Tao Jiang1,2, Katie Kindt3, Doris K Wu2. 1. Program in Neuroscience and Cognitive Science, University of Maryland, College Park, United States. 2. Laboratory of Molecular Biology, National Institute on Deafness and Other Communication Disorders, National Institutes of Health, Bethesda, United States. 3. Section on Sensory Cell Development, National Institute on Deafness and Other Communication Disorders, National Institutes of Health, Bethesda, United States.
Abstract
The asymmetric location of stereociliary bundle (hair bundle) on the apical surface of mechanosensory hair cells (HCs) dictates the direction in which a given HC can respond to cues such as sound, head movements, and water pressure. Notably, vestibular sensory organs of the inner ear, the maculae, exhibit a line of polarity reversal (LPR) across which, hair bundles are polarized in a mirror-image pattern. Similarly, HCs in neuromasts of the zebrafish lateral line system are generated as pairs, and two sibling HCs develop opposite hair bundle orientations. Within these sensory organs, expression of the transcription factor Emx2 is restricted to only one side of the LPR in the maculae or one of the two sibling HCs in neuromasts. Emx2 mediates hair bundle polarity reversal in these restricted subsets of HCs and generates the mirror-image pattern of the sensory organs. Downstream effectors of Emx2 control bundle polarity cell-autonomously via heterotrimeric G proteins.
The asymmetric location of stereociliary bundle (hair bundle) on the apical surface of mechanosensory hair cells (HCs) dictates the direction in which a given HC can respond to cues such as sound, head movements, and water pressure. Notably, vestibular sensory organs of the inner ear, the maculae, exhibit a line of polarity reversal (LPR) across which, hair bundles are polarized in a mirror-image pattern. Similarly, HCs in neuromasts of the zebrafish lateral line system are generated as pairs, and two sibling HCs develop opposite hair bundle orientations. Within these sensory organs, expression of the transcription factor Emx2 is restricted to only one side of the LPR in the maculae or one of the two sibling HCs in neuromasts. Emx2 mediates hair bundle polarity reversal in these restricted subsets of HCs and generates the mirror-image pattern of the sensory organs. Downstream effectors of Emx2 control bundle polarity cell-autonomously via heterotrimeric G proteins.
The asymmetric location of cilia on the apical surface of epithelial cells is critical for many functions such as left-right asymmetry and normal flow of the cerebral spinal fluid. Abnormal positioning of the monocilium in the node and multicilia of ependymal cells lining the brain ventricles can lead to left-right asymmetry defects and hydrocephalus, respectively (Tissir et al., 2010; Song et al., 2010). Similarly, the asymmetrical orientation or polarity of hair bundle on top of sensory HCs provides the directional sensitivity for detecting sensory inputs in the form of vibrations (Shotwell et al., 1981). The mechanisms underlying the precise positioning of hair bundle are unclear.Each hair bundle is comprised of specialized microvilli (also called stereocilia) arranged in a staircase pattern that are tethered to the kinocilium, a true cilium. Deflection of the hair bundle towards its kinocilium leads to the opening of the mechanotransduction channels located on the tips of stereocilia and depolarizes the HC. Hair bundle displacement in the opposite direction results in hyperpolarization (Figure 1A; Shotwell et al., 1981). Therefore, the orientation and positioning of the hair bundle determine the directional sensitivity of the HC.
Figure 1.
Regional expression of Emx2 in the maculae.
(A) Medial view of a mouse left inner ear with its six sensory organs (grey). Enlarged are the utricle and saccule showing their subdivisions, hair bundle polarity (arrows), LPR (yellow line), and striola (blue). The square denotes the sensory epithelium across the LPR on the right. Displacement of the hair bundle towards or away from the kinocilium results in depolarization and hyperpolarization of HC, respectively. (B) Schematic of the Emx2 expression domain (green) in the utricle and saccule. (C–H’) Utricle (C–E’) and saccule (F–H’) are stained for anti-Emx2 (green), anti-spectrin (red) and anti-oncomodulin (blue) antibodies (n = 6). Hair bundle polarity is determined by the location of the kinocilium, which is devoid of anti-spectrin staining (red). (D,E,G,H) and (D’,E’,G’,H’) are confocal images of the same HCs taken at the apical surface and nuclei level, respectively. (C,C’,D’,E’) Anti-Emx2 (green) staining is located in the lateral extrastriola (LES), which is lateral to the oncomodulin-positive striola (blue) of the utricle. Hair bundles in LES point toward those in the striola and medial extrastriola (MES) of utricle (E). (F,F’,G’,H’) Anti-Emx2 staining is restricted to the inner region (IR) of saccule and the LPR bisects the striola. Hair bundles in the IR point away from those in the outer region (OR) of saccule (H). The border of the Emx2-positive domain (green line, D’,E’,G’,H’) coincides with LPR (yellow line, D,E,G,H) in both maculae. Refer to Figure 2 for a description of asterisks and arrowheads. A, anterior; AC, LC, and PC, anterior, lateral and posterior crista; D, dorsal; M, medial; oC, organ of Corti; P, posterior; S, saccule; U, utricle.
DOI:
http://dx.doi.org/10.7554/eLife.23661.002
(A–B) Whole mount in situ hybridization of the utricle showing Emx2 hybridization domain (A; n = 3) lateral to that of the β-tectorin-positive striola (B; n = 3). Neither genes are expressed in the anterior and lateral cristae (AC and LC). (C–F) Section in situ hybridization of the utricle (C-D; n = 3) and saccule (E-F; n = 3) showing Emx2 expression (C,E) within the Lfng-positive sensory epithelium (D,F). Emx2 is not expressed in the striola (Lfng-negative, bracket) and lateral crista. (G–J’) Emx2 immunoreactivity is not detected in the lateral crista (G-H’; n = 6) or other cristae. In contrast, anti-Emx2 immunoreactivities are broadly detected in the cochlea (I–J’) including inner and outer HCs (n = 6; IHC, asterisk; OHC, bracket), as well as the Hensen’s and Claudius’ cell region (arrowhead, I–J’).
