| Literature DB >> 28275299 |
Xiao-Que Xie1, Qi-Hong Zhao1, Hua Wang1, Kang-Sheng Gu1.
Abstract
AIM: To explore novel therapeutic target of cisplatin resistance in human gastric cancer.Entities:
Keywords: Biology; Cisplatin resistance; Dysregulate; Gastric cancer; Microarray
Mesh:
Substances:
Year: 2017 PMID: 28275299 PMCID: PMC5323444 DOI: 10.3748/wjg.v23.i7.1189
Source DB: PubMed Journal: World J Gastroenterol ISSN: 1007-9327 Impact factor: 5.742
Primer of quantitative real-time polymerase chain reaction
| HIPK2 | Forward | CCCCGTGTACGAAGGTATGG | 20 | 59.90 | 60% |
| Reverse | GGGATGTTCTTGCTCTGGCT | 20 | 60.03 | 55% | |
| PDE3B | Forward | TGAGAGTTATGGCTGCCTGT | 20 | 58.72 | 50% |
| Reverse | CTGAGGGGCATTTGTAGCCA | 20 | 60.30 | 55% | |
| FGF2 | Forward | TCCACCTATAATTGGTCAAAGTGGT | 25 | 59.99 | 40% |
| Reverse | CATCAGTTACCAGCTCCCCC | 20 | 59.82 | 60% | |
| TWIST1 | Forward | ATTCAAAGAAACAGGGCGTGG | 21 | 59.39 | 47.6% |
| Reverse | CAGAGGTGTGAGGATGGTGC | 20 | 60.39 | 40% | |
| ZEB2 | Forward | GCCTCTGTAGATGGTCCAGTGA | 22 | 61.21 | 54.6% |
| Reverse | ATCGCGTTCCTCCAGTTTTCT | 21 | 60.00 | 47.6% | |
| VEGFC | Forward | CCCGCCTCTCCAAAAAGCTA | 20 | 60.04 | 55% |
| Reverse | CGGGTGTCAGGTAAAAGCCT | 20 | 59.96 | 55% | |
| SPHK1 | Forward | GCTGCGAAGTTGAGCGAAAA | 20 | 60.04 | 50% |
| Reverse | CGTTCCCTACAGTGGCCTG | 19 | 60.08 | 63.2% | |
| BAX | Forward | GCCCTTTTGCTTCAGGGTTT | 20 | 59.24 | 50% |
| Reverse | CATCCTCTGCAGCTCCATGT | 20 | 59.82 | 55% | |
| PTEN | Forward | CAGGATACGCGCTCGGC | 17 | 60.73 | 70.6% |
| Reverse | ACAGCGGCTCAACTCTCAAA | 20 | 57.89 | 50% | |
| HTRA1 | Forward | AGCCAAAGAGCTGAAGGACC | 20 | 59.96 | 55% |
| Reverse | GACATCATTGGCGGAGACCA | 20 | 60.11 | 55% | |
| CCL5 | Forward | TGCTGCTTTGCCTACATTGC | 20 | 59.76 | 50% |
| Reverse | CTTGTTCAGCCGGGAGTCAT | 20 | 60.04 | 55% | |
| TGM2 | Forward | CCTCTGTCTCTCCGGGAACC | 20 | 61.32 | 65% |
| Reverse | TGGCAACCAGGGGTCCTAT | 19 | 60.23 | 57.9% | |
| TLR4 | Forward | CTCGGTCAGACGGTGATAGC | 20 | 59.97 | 60% |
| Reverse | TTTAGGGCCAAGTCTCCACG | 20 | 59.68 | 55% | |
| ACTB | Forward | CTCACCATGGATGATGATATCGC | 23 | 59.13 | 47.8% |
| Reverse | AGGAATCCTTCTGACCCATGC | 21 | 59.79 | 52.4% |
GC: Gastric cancer.
