell death via the initiation of an apoptotic pathway. This is evidenced by an increase in DNA fragmentation [16] and the initiation of a caspase cascade in cells expressing mutant htt [17]. In fact, the htt protein and other neurodegenerative disease-associated polyglutamine-containing proteins have been shown to undergo proteolytic cleavage by the pro-apoptotic caspases in a polyQ length-dependent manner [18]. Importantly, caspase-1 and caspase-3 both cleave the N-terminal domain of htt, with caspase-3 cleaving specifically at amino acid position 513, liberating a potentially toxic polyQ-containing fragment of that size [19]. Importantly, treatment of HEK 293 T cells expressing the polyQ-expanded htt protein with caspsase inhibitors led to a decrease in htt toxicity [20]. These findings led to the “toxic fragment hypothesis” that htt cleavage by caspases is a crucial step in HD pathology. Do various fragments of the htt protein differ in aggregation propensity? We know more about htt exon 1 aggregation than that of other fragments. Htt exon 1 has been identified in the brains of HD mice [21] and shown to be either the result of proteolysis or of translation from an aberrantly processed mRNA [22]. It has been shown to aggregate in a two-step process in vitro, undergoing an initial nucleation phase of aggregation involving the formation of spherical oligomers followed by protofibril-like structures containing up to 2600 individual molecules of htt exon 1 protein [23]. Additionally, htt exon 1 formed small aggregates consisting of short fibrils in cells grown in tissue culture [24]. To study the pathogenic mechanisms underlying the toxicity of the human htt protein in vivo, animal models have been generated in which htt, or N-terminal fragments of htt, were expressed in mice, Drosophila melanogaster or Caenorhabditis elegans. One of the earliest and most well studied animal models is the R6/2 mouse that expresses the first ~90 amino acids of the human htt protein containing an expanded polyQ tract of 144 glutamines [25]. The R6/2 mouse recapitulates the progressive neurodegeneration observed in HD patients and has been used as a drug discovery tool [26]. Since the time that the R6/2 mouse was first published, many C. elegans models of htt aggregation and toxicity have likewise been developed. The first expressed the N-terminal 171 amino acids of htt (Htt171) in sensory neurons including the ASH, ASI, PHA, and PHB neurons under the control of the osm-10 promoter [27]. Htt171 was shown to aggregate in and be toxic to ASH neurons in a polyQ length-dependent manner [27]. Another C. elegans htt model was developed in which only the first 57 amino acids of the htt protein (Htt57) with short (Q19) and long (Q88 and Q128) polyQ tract lengths was tagged with GFP for visualization and expressed in mechanosensory neurons under the control of the mec-3 promoter [28]. This Htt57 fragment resulted in the dysfunction, but not death, of PLM neurons. Therefore, certain neuronal subtypes may be more susceptible to the toxic effects of polyQ-containing proteins than others and neurodegeneration may not be the only way that toxicity manifests. Additionally, aggregates predominated in neuronal processes rather than cell bodies, resulting in abnormal axonal morphologies [28]. The most recent C. elegans htt model to be described expresses htt exon 1 with Q28, Q55, or Q74 in body wall muscle cells, and is fused to GFP for visualization [29]. Until now, that was the only model to express a fragment of the htt protein in muscle cells. Similar to findings in neurons, the htt exon 1 fragment displayed polyQ length-dependent aggregation and toxicity in body wall muscle cells [29]. Two additional C. elegans models published in 2002 [30] and 2006 [31] cannot be considered htt models per se because they do not contain htt protein sequence. Instead, they express different polyQ tract-lengths fused to GFP for visualization (referred to herein as polyQ alone). As such, they are generic models, modeling polyQ toxicity irrespective of the normal protein context. PolyQ alone was shown to aggregate in body wall muscle cells [30] or neurons [31] in a polyQ length-dependent manner and to cause cellular dysfunction in both tissues. For the sake of comparison, a complete list of previously published C. elegans models of polyQ alone or polyQ in the context of human htt is shown (). Each model differs with respect to htt fragment length, the presence of a fluorescent tag, and the cell type in which htt is expressed. Each of the C. elegans models described here has contributed in its own way to our understanding of the mechanisms underlying polyQ toxicity and the genetic and physical interactions between polyQ-containing proteins and the cellular environment. For example, aggregation of polyQ alone responds to changes in the overall load of misfolded protein [32, 33] and decreases when molecular chaperones are upregulated [9, 34] or when neuronal signaling is suppressed [12]. But do these findings with polyQ alone translate to other htt models including vertebrates? To address this, a genome-wide RNAi screen was performed to identify gene inactivations that led to either an increase or decrease in Htt57-GFP toxicity as measured by PLM neuron function [35]. That screen revealed 49 genes that also suppress htt toxicity in mice, providing some of the first evidence that findings in C. elegans can directly translate to mammalian models. Likewise, important conserved signaling pathways, such as that associated with β-catenin, suppressed Htt57-GFP toxicity in PLM neurons via interaction with the forkhead transcription factor FOXO/DAF-16 [36]. In an elegant study published recently, Tourette et. al. showed that the Wnt receptor is upregulated in animals expressing Htt57-GFP in mechanosensory neurons, thereby leading to the observed decrease in FOXO activity [37]. As in previous studies, these findings in C. elegans nicely translated to mouse models [37]. Most of what we know about HD relates to neurodegeneration. However, the htt protein is ubiquitously expressed and recent studies point to early pathological hallmarks of disease being caused by previously overlooked changes in metabolic pathways in muscle cells [38]. Specifically, changes to mitochondrial function in muscle cells were observed in pre-symptomatic gene positive individuals [39]. Likewise, ATP/phosphocreatine levels were decreased in the muscles of both pre- and post-symptomatic HD patients [40]. Together, these metabolic deficiencies are thought to contribute to muscle wasting in patients and HD mice. Typically, the mouse has been the model system of choice to study muscle phenotypes associated with HD. This is partly because few suitable invertebrate models existed. Only one of the C. elegans models described above expresses a htt fragment in muscle cells [29]. That model was used to show that the RNAi-mediated knockdown of the mitochondrial fission gene Drp-1 rescued the muscle dysfunction that was caused by htt exon 1 [41]. Htt exon 1 encodes an N-terminal 17 amino acid region, a polyQ repeat, and a poly proline rich domain (PRD). Longer fragments including the caspase cleavage fragments Htt513 and Htt586 have these same features but also have a series of structurally ordered segments containing HEAT repeats separated by intrinsically disordered regions that include the sites of proteolysis [42]. HEAT repeats are present in a variety of proteins and are known to participate in protein-protein interactions. Nonetheless, the exact number of HEAT repeats, or their binding partners, is not known for the htt protein [22]. Despite their hypothesized role in HD pathology, caspase cleavage products of htt have never been directly examined for toxicity in C. elegans or any other model system. That being said, the full length htt protein was expressed in mice [43]. Because of the potential importance of the htt HEAT repeats in mediating interactions with other cellular factors, having an invertebrate model expressing a long htt fragment should allow for a more comprehensive view of htt action. To that end, we describe here a new C. elegans model for htt aggregation and toxicity, in which the naturally occurring 513 amino acid caspase cleavage product, herein referred to as Htt513, was engineered to have either wild type or expanded polyQ tracts and to be expressed in body wall muscle cells. We show that aggregation of the Htt513 fragment in body wall muscle cells is a polyQ length-dependent process. We also demonstrate that aggregation is associated with motor defects and a shortened lifespan, indicating that Htt513 proteotoxicity is likewise polyQ length-dependent. This model represents a new tool to study the molecular mechanisms of htt-associated muscle dysfunction as caused by a long and biologically relevant htt fragment.