DOI:
http://dx.doi.org/10.7554/eLife.23661.003
Regional expression of Emx2 in the maculae.
(A) Medial view of a mouse left inner ear with its six sensory organs (grey). Enlarged are the utricle and saccule showing their subdivisions, hair bundle polarity (arrows), LPR (yellow line), and striola (blue). The square denotes the sensory epithelium across the LPR on the right. Displacement of the hair bundle towards or away from the kinocilium results in depolarization and hyperpolarization of HC, respectively. (B) Schematic of the Emx2 expression domain (green) in the utricle and saccule. (C–H’) Utricle (C–E’) and saccule (F–H’) are stained for anti-Emx2 (green), anti-spectrin (red) and anti-oncomodulin (blue) antibodies (n = 6). Hair bundle polarity is determined by the location of the kinocilium, which is devoid of anti-spectrin staining (red). (D,E,G,H) and (D’,E’,G’,H’) are confocal images of the same HCs taken at the apical surface and nuclei level, respectively. (C,C’,D’,E’) Anti-Emx2 (green) staining is located in the lateral extrastriola (LES), which is lateral to the oncomodulin-positive striola (blue) of the utricle. Hair bundles in LES point toward those in the striola and medial extrastriola (MES) of utricle (E). (F,F’,G’,H’) Anti-Emx2 staining is restricted to the inner region (IR) of saccule and the LPR bisects the striola. Hair bundles in the IR point away from those in the outer region (OR) of saccule (H). The border of the Emx2-positive domain (green line, D’,E’,G’,H’) coincides with LPR (yellow line, D,E,G,H) in both maculae. Refer to Figure 2 for a description of asterisks and arrowheads. A, anterior; AC, LC, and PC, anterior, lateral and posterior crista; D, dorsal; M, medial; oC, organ of Corti; P, posterior; S, saccule; U, utricle.
Figure 2.
The Emx2 lineage domain is present in Emx2 functional null maculae.
(A–C) and (I–K) are the same specimens as (C–E’) and (F–H’) in Figure 1. (A–C) In Emx2 utricles, the border of the Emx2 lineage domain (cyan line) coincides largely with LPR (yellow line), located at the lateral edge of the oncomodulin-positive striola (blue outlined; n=5). (C) HCs point toward each other (arrows) across the LPR. Asterisks label HCs that are negative for cre reporter signals but positive for Emx2 immunostaining (Figure 1E’; n=18), whereas arrowhead labels a HC that is cre-reporter positive but negative for Emx2 immunostaining (Figure 1E’; n=21). (D) A similar Emx2 lineage domain (GFP) is observed using a different Cre reporter, Rosa. (E–G) The Emx2 lineage domain (green) remained in Emx2 utricles, but hair bundle polarity in this region is reversed (G; n=5) compared to controls (C; n=5). (I–K) In Emx2 control saccules, the border of the Emx2 lineage domain (cyan line) mostly coincides with the LPR except in the ventral-posterior region (I, double-headed arrow). (K) Across the LPR, HCs are pointing away from each other (arrows). Asterisks label HCs that are negative for cre reporter signals but positive for Emx2 immunostaining (Figure 1H’; n=60), whereas arrowhead labels a HC that is cre-reporter positive but negative for Emx2 immunostaining (Figure 1H’; n=105). (L) A similar lineage domain (GFP) is observed using the Cre reporter Rosa. (M–O) In Emx2 mutant saccules, the border of the Emx2 lineage domain (cyan line) remained located in the middle of the striolar region (blue outline), but the hair bundles within the lineage domain are reversed (O; n=5), relative to controls (green region in K). (H) and (P) Schematics of respective utricles and saccules showing relationships among the Emx2 expression domain (green), hair bundle polarity pattern, LPR (yellow line) and striola (blue outlined) in controls and Emx2 mutants.
DOI:
http://dx.doi.org/10.7554/eLife.23661.004
DOI:
http://dx.doi.org/10.7554/eLife.23661.005
DOI:
http://dx.doi.org/10.7554/eLife.23661.006
In the utricle (A–F”) and saccule (G–L”), the lineage (A,D,G,J, blue) and expression (A’,D’,G’,J’, green) domains of Emx2 are both restricted to the LES and IR, respectively. (C,F,I,L) show Emx2 lineage (blue) and anti-spectrin staining (red). (C’,F’,I’,L’) and (C”,F”,I”,L”) are same regions as (C,F,I,L) showing lineage staining (blue) and anti-Emx2 staining (green) at the nucleus level of HCs, respectively. The LPR (C”,F”,I”,L”, yellow line) correlates with the border of Emx2 immunostaining (green line) better than the border of Emx2-lineage domain (C’,F’,I’,L’, cyan line). Asterisks label the Emx2-lineage negative HCs with reversed bundle polarity that are positive for Emx2 staining, whereas arrowheads label Emx2-lineage HCs with default bundle polarity that are negative for Emx2 immunoreactivity.
DOI:
http://dx.doi.org/10.7554/eLife.23661.007
(A–B) The kidneys below the adrenal glands (dotted lines) are absent in Emx2 (B) compared to Emx2 embryos (A). (C) The size of the cortex is smaller in Emx2 than Emx2 embryos. Both kidney and cortical phenotypes have been described in Emx2 mutants (n=5; Pellegrini et al., 1996; Miyamoto et al., 1997). (D–G) In contrast to controls (D-E; n=3), the LPR (yellow line) is absent in Emx2 utricles (F–G; n=3) and hair bundle polarity defects are similar to those reported in Emx2 ears (Holley et al., 2010). The distribution of Prickle-like 2 (Pk2) immunostaining in Emx2 utricles is associated with the medial border of HCs (G), similar to control (E) and Emx2 utricles (Figure 6D–E). (H–K) Compared to controls (H–I; n=5), outer HCs are absent and two rows of poorly organized inner HCs with aberrant hair bundle polarity are evident in Emx2 cochlea (J-K; n=5), similar to the phenotypes reported in Emx2 knockout mutants (Holley et al., 2010).