Figure 1Cell viability treated with different concentrations of cisplatin for 48 h. MTT assay for SGC7901 cells and SGC7901/DDP cells treated with cisplatin (133.34, 66.67, 6.67, 0.67 and 0.067 μmol/L, respectively).
Figure 2mRNA expression levels from microarray. A: The volcano plot image showed the mRNA expression levels of microarray in SGC7901/DDP cells compared with SGC7901 cells. Black dots: equally expressed mRNAs between SGC7901/DDP cells and SGC7901 cells (FC ≤ 2); red dots: mRNAs were over-expressed in SGC7901/DDP cells compared with SGC7901 cells (FC ≥ 2); green dots: mRNAs in SGC7901/DDP cells were down-expressed compared to SGC7901 cells (P-values < 0.05, FC ≥ 2). Fold changes of these mRNAs in SGC7901/DDP cells compared with SGC7901 cells are shown as mean ± SD; B: Two-dimensional hierarchical clustering image of the 1308 dysregulated mRNAs in the SGC7901/DDP cells compared with the SGC7901 cells, each row represents an mRNA, each column represents a sample. 7901-1, 7901-2 and 7901-3 represent the three samples of SGC7901 cells, DDP-1, DDP-2 and DDP-3 represent the three samples of SGC7901/DDP cells. Red: Higher expression levels; green: Lower expression levels.
Figure 3Quantitative real-time polymerase chain reaction validation of the microarray results of the 13 mRNAs. Relative fold changes in expression between SGC7901/DDP cells and SGC7901 cells were in agreement with microarray.
Figure 4Bioinformatic analysis of differentially expressed mRNAs. Gene ontology analysis of mRNAs dysregulated in SGC7901/DDP cells compared with SGC7901 cells. A: Top 30 molecular functions of the dysregulated mRNAs may associated with. Gene ontology analysis include biological processes, cellular components and molecular function; B: Gene ontology enriched diseases. Top 30 diseases annotations of dysregulated mRNAs may involve in. The disease enrich system include 5 disease databases: OMIM, KEGG disease, FunDO, GAD and NHGRI GWAS Catalog.
Different expressed mRNAs enriched by KOBAS
| Gastric cancer | KEGG DISEASE | 0.0016 | |
| Skin diseases | KEGG DISEASE | 0.0078 | |
| Skin and soft tissue diseases | KEGG DISEASE | 0.0078 | |
| Macular degeneration | KEGG DISEASE | 0.0140 | |
| Cancers of the digestive system | KEGG DISEASE | 0.0439 | |
| Familial thoracic aortic aneurysm and dissection (TAAD) | KEGG DISEASE | 0.0459 | |
| Hypomagnesemia | KEGG DISEASE | 0.0459 | |
| Multiple epiphyseal dysplasia (MED) | KEGG DISEASE | 0.0459 | |
| Transient neonatal diabetes mellitus (TNDM) | KEGG DISEASE | 0.0459 | |
| Non-syndromic autosomal dominant mental retardation | KEGG DISEASE | 0.0461 | |
| Cardiac hypertrophy | NHGRI GWAS Catalog | 0.0028 | |
| Response to fenofibrate (adiponectin levels) | NHGRI GWAS Catalog | 0.0046 | |
| Complement C3 and C4 levels | NHGRI GWAS Catalog | 0.0094 | |