Materials and methods

Plasmid constructs

The PHtt513(Qn)::YFP gene constructs were generated by PCR amplification of the Htt513 fragment from a previously published full length cDNA clone of the human htt gene [44]. The primers used for PCR amplification were 5’ AATACCGCGGATGGCGACCCTGGAAAAGCTG, which contains a 5’ SacII site and 5’ TTATACCGGTCCATCCACTGAGTCCGCCTGCAG, which contains a 3’ AgeI site. The resultant PCR products were cloned into the corresponding restriction sites of the previously described pPD30.38Q0::YFP plasmid which is a C. elegans vector containing the unc-54 promoter driving YFP expression in body wall muscle cells [30]. The resulting sequence of the htt protein fragment used in this study was: MATLEKLMKAFESLKSFQ(n)PPPPPPPPPPPQLPQPPPQAQPLLPQPQPPPPPPPPPPGPAVAEEPLHRPKKELSATKKDRVNHCLTICENIVAQSVRNSPEFQKLLGIAMELFLLCSDDAESDVRMVADECLNKVIKALMDSNLPRLQLELYKEIKKNGAPRSLRAALWRFAELAHLVRPQKCRPYLVNLLPCLTRTSKRPEESVQETLAAAVPKIMASFGNFANDNEIKVLLKAFIANLKSSSPTIRRTAAGSAVSICQHSRRTQYFYSWLLNVLLGLLVPVEDEHSTLLILGVLLTLRYLVPLLQQQVKDTSLKGSFGVTRKEMEVSPSAEQLVQVYELTLHHTQHQDHNVVTGALELLQQLFRTPPPELLQTLTAVGGIGQLTAAKEESGGRSRSGSIVELIAGGGSSCSPVLSRKQKGKVLLGEEEALEDDSESRSDVSSSALTASVKDEISGELAASSGVSTPGSAGHDIITEQPRSQHTLQADSVD (Uniprot ID P42858). Plasmid constructs were generated that had 15 or 128 CAG repeats, indicated as PHtt513(Q15)::YFP or PHtt513(Q128)::YFP, respectively. The expressed proteins are herein referred to as Htt513(Q15) or Htt513(Q128) for simplicity.