DOI:
http://dx.doi.org/10.7554/eLife.23661.008
DOI:
http://dx.doi.org/10.7554/eLife.23661.002
Expression of Emx2 in sensory organs of the mouse inner ear.
(A–B) Whole mount in situ hybridization of the utricle showing Emx2 hybridization domain (A; n = 3) lateral to that of the β-tectorin-positive striola (B; n = 3). Neither genes are expressed in the anterior and lateral cristae (AC and LC). (C–F) Section in situ hybridization of the utricle (C-D; n = 3) and saccule (E-F; n = 3) showing Emx2 expression (C,E) within the Lfng-positive sensory epithelium (D,F). Emx2 is not expressed in the striola (Lfng-negative, bracket) and lateral crista. (G–J’) Emx2 immunoreactivity is not detected in the lateral crista (G-H’; n = 6) or other cristae. In contrast, anti-Emx2 immunoreactivities are broadly detected in the cochlea (I–J’) including inner and outer HCs (n = 6; IHC, asterisk; OHC, bracket), as well as the Hensen’s and Claudius’ cell region (arrowhead, I–J’).DOI:
http://dx.doi.org/10.7554/eLife.23661.003Within each sensory organ of the inner ear, HCs display a well-defined pattern of hair bundle polarity tailored to its function. The organ of Corti (sensory organ for sound detection) and the three cristae (vestibular organs for detecting angular acceleration) exhibit a polarity pattern where all the hair bundles are polarized in the same direction (unidirectional). In contrast, maculae of the utricle and saccule, vestibular organs for detecting linear acceleration, are divided by the LPR into two regions with opposing hair bundle polarities. Across the LPR, hair bundles are oriented toward each other in the utricle and away from each other in the saccule (Figure 1A). Similar to the hair bundle polarity pattern in the utricle, HCs in neuromast organs of the zebrafish lateral line are also oriented toward each other in a 1:1 ratio (López-Schier et al., 2004).Asymmetric localization of the hair bundle begins with the docking of the basal body to the center of the apical surface to form the kinocilium. The nascent kinocilium then moves from the center to the periphery where adjacent specialized-microvilli gradually differentiate into a staircase architecture and establishes the intrinsic polarity of the hair bundle (Lu and Sipe, 2016; Tilney et al., 1992). The directed movement of the kinocilium and subsequent staircase formation of the stereocilia in each HC require an intracellular complex, Insc/LGN/Gαi, which has been determined to mediate spindle orientation during mitosis in other cell types (Morin and Bellaïche, 2011; Lu and Sipe, 2016; Ezan et al., 2013; Tarchini et al., 2013, 2016). This complex, tethered to the cell cortex of sensory HCs, presumably relocates the basal body/nascent kinocilium to the cell periphery via the attached microtubules, in a manner similar to relocating centrioles during mitosis. In humans, mutations of LGN (also known as GPSM2) cause a syndromic hearing loss suggesting that the directed kinocilium migration and bundle assembly are critical for hearing (Doherty et al., 2012).In addition to establishing the intrinsic polarity of individual HCs, precise arrangement of hair bundle patterns in each inner ear organ is regulated by global and intercellular signaling mechanisms as well. The global polarity signaling molecules Wnts are required for establishing directional polarity in the developing mouse limb bud and Drosophila wing (Wu et al., 2013; Gao et al., 2011), as well as hair bundle alignment in the organ of Corti (Qian et al., 2007; Dabdoub and Kelley, 2005). A highly conserved intercellular signaling pathway, the core planar cell polarity (cPCP) pathway, coordinates polarity between adjacent cells. This cPCP complex is comprised of transmembrane proteins Van Gogh (Vang), Frizzled (Fz), and Celsr as well as cytoplasmic proteins such as Dishevelled (Dvl) and Prickle (Pk) (Goodrich and Strutt, 2011; Wallingford, 2012). Mutations of cPCP components such as Van Gogh-like 2 (Vangl2), Fz, and Dvl, affect the coordinated alignment of hair bundles among HCs but not the peripheral positioning of the kinocilium or the intrinsic bundle polarity of individual HCs (Montcouquiol et al., 2003; Wang et al., 2005, 2006).Hair bundles are misaligned in the maculae of Vangl2 mutants and the LPR is disrupted (Montcouquiol et al., 2006; Yin et al., 2012). However, it is debatable whether this complex is directly involved in the LPR establishment because the distribution of cPCP components such as Prickle-like 2 (Pk2) and Vangl2 are not reversed across the LPR in normal maculae as predicted by the polarity of the hair bundle (Deans et al., 2007; Jones et al., 2014). By contrast, all hair bundles were orientated in the same direction and the LPR was reportedly absent in knockout maculae of Emx2, which encodes a homeobox-containing transcription factor (Holley et al., 2010). This defect was attributed to an imbalance between proliferation and differentiation of sensory precursors rather than a specific role for Emx2 in directing hair bundle polarity.In our study, we show that Emx2 expression is required to reverse hair bundles from their ‘default’ polarity in the macula and neuromast. Ectopic expression of Emx2 in HCs is sufficient to reverse the ‘default’ bundle polarity. Our loss- and gain-of-function experiments in both inner ear and neuromast indicate that Emx2 is necessary and sufficient to mediate hair bundle orientation in vertebrate HCs.
Results
The border of Emx2 expression domain coincides with the LPR in maculae
We investigated the reported hair bundle polarity phenotype in Emx2 knockout maculae (Holley et al., 2010) by examining the normal expression pattern of Emx2. Using both in situ hybridization and immunostaining, we found that Emx2 expression is restricted to the lateral extrastriolar region (LES) of the utricle and inner region (IR) of the saccule (Figure 1B,C,C’,F,F’, Figure 1—figure supplement 1A–F). The border of the Emx2 expression domain (Figure 1C’,F’, green line bordering the green region) closely follows the LPR in the two maculae, at the lateral edge of the oncomodulin-positive striola in the utricle and at the center of the saccule bisecting the striola (blue outlined; Li et al., 2008; Desai et al., 2005). The coincidence of the Emx2 border (green line) with the LPR (yellow line) was confirmed by comparing Emx2 immunoreactivity to hair bundle polarity. We used the absence of anti-spectrin staining at the kinocilium location for determining hair bundle polarity (Figure 1D–E’,G–H’; Deans et al., 2007). Using this approach, we found that only HCs lateral to the LPR in the utricle and internal to the LPR in the saccule are Emx2 positive and they show polarities different from the rest of the maculae (Figure 1D–E’,G–H’, arrows). These results indicate that Emx2 expression is restricted to one side of the LPR in the maculae that share the same hair bundle polarity.