| Neutrophil count | NHGRI GWAS Catalog | 0.0119 | |
| Nephropathy(idiopathic membranous) | NHGRI GWAS Catalog | 0.0137 | |
| Sleep duration | NHGRI GWAS Catalog | 0.0195 | |
| Airflow obstruction | NHGRI GWAS Catalog | 0.0259 | |
| Cystic fibrosis severity | NHGRI GWAS Catalog | 0.0265 | |
| Metabolite levels (5-HIAA/ MHPG Ratio) | NHGRI GWAS Catalog | 0.0265 | |
| Bronchopulmonary dysplasia | NHGRI GWAS Catalog | 0.0296 | |
| Major depressive disorder | NHGRI GWAS Catalog | 0.0346 | |
| IgA nephropathy | NHGRI GWAS Catalog | 0.0346 | |
| Pulmonary function decline | NHGRI GWAS Catalog | 0.0368 | |
| Palmitic acid (16:0) plasma levels | NHGRI GWAS Catalog | 0.0368 | |
| Male-pattern baldness | NHGRI GWAS Catalog | 0.0439 | |
| Response to citalopram treatment | NHGRI GWAS Catalog | 0.0439 | |
| Hyperlipidemia | FunDO | 0.0050 | |
| Thrombocytopenia | FunDO | 0.0068 | |
| Fibromyalgia | FunDO | 0.0126 | |
| Cirrhosis | FunDO | 0.0209 | |
| Hepatitis C | FunDO | 0.0321 | |
| Thalassemia | FunDO | 0.0345 | |
| Gingival overgrowth | FunDO | 0.0417 | |
| Pulmonary fibrosis | FunDO | 0.0474 | |
| Ovary cancer | FunDO | 0.0477 | |
| Esophageal tumor | FunDO | 0.0477 | |
| Hyperlipidemia | GAD | 0.0093 | |
| Thrombocytopenia | GAD | 0.0114 | |
| Fibromyalgia | GAD | 0.0136 | |
| Cirrhosis | GAD | 0.0204 | |
| Hepatitis C | GAD | 0.0258 | |
| Thalassemia | GAD | 0.0362 | |
| Gingival overgrowth | GAD | 0.0419 | |
| Pulmonary fibrosis | GAD | 0.0420 | |
| Ovary cancer | GAD | 0.0426 | |
| Esophageal tumor | GAD | 0.048 |
Figure 5Heat-map of gene ontology enriched cisplatin resistance pathways and input mRNAs which significantly altered in SGC7901/DDP cells compared with SGC7901 cells. A: PI3K-Akt signaling pathway and input genes; B: MAPK signaling pathway and input genes; C: Notch signaling pathway and input genes; D: ErbB signaling pathway and input genes; E: Jak-STAT signaling pathway and input genes; F: NF-kappa B signaling pathway and input genes; G: HIF-1 signaling pathway and input genes; H: MicroRNAs in cancer and input genes. Each row represents an mRNA, and each column represents a sample. The intensity of the color indicates the relative levels of mRNAs. Red: Higher expression levels; green: Lower expression levels. The name of the input mRNAs which significantly altered (P < 0.05, FC ≥ 2) is present at the right of the figure.
Cisplatin resistance pathway and input gene (P < 0.05, FC ≥ 2.0)
| PI3K-Akt signaling pathway | 2.60826 | Up | Chr18:6958512-6956742 | hs|18p11.31 | |
| 2.75269 | Up | Chr18:6942035-6941976 | hs|18p11.31 | ||
| 2.09356 | Up | Chr1:235714443-235714384 | hs|1q42.3 | ||
| 2.96629 | Up | Chr17:45389027-45389086 | hs|17q21.32 | ||
| 7.72783 | Up | Chr2:160964233-160958330 | hs|2q24.2 | ||