C. elegans strains, crosses, and culture

C. elegans were cultured according the standard methods [45]. In short, animals were maintained at 20°C or 15°C on NGM agar plates seeded with E. coli (OP50) obtained from the Caenorhabditis Genetics Center (St. Paul, Minnesota). The wild type strain used was the Bristol N2 isolate. The PYFP line (herein referred to as YFP) was previously published and expresses an integrated YFP transgene in body wall muscle cells [30]. To generate transgenic animals, 50ng/μL of DNA encoding PHtt513(Q15)::YFP or PHtt513(Q128)::YFP were microinjected into the gonads of adult wild type hermaphrodites to generate multiple (at least 5) independent lines transmitting extrachromosomal arrays. Integrated PHtt513(Q15)::YFP (EAK102) or PHtt513(Q128)::YFP (EAK103) lines were generated by gamma irradiation followed by backcrossing to N2 animals for at least three generations to ensure a wild type genetic background free of secondary mutations.

Fluorescence microscopy

To obtain confocal z-stacks of transgenic C. elegans, animals were fixed with 4% paraformaldehyde and actin filaments were stained with phalloidin (Molecular Probes/Life Technologies, Grand Island, NY) as previously described [7]. Imaging was with a Leica SP8 confocal microscope (Wetzlar, Germany) using a 40X oil immersion objective. For Fluorescence Recovery after Photobleaching (FRAP) of Htt513(Q128) foci in living animals, day 1 adults were immobilized with 2mM levamisole, mounted on 2% agarose pads, and covered with a coverslip. FRAP was performed on a Leica SP8 confocal microscope with a 63X oil immersion objective (Wetzlar, Germany). Data were analyzed as previously described [31]. For analysis of aggregation over time, images were obtained with a Ziess Axio Observer A1 (Oberkochen, Germany) inverted compound fluorescence microscope using a 20X objective. Micrographs of small regions of the animal were stitched together manually to obtain images of whole animals.

Quantification of aggregate number

Quantification of aggregate number was performed on live animals at day 1 of adulthood. Fluorescent micrographs were obtained with a Ziess Axio Observer (Oberkochen, Germany) as described above and aggregate number in each image was determined by counting the fluorescent foci. A minimum n-number of n = 50 animals was examined for each genotype.

Motility assays

Our measure of motility was thrashing rate in liquid. Individual animals harboring extrachromsomal or integrated arrays were examined at days 1, 4 and 8 of adulthood. They were picked from petri plates to a 10μL drop of M9 on a microscope slide. Animals were given 30s to recover from passaging before counting thrashes. A thrash was scored each time that the head crossed the vertical midline of the body. The total number of thrashes was counted for 60s. An n-number of n = 30–50 animals was assayed for each genotype. Statistical analyses were performed using R-studio.

Lifespan assays

Animals were acclimated at 20°C for at least two generations before initiating lifespan analyses. Forty age-matched L4 larvae were placed on NGM plates seeded with E. coli (OP50) and cultured at 20°C. During the reproductive time of their life cycle, animals were transferred away from their progeny by daily passaging to freshly seeded plates. Post-reproductive adults were passaged as needed to prevent starvation. Animals were scored as deceased when they no longer moved upon prodding the head several times with a platinum wire as described previously [46]. Animals that crawled off the plate were censored in statistical analyses by adjusting the total population to the number of animals seen on the plate on a given day. Data were analyzed and plotted using R-studio.

Western blot analysis

100 fluorescent L4 larval stage animals were frozen at -80°C in M9 overnight and thawed on ice before boiling in Laemmli sample buffer for 5min. Samples were centrifuged at 10,000Xg for 5min prior to loading on 10% polyacrylamide gels (SDS-PAGE). Following transfer to PVDF filters, immunodetection was with an IRDye800 conjugated anti-GFP antibody (cat# 600-432-215) from Rockland Immunochemicals, Inc. (Gilbertsville, PA) or with the anti-polyQ antibody 3B5H10 from Sigma (St. Louis, MO). Visualization was with an Odyssey system from Li-Cor (Lincoln, NE). Three biological replicates were performed and average band intensity for the three replicates was determined using the Odyssey system.

mRNA analysis

Ten day 1 and day 4 adult animals were frozen in liquid nitrogen and stored at -80°C in M9 before RNA isolation using TrizolTM Reagent. RNA was treated with DNase I using the DNA-freeTM DNA removal kit from Thermo Fisher Scientific, Inc. (Waltham, MA) according to the manufacturers instructions. cDNA was synthesized using iScript Reverse Transcriptase (Bio-Rad Laboratories, Hercules, CA) according to the manufacturers instructions. The Bio-Rad cyber green master mix and the Bio-Rad MyIQ cycler were used for quantitative PCR (qPCR) of yfp or actin as a loading control. The YFP primers were 5’ ATGGTGAGCAAGGGCGAGGAGCTGTTC and 5’ GGTGGCATCGCCCTCGCCCTCGCCG. The actin primers were 5’ ATCACCGCTCTTGCCCCATC and 5’ GGCCGGACTCGTCGTATTCTT. Three independent biological replicates were performed (each in technical triplicate) and the data averaged.