Figure 1—figure supplement 1.
Expression of Emx2 in sensory organs of the mouse inner ear.
(A–B) Whole mount in situ hybridization of the utricle showing Emx2 hybridization domain (A; n = 3) lateral to that of the β-tectorin-positive striola (B; n = 3). Neither genes are expressed in the anterior and lateral cristae (AC and LC). (C–F) Section in situ hybridization of the utricle (C-D; n = 3) and saccule (E-F; n = 3) showing Emx2 expression (C,E) within the Lfng-positive sensory epithelium (D,F). Emx2 is not expressed in the striola (Lfng-negative, bracket) and lateral crista. (G–J’) Emx2 immunoreactivity is not detected in the lateral crista (G-H’; n = 6) or other cristae. In contrast, anti-Emx2 immunoreactivities are broadly detected in the cochlea (I–J’) including inner and outer HCs (n = 6; IHC, asterisk; OHC, bracket), as well as the Hensen’s and Claudius’ cell region (arrowhead, I–J’).
DOI:
http://dx.doi.org/10.7554/eLife.23661.003
The LES and IR regions are preserved in Emx2 maculae
Extrapolating from the normal restricted expression of Emx2 shown above and the unidirectional polarity phenotype previously reported in Emx2 knockouts (Holley et al., 2010) suggest that Emx2 has a role in regional hair bundle polarity patterning. However, since Emx2 encodes a transcription factor and has been implicated in regional patterning in other systems (Pellegrini et al., 1996; Miyamoto et al., 1997), the lack of LPR in Emx2 maculae could be caused by the loss of the Emx2 expression domain rather than altering the hair bundle polarity. Indeed, the area of the maculae was reported to be smaller in Emx2 mutants than wildtype (Holley et al., 2010). To address this possibility, we took a genetic approach. First, we lineage-traced the descendants of Emx2 expressing cells in wildtype by crossing Emx2mice (Kimura et al., 2005) to Cre reporter mice, Rosa or Rosa. The lineage-traced domain of Emx2 (Figure 2A–D,I–L) corresponded to its expression pattern (Figure 1C–H’), regionally restricted to the LES of utricle and IR of saccule. Within the Emx2-lineage domain of the two maculae (Figure 2B–C,J–K, green), hair bundles were oriented in the opposite direction from the rest of the sensory organ. The border of the lineage domain in the maculae (Figure 2A–C,I–K, cyan line) largely coincided with the LPR (yellow line). Immediately lateral or inside of the LPR in the respective utricle and saccule, there were occasional cre reporter-negative HCs with reversed polarity (Figure 2C,K, Figure 2—figure supplement 1, asterisks) but these cells were invariably positive for Emx2 immunostaining (Figure 1E’,H’, Figure 2—figure supplement 1, asterisks). By contrast, medial or outside of the LPR in the respective utricle and saccule, there were also cre-reporter positive HCs with default polarity (Figure 2C,K, Figure 2—figure supplement 1, arrowheads) but they were negative for Emx2 immunostaining (Figure 1E’H’, Figure 2—figure supplement 1, arrowheads). These cre-reporter positive HCs with default polarity were particularly abundant in the posterior-ventral region of the saccule where the border of Emx2-lineage domain and LPR diverged (Figure 2I, double-headed arrow). Overall, these results indicate that the border of the Emx2-lineage domain, though not as faithful as the immunostaining results, corresponds reasonably well with the LPR.
Figure 2—figure supplement 1.
Emx2 immunostaining in the Emx2 maculae correlates with the reversed hair bundle polarity.
In the utricle (A–F”) and saccule (G–L”), the lineage (A,D,G,J, blue) and expression (A’,D’,G’,J’, green) domains of Emx2 are both restricted to the LES and IR, respectively. (C,F,I,L) show Emx2 lineage (blue) and anti-spectrin staining (red). (C’,F’,I’,L’) and (C”,F”,I”,L”) are same regions as (C,F,I,L) showing lineage staining (blue) and anti-Emx2 staining (green) at the nucleus level of HCs, respectively. The LPR (C”,F”,I”,L”, yellow line) correlates with the border of Emx2 immunostaining (green line) better than the border of Emx2-lineage domain (C’,F’,I’,L’, cyan line). Asterisks label the Emx2-lineage negative HCs with reversed bundle polarity that are positive for Emx2 staining, whereas arrowheads label Emx2-lineage HCs with default bundle polarity that are negative for Emx2 immunoreactivity.
DOI:
http://dx.doi.org/10.7554/eLife.23661.007
The Emx2 lineage domain is present in Emx2 functional null maculae.