| 2.92538 | Up | Chr4:177604882-177604823 | hs|4q34.3 | ||
| 2.42861 | Up | Chr11:103778445-103778386 | hs|11q22.3 | ||
| 2.00967 | Up | Chr2:227596677-227596618 | hs|2q36.3 | ||
| 2.04779 | Up | Chr7:93536149-93540155 | hs|7q21.3 | ||
| 2.25620 | Up | Chr1:110466137-110466196 | hs|1p13.3 | ||
| 4.76437 | Up | Chr4:110932689-110932748 | hs|4q25 | ||
| 3.02437 | Up | Chr4:123819331-123819390 | hs|4q28.1 | ||
| 2.99240 | Up | Chr4:123819317-123819376 | hs|4q28.1 | ||
| 2.31254 | Up | Chr2:216288895-216288217 | hs|2q35 | ||
| 2.08497 | Up | Chrx:107399109-107399050 | hs|Xq22.3 | ||
| 10.99211 | Up | Chr3:191860574-191860515 | hs|3q28 | ||
| 2.01984 | Up | Chr7:93555764-93555823 | hs|7q21.3 | ||
| 2.19252 | Up | Chr15:49776810-49776869 | hs|15q21.2 | ||
| 2.56116 | Down | Chr18:21534735-21534794 | hs|18q11.2 | ||
| 2.30808 | Down | Chr9:21166331-21166272 | hs|9p21.3 | ||
| 2.40183 | Down | Chr19:4172219-4172278 | hs|19p13.3 | ||
| 2.13271 | Down | Chr9:120476856-120476915 | hs|9q33.1 | ||
| 2.89458 | Down | Chr21:47546086-47546145 | hs|21q22.3 | ||
| 2.09302 | Down | Chr16:28950600-28950659 | hs|16p11.2 | ||
| 3.83177 | Down | Chr12:6728794-6728735 | hs|12p13.31 | ||
| 2.11177 | Down | Chr2:227867523-227867464 | hs|2q36.3 | ||
| 4.49558 | Down | Chr20:56141030-56141089 | hs|20q13.31 | ||
| 3.82587 | Down | Chr17:26694806-26694747 | hs|17q11.2 | ||
| 16.48365 | Down | Chr17:47284034-47283975 | hs|17q21.32 | ||
| 2.87954 | Down | Chrx:70328539-70328480 | hs|Xq13.1 | ||
| 7.53410 | Down | Chr19:10070602-10070543 | hs|19p13.2 | ||
| 17.08866 | Down | Chrx:137713947-137713888 | hs|Xq26.3 | ||
| MAPK signaling pathway | 4.57879 | Down | Chr7:128498538-128498597 | hs|7q32.1 | |
| 4.81302 | Down | Chr7:128498476-128498535 | hs|7q32.1 | ||
| 7.83293 | Down | Chr10:18787305-18787364 | hs|10p12.31 | ||
| 4.87152 | Down | Chr15:79254554-79254495 | hs|15q25.1 | ||
| 2.17501 | Down | Chr14:75748214-75748273 | hs|14q24.3 | ||
| 2.04000 | Down | Chr1:59246570-59246511 | hs|1p32.1 | ||
| 3.10358 | Down | Chr11:64508971-64508912 | hs|11q13.1 | ||
| 17.08866 | Down | Chrx:137713947-137713888 | hs|Xq26.3 | ||
| 2.93035 | Up | Chr9:101916322-101916381 | hs|9q22.33 | ||
| 4.76437 | Up | Chr4:110932689-110932748 | hs|4q25 | ||
| 4.76437 | Up | Chr4:110932689-110932748 | hs|4q25 | ||
| 10.99211 | Up | Chr3:191860574-191860515 | hs|3q28 | ||
| 2.25019 | Up | Chr3:185161379-185165590 | hs|3q27.2 | ||
| 3.02437 | Up | Chr4:123819331-123819390 | hs|4q28.1 | ||
| 2.99240 | Up | Chr4:123819317-123819376 | hs|4q28.1 | ||
| 2.08267 | Up | Chr19:7979302-7979361 | hs|19p13.2 | ||
| 2.19252 | Up | Chr15:49776810-49776869 | hs|15q21.2 | ||
| 8.83585 | Up | Chr17:65028139-65028198 | hs|17q24.2 | ||
| 2.94145 | Up | Chr17:65029115-65029174 | hs|17q24.2 | ||
| 2.14311 | Up | Chr2:152694239-152694180 | hs|2q23.3 | ||