Results and discussion

Expression of Htt513 in C. elegans body wall muscle cells

To express the first 513 amino acids of human htt (Htt513) in C. elegans body wall muscle cells, we utilized the myosin heavy chain promoter, unc-54. YFP was translationally fused to the C-terminus of Htt513 allowing us to visualize the protein in live animals. Because polyQ length is known to affect aggregation and toxicity [47-49], we generated two different polyQ tract lengths for the purpose of comparison. One was short (Q15) and in a range not usually associated with HD. The other was much longer (Q128) and in the range of pathogenesis (). Formally, the resultant proteins are Htt513(Q15)::YFP and Htt513(Q128)::YFP, respectively. However, for simplicity’s sake we refer to them here as Htt513(Q15) and Htt513(Q128).

Htt513 protein expression in C. elegans body wall muscle cells.

(A) Schematic representation of gene constructs for Htt513(Qn) expression in C. elegans body wall muscle cells. The polyQ-containing N-terminal domain including the first 513 amino acids of human htt was translationally fused to YFP and expressed in body wall muscle cells under the control of the unc-54 promoter. Short (Q15) and long (Q128) polyQ tracts were generated. (B) A representative immunoblot was probed with an anti-GFP antibody (top) and reprobed with an anti-expanded polyQ antibody (bottom). (C) Quantification of protein bands detected with the anti-GFP antibody. Data represent means of three biological replicates (n = 3) and error bars represent standard error of the mean. Because protein aggregation is a concentration-dependent process, we wanted to ensure that our two Htt513 proteins were expressed at similar levels. We thus examined their relative levels in integrated transgenic lines by immunoblot analysis with an anti-GFP antibody that reliably cross-reacts with YFP. Both Htt513(Q15) and Htt513(Q128) accumulated to substantially lower levels than YFP alone (). Specifically, Htt513(Q15) accumulated an average of 7% of YFP levels and Htt513(Q128) accumulated an average of only 0.8% of YFP levels (). In fact, Htt513(Q128) protein levels were so low it was detectable only as a very faint band in an immunoblot analysis compared to the readily detected Htt513(Q15) protein. Because Htt513(Q128) was so difficult to detect, we re-probed the immunoblot with a very sensitive antibody that was raised against expanded polyQ tracts. As expected, the anti-expanded polyQ antibody recognized Htt513(Q128), but not Htt513(Q15), demonstrating that the faint Htt513(Q128) band on the anti-GFP immunoblot was indeed Htt513(Q128) (). To confirm that the steady-state protein levels for Htt513(Q15) and Htt(Q128) were not affected by the positions at which the transgenes inserted, we also examined protein levels in lines transmitting non-integrated extrachromosomal arrays. The steady-state levels of Htt513(Q15) and Htt513(Q128) protein were examined in at least 5 independent extrachromosomal array lines and no overt differences were observed between lines harboring the same transgene. Specifically, the levels of Htt513(Q15) were much lower than YFP alone, similar to the results obtained from integrated lines. Importantly, Htt513(Q128) was only detected with the anti-expanded polyQ antibody and not with the anti-GFP antibody as shown in a representative immunoblot (). At face value, this lack of detection with the anti-GFP antibody indicates extremely low Htt513(Q128) protein levels, although an inhibitory effect of the expanded polyQ tract on the binding of the anti-GFP antibody cannot be ruled out. Therefore, we also examined mRNA levels using qRT-PCR. Both Htt513(Q15) and Htt513(Q128) mRNA levels accumulated to only ~2% of control levels at day 1 and day 4 of adulthood (). Because Htt513(Q15) and Htt513(Q128) were expressed at similar levels, we can compare these lines with respect to aggregation and toxicity.

Levels of Htt513 mRNA are low in adult animals.

Total RNA was isolated from equivalent numbers of YFP control animals and animals expressing Htt513(Q15) or Htt513(Q128) at day 1 or day 4 of adulthood. qRT-PCR was performed with primers for YFP and expression levels were normalized to actin and plotted relative to the YFP control at day 1 of adulthood, which was set equal to 100%. The data represent means of three biological replicates and error bars represent standard error of the mean.

Htt513 aggregates in a polyglutamine length-dependent manner in C. elegans body wall muscle cells

For our model to useful, it should recapitulate some of the key features of HD, such as htt aggregation. In patients, a threshold length of 35 glutamines has been described such that longer polyQ tracts result in htt aggregation. Thus, if the aggregation dynamics for Htt513 in C. elegans are similar to that observed in patients, we would not expect Htt513(Q15) to aggregate in C. elegans body wall muscle cells, but we would expect Htt513(Q128) to aggregate. Consistent with this, Htt513(Q15) yielded primarily diffuse fluorescence at day 1 of adulthood, whereas Htt513(Q128) formed fluorescent foci (). Upon counting the number of foci, we found that the Htt513(Q15) integrated line had an average of less than one per animal compared to the Htt513(Q128) integrated line that had an average of 26 (). These counts were similar to those of corresponding lines harboring extrachromosomal arrays (). Such foci are suggestive of Htt513(Q128) aggregation.