(A–C) and (I–K) are the same specimens as (C–E’) and (F–H’) in Figure 1. (A–C) In Emx2 utricles, the border of the Emx2 lineage domain (cyan line) coincides largely with LPR (yellow line), located at the lateral edge of the oncomodulin-positive striola (blue outlined; n=5). (C) HCs point toward each other (arrows) across the LPR. Asterisks label HCs that are negative for cre reporter signals but positive for Emx2 immunostaining (Figure 1E’; n=18), whereas arrowhead labels a HC that is cre-reporter positive but negative for Emx2 immunostaining (Figure 1E’; n=21). (D) A similar Emx2 lineage domain (GFP) is observed using a different Cre reporter, Rosa. (E–G) The Emx2 lineage domain (green) remained in Emx2 utricles, but hair bundle polarity in this region is reversed (G; n=5) compared to controls (C; n=5). (I–K) In Emx2 control saccules, the border of the Emx2 lineage domain (cyan line) mostly coincides with the LPR except in the ventral-posterior region (I, double-headed arrow). (K) Across the LPR, HCs are pointing away from each other (arrows). Asterisks label HCs that are negative for cre reporter signals but positive for Emx2 immunostaining (Figure 1H’; n=60), whereas arrowhead labels a HC that is cre-reporter positive but negative for Emx2 immunostaining (Figure 1H’; n=105). (L) A similar lineage domain (GFP) is observed using the Cre reporter Rosa. (M–O) In Emx2 mutant saccules, the border of the Emx2 lineage domain (cyan line) remained located in the middle of the striolar region (blue outline), but the hair bundles within the lineage domain are reversed (O; n=5), relative to controls (green region in K). (H) and (P) Schematics of respective utricles and saccules showing relationships among the Emx2 expression domain (green), hair bundle polarity pattern, LPR (yellow line) and striola (blue outlined) in controls and Emx2 mutants.DOI:
http://dx.doi.org/10.7554/eLife.23661.004
Sensory area quantifications for Emx2 mutant maculae.
DOI:
http://dx.doi.org/10.7554/eLife.23661.005
Total hair cell number in utricles of loss- and gain-of-function Emx2 mutants.
DOI:
http://dx.doi.org/10.7554/eLife.23661.006
Emx2 immunostaining in the Emx2 maculae correlates with the reversed hair bundle polarity.
In the utricle (A–F”) and saccule (G–L”), the lineage (A,D,G,J, blue) and expression (A’,D’,G’,J’, green) domains of Emx2 are both restricted to the LES and IR, respectively. (C,F,I,L) show Emx2 lineage (blue) and anti-spectrin staining (red). (C’,F’,I’,L’) and (C”,F”,I”,L”) are same regions as (C,F,I,L) showing lineage staining (blue) and anti-Emx2 staining (green) at the nucleus level of HCs, respectively. The LPR (C”,F”,I”,L”, yellow line) correlates with the border of Emx2 immunostaining (green line) better than the border of Emx2-lineage domain (C’,F’,I’,L’, cyan line). Asterisks label the Emx2-lineage negative HCs with reversed bundle polarity that are positive for Emx2 staining, whereas arrowheads label Emx2-lineage HCs with default bundle polarity that are negative for Emx2 immunoreactivity.DOI:
http://dx.doi.org/10.7554/eLife.23661.007
Mutant phenotypes of Emx2 and Emx2 embryos are similar to Emx2 mutants.
(A–B) The kidneys below the adrenal glands (dotted lines) are absent in Emx2 (B) compared to Emx2 embryos (A). (C) The size of the cortex is smaller in Emx2 than Emx2 embryos. Both kidney and cortical phenotypes have been described in Emx2 mutants (n=5; Pellegrini et al., 1996; Miyamoto et al., 1997). (D–G) In contrast to controls (D-E; n=3), the LPR (yellow line) is absent in Emx2 utricles (F–G; n=3) and hair bundle polarity defects are similar to those reported in Emx2 ears (Holley et al., 2010). The distribution of Prickle-like 2 (Pk2) immunostaining in Emx2 utricles is associated with the medial border of HCs (G), similar to control (E) and Emx2 utricles (Figure 6D–E). (H–K) Compared to controls (H–I; n=5), outer HCs are absent and two rows of poorly organized inner HCs with aberrant hair bundle polarity are evident in Emx2 cochlea (J-K; n=5), similar to the phenotypes reported in Emx2 knockout mutants (Holley et al., 2010).
Figure 6.
Hair bundle polarity reversal is associated with reversed Gαi but not Pk2 localization in Emx2 mutants.
(A) Schematic diagram illustrates the distribution of Pk2 and Gαi in HCs across the LPR of a control utricle. (B–C) In control utricles, Pk2 staining (green) is concentrated on the medial side of HC-supporting cell border across the LPR (n = 15). (D–G) In the lateral region of Emx2 (D-E; n = 5) and medial region of Gfi1 utricles (F-G; n = 4), in which the hair bundle polarity is reversed compared to the respective left and right side of the LPR in controls (C), Pk2 staining remained on the medial side (green). (H–M) In control utricles (H–I), Gαi immunostaining (green) is associated with the kinocilium. This relationship is consistent among all HCs of the utricle and the staining pattern of Gαi is reversed across the LPR (yellow line) (I; n = 8). A similar spatial relationship between Gαi and the kinocilium position is observed in Emx2 (J-K; n = 4) and Gfi1 (L-M; n = 5) utricles as controls. (N–O”) Sox2 utricles ( GOF-SE late) show mixed phenotypes including normal (black arrows), misoriented (blue arrows), and reversed (red arrows) kinocilia (n = 3). Some HCs with normal polarity show the abnormal Gαi distribution (asterisks).
DOI:
http://dx.doi.org/10.7554/eLife.23661.016
(A–B) In controls (n = 3), Vangl2 immunostaining (green) are restricted, stronger between adjacent supporting cells and weaker between HC and supporting cell junction. The staining pattern of Vangl2 is not changed across the LPR (Jones et al., 2014). (C–F) In the lateral region of Emx2utricle (C-D; n = 3) and medial region of Gfi1 utricle (E-F; n = 3), in which the hair bundle polarity is reversed compared to controls (B), there is no obvious change in the distribution of Vangl2 immunostaining. (G–L) In control utricles (G-H; n = 3), Par6 (green) is localized in the apical surface of HCs opposite to the kinocilium (H). This relationship between kinocilium and Par6 is consistent in all HCs and the staining pattern of Par6 is reversed across the LPR (yellow line). Similar relationship between Par6 immunostaining and kinocilium position (lack of phalloidin staining) is observed in Emx2 (I-J; n = 3) and Gfi1 (K-L; n = 3) utricles as controls. (M–N”) Activating Emx2 at a later age by administering tamoxifen at E15.5 and E16.5 causes mixed phenotypes in Sox2 utricles (GOF-SE late; n = 3): normal (black arrows), reversed (red arrows) or misoriented (blue arrows) kinocilia. In some HCs with normal hair bundle polarity, anti-Par6 distribution is no longer complementary to the kinocilium position (asterisks).