| 2.56659 | Up | Chr1:68153371-68153430 | hs|1p31.3 | ||
| 2.32411 | Up | Chr11:27679959-27679900 | hs|11p14.1 | ||
| 2.30323 | Up | Chr11:27677072-27677013 | hs|11p14.1 | ||
| 2.09452 | Up | Chr7:81579504-81579445 | hs|7q21.11 | ||
| Notch signaling pathway | 2.03379 | Up | Chr11:95712434-95712375 | hs|11q21 | |
| 3.20086 | Up | Chr20:10619120-10619061 | hs|20p12.2 | ||
| 2.57919 | Up | Chr4:140810806-140810747 | hs|4q31.1 | ||
| 9.99859 | Down | Chr11:58975615-58975674 | hs|11q12.1 | ||
| ErbB signaling pathway | 4.76437 | Up | Chr4:110932689-110932748 | hs|4q25 | |
| 2.77996 | Up | Chr8:32474390-32585512 | hs|8p12 | ||
| 2.08267 | Up | Chr19:7979302-7979361 | hs|19p13.2 | ||
| 2.04000 | Down | Chr1:59246570-59246511 | hs|1p32.1 | ||
| 5.29571 | Down | Chr12:56482380-56482439 | hs|12q13.2 | ||
| 8.12050 | Down | Chr12:56496160-56496219 | hs|12q13.2 | ||
| 2.37427 | Down | Chr2:70675378-70675319 | hs|2p13.3 | ||
| Jak-STAT signaling pathway | 4.21849 | Up | Chr19:55875847-55875788 | hs|19q13.42 | |
| 2.92970 | Up | Chr4:142654431-142654490 | hs|4q31.21 | ||
| 2.00180 | Up | Chr12:93969799-93969858 | hs|12q22 | ||
| 5.95682 | Up | Chr4:124324494-124324553 | hs|4q28.1 | ||
| 2.90187 | Up | Chr1:66102129-66102188 | hs|1p31.3 | ||
| 2.87954 | Down | Chrx:70328539-70328480 | hs|Xq13.1 | ||
| 3.41581 | Down | Chr1:43819826-43819885 | hs|1p34.2 | ||
| NF-kappaB signaling pathway | 2.03846 | Up | Chr4:74963044-74962985 | hs|4q13.3 | |
| 9.97781 | Up | Chr4:74609265-74609324 | hs|4q13.3 | ||
| 2.13271 | Down | Chr9:120476856-120476915 | hs|9q33.1 | ||
| HIF-1 signaling pathway | 2.39081 | Up | Chr6:12296672-12296731 | hs|6p24.1 | |
| 2.46437 | Up | Chr6:12296218-12296277 | hs|6p24.1 | ||
| 4.76437 | Up | Chr4:110932689-110932748 | hs|4q25 | ||
| 2.13271 | Down | Chr9:120476856-120476915 | hs|9q33.1 | ||
| MicroRNAs in cancer | 2.00967 | Up | Chr2:227596677-227596618 | hs|2q36.3 | |
| 3.32563 | Up | Chr2:145146320-145146261 | hs|2q22.3 | ||
| 2.70558 | Up | Chr2:145182422-145182363 | hs|2q22.3 | ||
| 2.02409 | Up | Chr11:35253812-35253871 | hs|11p13 | ||
| 2.25018 | Up | Chr9:36124319-36124378 | hs|9p13.3 | ||
| 2.96629 | Up | Chr17:45389027-45389086 | hs|17q21.32 | ||
| 2.61864 | Up | Chr18:61172218-61172277 | hs|18q21.33 | ||
| 2.36144 | Up | Chr2:191829716-191829775 | hs|2q32.2 | ||
| 2.07371 | Up | Chr2:191827822-191827881 | hs|2q32.2 | ||
| 5.29571 | Down | Chr12:56482380-56482439 | hs|12q13.2 | ||
| 8.12050 | Down | Chr12:56496160-56496219 | hs|12q13.2 |
Figure 6Interaction network analyses of differentially express proteins. In the network, nodes represents proteins, lines as functional associations between the abnormal expressed proteins and the thickness of the lines indicates the level of confidence in association reported.