The Htt513 protein forms large visible foci in body wall muscle cells in a polyglutamine length-dependent manner.

(A) Z-stack projections. Day 1 adult animals were fixed, stained with phalloidin, and z-stacks of head regions were imaged with a confocal microscope. YFP is shown in yellow and phalloidin-stained actin filaments are shown in red. (B) Quantification of fluorescent foci number in whole animals expressing Htt513(Q15) or Htt513(Q128). The data represent average foci number across 50 individuals (n = 50). Error bars represent standard error of the mean. To determine if Htt513(Q128) formed bona fide protein aggregates, we performed Fluorescence Recovery After Photobleaching (FRAP) of the large, visible, Htt513(Q128) foci and compared their recovery time to those of areas of diffuse fluorescence in animals expressing YFP alone in body wall muscle cells. As expected for immobile protein aggregates, the Htt513(Q128) foci showed no recovery of fluorescence within the 45s time course that we recorded (). This is in contrast to the Htt513(Q15) protein which did not form foci and whose diffuse fluorescence recovered rapidly after photobleaching (). Together, these data indicate that aggregation is dependent on polyQ tract length and not on other inherent characteristics of the Htt513 protein fragment.

FRAP reveals Htt513(Q128) aggregates in C. elegans body wall muscle cells.

Fluorescence Recovery After Photobleaching (FRAP) was performed on regions of diffuse fluorescence in animals expressing YFP alone or on individual fluorescent foci in Htt513(Q128) animals. (A) Representative images before bleaching (pre-bleach), immediately following bleaching (post-bleach) and after a 45s recovery (post-recovery). Red boxes indicate the regions subjected to photobleaching. (B) Quantification of relative fluorescence intensity over a 45s FRAP time course. Data represent averages of at least 10 fluorescent foci (or regions of diffuse fluorescence) in different animals. Error bars represent standard error of the mean. The time of bleaching is indicated with an arrow. In HD patients, aggregation is age-dependent and correlates with the onset of symptoms. To determine whether the aggregation of Htt513(Q15) or Htt513(Q128) changes during aging, we examined animals grown to days 1, 4, or 8 of adulthood. We found that Htt(Q128) was already aggregated at day 1 as described above (), and that those aggregates persisted unchanged to day 8. Furthermore, Htt513(Q15) was not aggregated at day 1 of adulthood, and no age-dependent increase in aggregation was observed ().

Age-dependent decline in Htt513(Q15) steady-state protein levels.

Representative fluorescent micrographs showing YFP in live animals examined over a time course spanning days 1–8 of adulthood. Htt513(Q15), and Htt513(Q128) integrated lines were imaged with the same exposure time (300ms), while YFP alone was imaged with an exposure time 100X shorter (3ms) due to its much higher expression levels. Intestinal autoflourescence began to appear between days 4–8 of adulthood and can be seen in the animals imaged with longer exposure times. Surprisingly, instead of aggregation worsening over time, the levels of Htt513(Q15) protein declined to almost undetectable levels by day 4 of adulthood (). A parallel drop in mRNA levels did not seem to cause this drop protein levels. qRT-PCR revealed that YFP control animals experienced a 60% decline in yfp mRNA between days 1 and 4 of adulthood. In contrast, both Htt513(Q15) and Htt513(Q128) transgenes expressed only 2% of control levels at day 1 of adulthood but expression did not decline during aging (). In other words, Htt513(Q15) and Htt513(Q128) mRNA levels were low but steady in adult animals. The finding that Htt513(Q15) protein levels decline over time despite constant mRNA levels suggests that Htt513(Q15) is a likely target for protein turnover. Additionally, it seems to be a better substrate for turnover than Htt513(Q128) or YFP alone, as both of those proteins persisted well into adulthood. This finding regarding protein stability is consistent with a recent study of the half-lives of htt protein fragments in human cells in tissue culture where extremely short N-terminal htt fragments were very stable, with half lives in the order of 16 hours, compared to a longer fragment including the first 508 amino acids of human htt that had a half life of only 1.5hrs [50]. The 513 amino acid fragment analyzed here is even longer than that, with perhaps an even shorter half-life. Furthermore, the apparently greater stability of Htt513(Q128) compared to Htt513(Q15) is likely due to increased aggregation of the polyQ-expanded protein interfering with the degradation machinery.

Htt513(Q128) is toxic to C. elegans body wall muscle cells.