DOI:
http://dx.doi.org/10.7554/eLife.23661.017
In the GOF-SE late utricle (A–B"), hair bundles can be normal (black arrows), reversed (red arrows), or misoriented (blue arrows). However, the immunoreactivities of Pk2 is maintained on the medial side of HC-supporting cell boundary regardless of the hair bundle polarity.
DOI:
http://dx.doi.org/10.7554/eLife.23661.018
DOI:
http://dx.doi.org/10.7554/eLife.23661.008Encouraged by the lineage results, we investigated whether Emx2, in which Cre is inserted into exon1 of the Emx2 locus, generates a functional null. Our results showed that Emx2 and Emx2 embryos exhibit brain, kidney and ear phenotypes similar to Emx2 mutants indicating that Emx2 is a null allele (Figure 2—figure supplement 2; Pellegrini et al., 1996; Miyamoto et al., 1997). Thus, this Emx2 strain allowed us to investigate the Emx2-lineage domain in Emx2 functional null mutants. We observed that the Emx2-lineage domain remained in both maculae of Emx2 mutant ears. The spatial relationship of Emx2-lineage domain with the striola was maintained but hair bundle polarity within the domain was reversed (Figure 2E–H,M–P, green region) compared to controls (Figure 2C,K, green region). We also did not observe a reduction in the size of maculae (Figure 2—source data 1) or total HC number in the utricle (Figure 2—source data 2) of our Emx2 mutants. Taken together, our results indicate that the unidirectional hair bundle phenotype in Emx2maculae is not caused by the loss of a domain, rather Emx2 has a role in establishing regional bundle polarity in the maculae. Furthermore, the strong correlation between the border of Emx2 immunostaining domain and the LPR suggests that Emx2 has a cell-autonomous role in reversing bundle polarity.
Figure 2—figure supplement 2.
Mutant phenotypes of Emx2 and Emx2 embryos are similar to Emx2 mutants.
(A–B) The kidneys below the adrenal glands (dotted lines) are absent in Emx2 (B) compared to Emx2 embryos (A). (C) The size of the cortex is smaller in Emx2 than Emx2 embryos. Both kidney and cortical phenotypes have been described in Emx2 mutants (n=5; Pellegrini et al., 1996; Miyamoto et al., 1997). (D–G) In contrast to controls (D-E; n=3), the LPR (yellow line) is absent in Emx2 utricles (F–G; n=3) and hair bundle polarity defects are similar to those reported in Emx2 ears (Holley et al., 2010). The distribution of Prickle-like 2 (Pk2) immunostaining in Emx2 utricles is associated with the medial border of HCs (G), similar to control (E) and Emx2 utricles (Figure 6D–E). (H–K) Compared to controls (H–I; n=5), outer HCs are absent and two rows of poorly organized inner HCs with aberrant hair bundle polarity are evident in Emx2 cochlea (J-K; n=5), similar to the phenotypes reported in Emx2 knockout mutants (Holley et al., 2010).
DOI:
http://dx.doi.org/10.7554/eLife.23661.008
Timing of terminal mitosis of HC precursors in the Emx2 utricle is unchanged
Since Emx2 has been implicated in regulating cell divisions in the brain (Galli et al., 2002; Heins et al., 2001), hair bundle polarity defects in the Emx2 mutants could be indirectly related to the timing of terminal mitosis in the maculae. For example, sensory progenitors expressing Emx2 may remain in the cell cycle longer and fail to respond to polarity signal(s) that are instructing post-mitotic HCs in non-Emx2 regions. We addressed this possibility by comparing the timing of HC terminal mitosis between Emx2 heterozygous and knockout utricles. A thymidine analog, EdU, was injected intraperitoneally to pregnant dams between embryonic day (E) 11.5 to E16.5, and embryos were harvested at E18.5. Myosin VIIa-positive HCs with strong EdU labeling served as a proxy for the time of terminal mitosis. Although our results indicate that HC precursors in the LES (where Emx2 is normally expressed) undergo terminal mitosis later than the rest of the maculae, we did not observe any obvious difference in this timing between controls and Emx2 utricles (Figure 3). These results suggest that Emx2 does not affect hair bundle polarity indirectly via regulating the timing of terminal mitosis of HC precursors in the LES.
Figure 3.
Regional differences in timing of cell cycle exit are maintained in the Emx2 utricle.
(A–C’) E18.5 Emx2 utricles injected with EdU at E11.5 (A-A’; n = 3), E14.5 (B-B’; n = 3), or E16.5 (C-C’; n = 3) and harvested at E18.5 (G) were processed for anti-Myosin VIIa (HC marker), anti-oncomodulin (striolar marker), and incorporated EdU. Abundant labeling is observed in the striola when the utricle is exposed to EdU at E11.5 (A) and not at E14.5 (B) and E16.5 (C), whereas labeling in the MES is observed in all three ages but weakest at E16.5 (C). In contrast, EdU labeling is not apparent in the LES at E11.5 (A) but only at E14.5 and E16.5 (B,C). (D–F’) In Emx2 utricles, the regional differences of EdU labeling are similar to the controls. (H) A subdivision of the utricle into the oncomodulin-positive, striola (blue), LES (green) and MES (pink) domains. The red dotted line joining the two ends of the striola was used as an arbitrary division between the two ends of LES and MES. (I–I”) Triple labeling of the utricle with anti-Myosin VIIa (red), anti-oncomodulin (blue) and EdU (green). HCs that are triple-labeled (yellow arrowhead), EdU-positive HCs (white arrow) and EdU-positive non-HCs (blue arrow) are marked. (J) No significant differences in percentages of EdU-labeled HCs are observed between various regions of the Emx2 and Emx2 utricles (Figure 3—source data 1). Blue, green and pink lines represent the percentages of EdU-positive HCs in the striola, LES, and MES, respectively. Both Emx2 heterozygous and knockout utricles show the peak of EdU-positive HCs detected at E11.5 for the striola and MES, and at E13.5 for the LES.