Dysregulated mRNAs (P < 0.05, FC ≥ 2.0) associated with cisplatin resistance
| 0.00035 | 2.19252 | Up | Fibroblast growth factor 7 | PMID: 22990650 | |
| 2.63E-06 | 4.06213 | Up | Homeodomain interacting protein kinase 2 | PMID: 24846322 | |
| 9.94E-05 | 2.46437 | Up | Endothelin 1 | PMID: 21220476 | |
| 0.00108 | 2.29340 | Up | Cystathionine-beta-synthase | PMID: 24236104 | |
| 0.00029 | 10.44998 | Up | Phosphodiesterase 3B, cgmp-inhibited | PMID: 24133626 | |
| 0.00041 | 2.42888 | Up | E2F transcription factor 5, p130-binding | PMID: 22193543 | |
| 0.00104 | 2.13293 | Up | Peptidylprolyl cis/trans isomerase, NIMA-interacting 1 | PMID: 26820938 | |
| 0.00346 | 4.76437 | Up | Epidermal growth factor | PMID: 27086487 | |
| 0.00025 | 2.25620 | Up | Colony stimulating factor 1 (macrophage) | PMID: 22005523 | |
| 0.00103 | 2.17028 | Up | Proliferating cell nuclear antigen | PMID: 24474685 | |
| 2.63E-06 | 4.06213 | Up | Homeodomain interacting protein kinase 2 | PMID: 24846322 | |
| 0.00011 | 2.43726 | Up | Ectonucleoside triphosphate diphosphohydrolase 6 (putative) | PMID: 21519793 | |
| 0.00097 | 2.29646 | Up | Aldo-keto reductase family 1, member C1 | PMID: 23165153, PMID: 17266043 | |
| 0.00172 | 2.19491 | Up | Asparagine synthetase (glutamine-hydrolyzing) | PMID: 23956056, PMID: 17409444 | |
| 0.00062 | 2.32411 | Up | Brain-derived neurotrophic factor | PMID: 22276165, PMID: 17044982 | |
| 0.01089 | 2.55664 | Up | Calcium binding tyrosine-(Y)-phosphorylation regulated | PMID: 24362251 | |
| 2.15E-06 | 2.99240 | Up | Fibroblast growth factor 2 (basic) | PMID: 12894531 | |
| 1.95E-05 | 2.93256 | Up | Solute carrier family 7 member 11 | PMID: 24516043 | |
| 0.00046 | 2.00213 | Up | Tubulin, beta 3 class III | PMID: 25107571 | |
| 0.00180 | 2.96340 | Up | Twist family bhlh transcription factor 1 | PMID: 22673193, PMID: 22245869 | |
| 9.41E-05 | 3.20086 | Up | Jagged 1 | PMID: 24659709 | |
| 0.00031 | 2.36619 | Down | Annexin A11 | PMID: 19484149, PMID: 17982121 | |
| 2.67E-05 | 5.05630 | Down | Chemokine (C-C motif) ligand 5 | PMID: 26983899 | |
| 0.00044 | 17.08866 | Down | Fibroblast growth factor 13 | PMID: 24113164 | |
| 7.48E-05 | 2.92508 | Down | Insulin-like growth factor binding protein 3 | PMID: 20023704 | |
| 0.00066 | 2.24596 | Down | Kallikrein-related peptidase 6 | PMID: 23307575 | |
| 4.50E-05 | 5.36735 | Down | Solute carrier family 7 member 8 | PMID: 23462296 | |
| 2.88E-05 | 6.24520 | Down | Transglutaminase 2 | PMID: 21424127, PMID: 24828664 | |
| 0.00114 | 2.13271 | Down | Toll-like receptor 4 | PMID: 21616060, PMID: 22583829 | |
| 0.02405 | 3.20613 | Down | XIAP associated factor 1 | PMID: 25824780, PMID: 25240826 | |
| 0.00061 | 3.65969 | Down | Transcription elongation factor A (SII), 2 | PMID: 16142353 |