Htt exon 1 was previously shown to be toxic to C. elegans body wall muscle cells, especially when it had an expanded polyQ repeat [29]. Likewise, expanded polyQ alone was also toxic to muscle cells [30]. Interestingly, aging was shown to exacerbate the toxicity of some polyQ proteins [30] but not others [51]. To determine whether Htt513 is toxic and whether toxicity is modulated by age or polyQ length, we assayed muscle cell function by measuring thrashing rate in liquid at days 1, 4, and 8 of adulthood ().

Htt513(Q128) is toxic to body wall muscle cells.

Toxicity was determined as a function of the rate at which animals thrash in liquid. Individual data points are indicated for each genotype and age to illustrate the full range of data. Mean thrashing rate is indicated with horizontal lines. Error bars represent 95% confidence intervals. A) Thrashing rate at day 1 of adulthood for animals harboring extrachromosomal arrays. The indicated p-values are the results of Sheffé multiple comparisons post-hoc tests. ANOVA p-value = 1.23E-10. n = 30. B) Thrashing rate at days 1, 4, and 8 of adulthood for animals harboring integrated transgenes. ANOVA p-value = 1.1e-16. n = 50 Qualitatively, Htt513(Q15) and Htt513(Q128) appeared to have slower thrashing rates than that of control animals expressing YFP alone at all time points tested. ANOVA analysis of all nine treatments yielded a p-value of 1.1e-16, so we performed post-hoc analyses in the form of a priori planned comparisons using the Scheffé multiple comparisons test (). - p>0.05. * p<0.05. *** p≤0.001. Using a p-value cut-off of less than 0.001, these data indicate that only Htt513(Q128) resulted in motility defects relative to YFP alone at all time points tested. In contrast, Htt513(Q15) appeared to be greatly affected in motility only at day 4 of adulthood, only somewhat affected at day 8, and showed no age-dependent increase in toxicity as determined by comparing the thrashing rate of Htt513(Q15) animals over time (). Likewise, Htt513(Q128) did not increase in toxicity during aging. Instead, there was a slight motility improvement observed between days 1–4. Despite the statistically significant motility defects observed for Htt513(Q128) animals, no overt morphological abnormalities were detected in muscle cells via phalloidin staining of actin filaments (). To ensure that the observed toxicity was not an artifact of the Htt513(Q128) transgene insertion site, we also examined the thrashing rate of animals expressing Htt513(Q15) and Htt513(Q128) from extrachromosomal arrays. We found a similar motility impairment at day 1 of adulthood (), indicating that the observed motility defect is most likely due to the toxic effects of the Htt513(Q128) protein.

Animals expressing Htt513(Q128) have a shortened life span

As a complementary approach to measure the toxic effects of the Htt513(Q128) protein, we asked whether expression in C. elegans body wall muscle cells had any effect on lifespan. To address this, we performed a lifespan analysis of N2 (wild type), YFP, Htt513(Q15), and Htt513(Q128) animals. We observed a marked reduction in the mean lifespan of animals expressing Htt513(Q128) (). Specifically, Htt513(Q128) animals had a mean lifespan of 12 days and a maximum lifespan of 25 days compared to N2, YFP, and Htt513(Q15) animals which all had mean lifespans of 21 days and maximum lifespan of 29, 25, and 28 days respectively. These data indicate that the toxicity of the Htt513(Q128) protein manifests not only as impaired muscle function but also early death. This is in contrast to the previously described C-terminal fragment of the human ataxin-3 protein which, even in its polyQ-expanded form, did not affect C. elegans lifespan despite a significant impairment of muscle function [51].

Htt513 (Q128) animals have a shortened lifespan.

Lifespan assays were performed on populations of at least 40 individuals expressing either Htt513(Q15), Htt513(Q128), or YFP in body wall muscle as compared to wild type animals. The fraction of animals still alive at any given day is indicated.

Conclusions

We have described a new model for the aggregation and toxicity of a disease-associated fragment of the polyQ-containing htt protein in C. elegans body wall muscle cells. This is the first time that a htt fragment of this length (Htt513) was expressed in C. elegans–all other fragments have been no longer than 171 amino acids. Furthermore, this is only the second time that any htt fragment has been expressed in C. elegans body wall muscle cells. All polyQ-containing proteins expressed to date in C. elegans body wall muscle cells (polyQ alone, AT3CT, Htt exon1, and now Htt513) aggregate in a polyQ length-dependent manner and display polyQ length-dependent toxicity. One notable difference is that steady-state Htt513 protein levels seem to be lower than those of other polyQ-containing proteins in this same tissue. It is possible that Htt513 is a better substrate for protein turnover, especially in its wild type rather than polyQ-expanded form. Another notable difference is that only Htt513(Q128) was reported to shorten lifespan. Taken together, the data presented here suggest that the Htt513 fragment may have unique physical interactions with the cellular environment, including, but not limited to, the protein degradation machinery. As such, screens for genetically or physically interacting proteins will likely tell us a great deal about how Htt513 interfaces with the proteostasis network for which many members including molecular chaperones and neuronal signaling components have recently been identified in C. elegans [5]. Finally, this should be a useful model to study the muscle-specific effects of mutant htt.