DOI:
http://dx.doi.org/10.7554/eLife.23661.009
DOI:
http://dx.doi.org/10.7554/eLife.23661.010
Regional differences in timing of cell cycle exit are maintained in the Emx2 utricle.
(A–C’) E18.5 Emx2 utricles injected with EdU at E11.5 (A-A’; n = 3), E14.5 (B-B’; n = 3), or E16.5 (C-C’; n = 3) and harvested at E18.5 (G) were processed for anti-Myosin VIIa (HC marker), anti-oncomodulin (striolar marker), and incorporated EdU. Abundant labeling is observed in the striola when the utricle is exposed to EdU at E11.5 (A) and not at E14.5 (B) and E16.5 (C), whereas labeling in the MES is observed in all three ages but weakest at E16.5 (C). In contrast, EdU labeling is not apparent in the LES at E11.5 (A) but only at E14.5 and E16.5 (B,C). (D–F’) In Emx2 utricles, the regional differences of EdU labeling are similar to the controls. (H) A subdivision of the utricle into the oncomodulin-positive, striola (blue), LES (green) and MES (pink) domains. The red dotted line joining the two ends of the striola was used as an arbitrary division between the two ends of LES and MES. (I–I”) Triple labeling of the utricle with anti-Myosin VIIa (red), anti-oncomodulin (blue) and EdU (green). HCs that are triple-labeled (yellow arrowhead), EdU-positive HCs (white arrow) and EdU-positive non-HCs (blue arrow) are marked. (J) No significant differences in percentages of EdU-labeled HCs are observed between various regions of the Emx2 and Emx2 utricles (Figure 3—source data 1). Blue, green and pink lines represent the percentages of EdU-positive HCs in the striola, LES, and MES, respectively. Both Emx2 heterozygous and knockout utricles show the peak of EdU-positive HCs detected at E11.5 for the striola and MES, and at E13.5 for the LES.DOI:
http://dx.doi.org/10.7554/eLife.23661.009
Timing of terminal mitosis in utricular HCs of Emx2 mutants.
DOI:
http://dx.doi.org/10.7554/eLife.23661.010
Ectopic Emx2 reverses hair bundle polarity
If Emx2 directs hair bundle polarity, one would predict the ectopic expression of Emx2 in naïve (non-Emx2) HCs should alter their polarity. Thus, we generated Rosamice, modeled after the Cre reporter, Rosa (Rosa-Ai14; Madisen et al., 2010), such that Emx2 transcription can be activated in the presence of Cre. We first ectopically expressed Emx2 in all sensory epithelia of the inner ear by breeding Sox2(Arnold et al., 2011) to Rosa mice and administered tamoxifen to pregnant dams at E12.5/E13.5 (GOF-SE early). Compared to hair bundles pointing toward the LPR in control utricles (Figure 4A–C), the LPR was absent in GOF-SE early mutants. All hair bundles in the entire utricle were uniformly pointing toward the medial direction (Figure 4D–F,O–Q). This ability of ectopic Emx2 to reverse hair bundle polarity is developmentally dependent. By delaying the tamoxifen administration to E15.5 and E16.5 (GOF-SE late), at which time many HC precursors have undergone terminal mitosis and started to differentiate (Figure 3), only a partial polarity phenotype was observed in the medial utricle (Figure 4G–I,P–Q, region M). These results suggest that once the kinocilium position is established, it no longer responds to Emx2-dependent cues. Ectopic expression of Emx2 during early prosensory development also resulted in increased apical HC surface area and reduced HC density, which may not be related to the bundle polarity phenotype (Figure 4D–F,M–O). To better pinpoint the role of Emx2 in hair bundle polarity, we overexpressed Emx2 specifically in nascent HCs rather than all cell types in the prosensory domain using the Gfi1strain (Yang et al., 2010). In Gfi1 mutant utricles (GOF-HC), all HCs in the utricle were pointing towards the medial edge (Figure 4J–L,P–Q) even though the total HC number remained the same (Figure 2—source data 2). The hair bundle reversal in the medial utricle was approximately 180° different from controls (Figures 4P and 8K, compare region M between control and GOF-HC utricles). Similar findings were observed in the saccule: only the outer region (OR) of the saccule where Emx2 is not normally expressed showed a hair bundle reversal phenotype (Figure 5C–D,O) compared to controls (Figure 5A–B). Gain-of Emx2 function in naïve HCs also affected some of their endogenous properties since only a low percentage of Gfi1 maculae retained their oncomodulin staining (Figure 5C–D, n = 1/5).
Figure 4.
Ectopic Emx2 reverses hair bundle polarity in the utricle.
Compared to the medial side of the LPR in controls (A–C), hair bundle polarity (arrows) in the medial region of Sox2 (D-F, tamoxifen given at E12.5 and E13.5, gain-of-function (GOF) in the sensory epithelium (SE), GOF-SE early; n = 3) and Gfi1 utricles (J-L, GOF-HC (hair cell); n = 7) are reversed. (G–I) Sox2 utricles (tamoxifen give at E15.5 and E16.5, GOF-SE late) show a mixed phenotype of normal and reversed bundle polarities (white arrows, n = 3). Among the GOF specimen (D,G,J), anti-oncomodulin staining (blue) is only sparsely detectable in the GOF-HC utricles (J) compared to controls (A). (M–N) Quantification of HC density (M; Figure 4—source data 1) and surface area (N; Figure 4—source data 2) in Regions 1 and 3 of utricles from various genotypes (controls, n = 6; GOF-SE, n = 3; GOF-HC, n = 4). Only utricles of GOF-SE early show a significant decrease in HC density and an increase in the apical surface area of HCs compared to controls. Error bars represent SEM. *p<0.05; **p<0.01; ***p<0.001. (O) Schematic diagrams illustrating hair bundle polarity pattern and defined regions in control and Emx2 gain-of-function utricles. (P–Q) Box-plots of hair bundle polarity in regions L (LES) and M (MES) of utricles (Figure 4—source data 3). Region L of controls includes the LPR and thus show HCs with both medial and lateral polarities but only medial-pointing hair bundles are present in all Emx2 GOF utricles except GOF-SE late (control, n = 6; mutant, n = 3). Box represents quartiles 1 to 3. The line within the box is the median and the bar represents maximum and minimum number. **p<0.01, ***p<0.001, compared to controls.