Expression of Htt513(Qn) proteins in C. elegans body wall muscle cells from extrachromosomal arrays.

Top: Representative immunoblot probed with an anti-expanded polyQ antibody. Bottom: The same immunoblot as above probed with an anti-GFP antibody. The YFP control was expressed from an integrated transgene while Htt513(Q15) and Htt513(Q128) were expressed from extrachromosomal arrays. (TIF) Click here for additional data file.

Htt513 aggregation in extrachromosomal array lines.

Day 1 adult animals were fixed and imaged with a compound fluorescence microscope. YFP fluorescence is shown for animals expressing Htt513(Q15) or Htt513(Q128). (TIF) Click here for additional data file.

Fluorescence Recovery After Photobleaching (FRAP) reveals that Htt513 (Q15) is not aggregated.

FRAP was performed on regions of diffuse fluorescence in animals expressing YFP alone, Q19-YFP or Htt513(Q15). Quantification of relative fluorescence intensity over a 60s FRAP time course is shown. Data represent averages of at least 10 regions of diffuse fluorescence in different animals. Error bars represent standard error of the mean. The time of bleaching is indicated with an arrow. (TIF) Click here for additional data file.
Table 1

Previously published Htt or polyQ alone C. elegans models.

Expressed ProteinTissue/Cell TypePolyQ lengthsPhenotypesReferences
Htt171Sensory neurons (ASH, ASI, PHA, PHB)Q2, Q23, Q95, Q150PolyQ length-dependent aggregation and toxicity. Age-dependent aggregation of Q150 in ASH neurons.Faber, et. al., Proc. Natl. Acad. Sci., 1999
Htt57-YFPTouch Receptor Neurons (AVM, ALML, ALMR, PVM, PLML, PLMR)Q19, Q88, Q128PolyQ length-dependent aggregation and toxicity in PLM tail mechanosensory neuronsParker, et. al., Proc. Natl. Acad. Sci., 2001
polyQ-YFPBody wall muscle cellsQ19, Q29, Q33, Q35, Q40, Q44, Q64, Q82PolyQ length-dependent and age-dependent aggregation and toxicity.Morley, etl. al., Proc. Natl. Acad. Sci., 2002
polyQ-YFPAll NeuronsQ19, Q35, Q40, Q67, Q86PolyQ length-dependent aggregation and toxicity. No age-dependent changes observed.Brignull, et. al., J Neurosci., 2006
GFP-Htt exon 1Body wall muscle cellsQ28, Q55, Q74PolyQ length-dependent aggregation and toxicity.Wang, et. al., Hum. Mol. Genet., 2006
Table 2

Scheffé Multiple Comparisons Post-Hoc Test of Significance.

Treatment pairsp-valueSignificance
day 1 YFP vs. Htt513(Q15)0.99-
day 1 YFP vs. Htt513(Q128)1.95E-11***
day 4 YFP vs. Htt513(Q15)2.22E-16***
day 4 YFP vs. Htt513(Q128)1.11E-16***
day 8 YFP vs. Htt513(Q15)0.001***
day 8 YFP vs. Htt513(Q128)2.28E-13***
Htt513(Q15) day 1 vs. day 40.03*
Htt513(Q15) day 1 vs. day 82.99E-04***
Htt513(Q15) day 4 vs. day 89.99E-01-
Htt513(Q128) day 1 vs. day 43.48E-08***
Htt513(Q128) day 1 vs. day 81.95E-11***
Htt513(Q128) day 4 vs. day 80.99-

- p>0.05.

* p<0.05.

*** p≤0.001.

  51 in total

Review 1.  Increased mitochondrial fission and neuronal dysfunction in Huntington's disease: implications for molecular inhibitors of excessive mitochondrial fission.

Authors:  P Hemachandra Reddy
Journal:  Drug Discov Today       Date:  2014-03-28       Impact factor: 7.851

2.  Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice.

Authors:  L Mangiarini; K Sathasivam; M Seller; B Cozens; A Harper; C Hetherington; M Lawton; Y Trottier; H Lehrach; S W Davies; G P Bates
Journal:  Cell       Date:  1996-11-01       Impact factor: 41.582

3.  HEAT repeats in the Huntington's disease protein.

Authors:  M A Andrade; P Bork
Journal:  Nat Genet       Date:  1995-10       Impact factor: 38.330

4.  Abnormal in vivo skeletal muscle energy metabolism in Huntington's disease and dentatorubropallidoluysian atrophy.

Authors:  R Lodi; A H Schapira; D Manners; P Styles; N W Wood; D J Taylor; T T Warner
Journal:  Ann Neurol       Date:  2000-07       Impact factor: 10.422

5.  Trinucleotide (CAG) repeat length is positively correlated with the degree of DNA fragmentation in Huntington's disease striatum.

Authors:  N J Butterworth; L Williams; J Y Bullock; D R Love; R L Faull; M Dragunow
Journal:  Neuroscience       Date:  1998-11       Impact factor: 3.590

6.  Collapse of proteostasis represents an early molecular event in Caenorhabditis elegans aging.

Authors:  Anat Ben-Zvi; Elizabeth A Miller; Richard I Morimoto
Journal:  Proc Natl Acad Sci U S A       Date:  2009-08-24       Impact factor: 11.205

7.  The genetics of Caenorhabditis elegans.

Authors:  S Brenner
Journal:  Genetics       Date:  1974-05       Impact factor: 4.562

8.  Polyglutamine proteins at the pathogenic threshold display neuron-specific aggregation in a pan-neuronal Caenorhabditis elegans model.

Authors:  Heather R Brignull; Finola E Moore; Stephanie J Tang; Richard I Morimoto
Journal:  J Neurosci       Date:  2006-07-19       Impact factor: 6.709

Review 9.  Skeletal muscle pathology in Huntington's disease.

Authors:  Daniel Zielonka; Izabela Piotrowska; Jerzy T Marcinkowski; Michal Mielcarek
Journal:  Front Physiol       Date:  2014-10-06       Impact factor: 4.566

10.  Progressive disruption of cellular protein folding in models of polyglutamine diseases.

Authors:  Tali Gidalevitz; Anat Ben-Zvi; Kim H Ho; Heather R Brignull; Richard I Morimoto
Journal:  Science       Date:  2006-02-09       Impact factor: 63.714

View more
  13 in total

Review 1.  Models and mechanisms of repeat expansion disorders: a worm's eye view.

Authors:  Paige Rudich; Todd Lamitina
Journal:  J Genet       Date:  2018-07       Impact factor: 1.166

Review 2.  Modern approaches for modelling dystonia and Huntington's disease in vitro and in vivo.

Authors:  Olga A Zhunina; Nikita G Yabbarov; Alexander N Orekhov; Alexey V Deykin
Journal:  Int J Exp Pathol       Date:  2019-05-15       Impact factor: 1.925

3.  Generation and characterization of a tractable C. elegans model of tauopathy.

Authors:  Joshua C Russell; Haoyi Lei; Rahul K Chaliparambil; Sarah Fish; Susan M Markiewicz; Ting-I Lee; Anushka Noori; Matt Kaeberlein
Journal:  Geroscience       Date:  2021-09-18       Impact factor: 7.581

4.  A Novel Caenorhabditis Elegans Proteinopathy Model Shows Changes in mRNA Translational Frameshifting During Aging.

Authors:  Frauke Adamla; Jarod Rollins; Matthew Newsom; Santina Snow; Markus Schosserer; Clemens Heissenberger; Jordan Horrocks; Aric N Rogers; Zoya Ignatova
Journal:  Cell Physiol Biochem       Date:  2019

5.  An apparent core/shell architecture of polyQ aggregates in the aging Caenorhabditis elegans neuron.

Authors:  Rachel S Fisher; Rosa Meyo Jimenez; Elizabeth Soto; Darin Kalev; Shana Elbaum-Garfinkle
Journal:  Protein Sci       Date:  2021-05-22       Impact factor: 6.993

6.  Chemical mutagenesis of Caenorhabditis elegans uncovers genetic modifiers of huntingtin protein aggregation.

Authors:  Hailey Ung; Rhodes Hall; Elise Kikis
Journal:  MicroPubl Biol       Date:  2020-01-02

Review 7.  Drug discovery: Insights from the invertebrate Caenorhabditis elegans.

Authors:  Sebastián Giunti; Natalia Andersen; Diego Rayes; María José De Rosa
Journal:  Pharmacol Res Perspect       Date:  2021-04

8.  A tetracycline-dependent ribozyme switch allows conditional induction of gene expression in Caenorhabditis elegans.

Authors:  Lena A Wurmthaler; Monika Sack; Karina Gense; Jörg S Hartig; Martin Gamerdinger
Journal:  Nat Commun       Date:  2019-01-30       Impact factor: 14.919

9.  PolyQ-independent toxicity associated with novel translational products from CAG repeat expansions.

Authors:  Paige Rudich; Simon Watkins; Todd Lamitina
Journal:  PLoS One       Date:  2020-04-02       Impact factor: 3.240

10.  TBK1 phosphorylates mutant Huntingtin and suppresses its aggregation and toxicity in Huntington's disease models.

Authors:  Ramanath Narayana Hegde; Anass Chiki; Lara Petricca; Paola Martufi; Nicolas Arbez; Laurent Mouchiroud; Johan Auwerx; Christian Landles; Gillian P Bates; Malvindar K Singh-Bains; Mike Dragunow; Maurice A Curtis; Richard Lm Faull; Christopher A Ross; Andrea Caricasole; Hilal A Lashuel
Journal:  EMBO J       Date:  2020-08-05       Impact factor: 11.598

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.