DOI:
http://dx.doi.org/10.7554/eLife.23661.011
DOI:
http://dx.doi.org/10.7554/eLife.23661.012
DOI:
http://dx.doi.org/10.7554/eLife.23661.013
DOI:
http://dx.doi.org/10.7554/eLife.23661.014
Figure 5.
Ectopic Emx2 reverses hair bundle polarity in the saccule and cristae but not organ of Corti.
(A–D) Saccule, (E–J) anterior and lateral cristae (AC and LC), as well as (K–N) organ of Corti of Rosa (A–B, E–G, K–L) and Gfi1 (C–D, H–J, M–N) inner ears at E18.5 (n = 7). In the Gfi1 saccule, bundle polarity in the OR (outer region) is reversed by approximately 180° (C–D) compared to controls (A–B). (E–J) In control cristae, hair bundles point toward the anterior direction in the AC (F) and medial direction in the LC (G), whereas these polarities are reversed in AC (I) and LC (J) of Gfi1 ears, pointing toward posterior and lateral directions, respectively (H–J). (K–N) No difference in hair bundle polarity is apparent between control (K–L) and Gfi1 (M–N) organ of Corti. IHC, inner HCs (asterisk); OHC, outer HCs (bracket). (O) Schematic diagrams illustrating hair bundle polarity pattern in control and Emx2 GOF sensory organs of the inner ear.
DOI:
http://dx.doi.org/10.7554/eLife.23661.015
Ectopic Emx2 reverses hair bundle polarity in the utricle.
Compared to the medial side of the LPR in controls (A–C), hair bundle polarity (arrows) in the medial region of Sox2 (D-F, tamoxifen given at E12.5 and E13.5, gain-of-function (GOF) in the sensory epithelium (SE), GOF-SE early; n = 3) and Gfi1 utricles (J-L, GOF-HC (hair cell); n = 7) are reversed. (G–I) Sox2 utricles (tamoxifen give at E15.5 and E16.5, GOF-SE late) show a mixed phenotype of normal and reversed bundle polarities (white arrows, n = 3). Among the GOF specimen (D,G,J), anti-oncomodulin staining (blue) is only sparsely detectable in the GOF-HC utricles (J) compared to controls (A). (M–N) Quantification of HC density (M; Figure 4—source data 1) and surface area (N; Figure 4—source data 2) in Regions 1 and 3 of utricles from various genotypes (controls, n = 6; GOF-SE, n = 3; GOF-HC, n = 4). Only utricles of GOF-SE early show a significant decrease in HC density and an increase in the apical surface area of HCs compared to controls. Error bars represent SEM. *p<0.05; **p<0.01; ***p<0.001. (O) Schematic diagrams illustrating hair bundle polarity pattern and defined regions in control and Emx2 gain-of-function utricles. (P–Q) Box-plots of hair bundle polarity in regions L (LES) and M (MES) of utricles (Figure 4—source data 3). Region L of controls includes the LPR and thus show HCs with both medial and lateral polarities but only medial-pointing hair bundles are present in all Emx2 GOF utricles except GOF-SE late (control, n = 6; mutant, n = 3). Box represents quartiles 1 to 3. The line within the box is the median and the bar represents maximum and minimum number. **p<0.01, ***p<0.001, compared to controls.DOI:
http://dx.doi.org/10.7554/eLife.23661.011
Quantification of HC density in Emx2 gain-of-function mutants.
DOI:
http://dx.doi.org/10.7554/eLife.23661.012
Quantification of apical surface area of HCs in Emx2 gain-of-function mutants.
DOI:
http://dx.doi.org/10.7554/eLife.23661.013
Quantification of hair bundle orientation in Emx2 gain-of-function mutants.
DOI:
http://dx.doi.org/10.7554/eLife.23661.014
Ectopic Emx2 reverses hair bundle polarity in the saccule and cristae but not organ of Corti.
(A–D) Saccule, (E–J) anterior and lateral cristae (AC and LC), as well as (K–N) organ of Corti of Rosa (A–B, E–G, K–L) and Gfi1 (C–D, H–J, M–N) inner ears at E18.5 (n = 7). In the Gfi1 saccule, bundle polarity in the OR (outer region) is reversed by approximately 180° (C–D) compared to controls (A–B). (E–J) In control cristae, hair bundles point toward the anterior direction in the AC (F) and medial direction in the LC (G), whereas these polarities are reversed in AC (I) and LC (J) of Gfi1 ears, pointing toward posterior and lateral directions, respectively (H–J). (K–N) No difference in hair bundle polarity is apparent between control (K–L) and Gfi1 (M–N) organ of Corti. IHC, inner HCs (asterisk); OHC, outer HCs (bracket). (O) Schematic diagrams illustrating hair bundle polarity pattern in control and Emx2 GOF sensory organs of the inner ear.DOI:
http://dx.doi.org/10.7554/eLife.23661.015In addition to maculae, we also examined the impact of Emx2 in other sensory organs. In the vestibular system, hair bundles in cristae detect unidirectional fluid flow through semicircular canals and all three cristae exhibit a defined polarity. For example, hair bundles are all oriented toward the anterior direction in the anterior crista and medial direction in the lateral crista (Figure 5E–G, arrows), and Emx2 immunostaining was not detected in these HCs (Figure 1—figure supplement 1G–H’; Holley et al., 2010). In Gfi1 ears, hair bundle polarity in both anterior and lateral cristae was reversed (Figure 5H–J,O) compared to controls (Figure 5E–G). By contrast, in the organ of Corti, Emx2 is normally expressed in the HCs as well as the Hensen’s and Claudius’ cells (Figure 1—figure supplement 1I–J’; Holley et al., 2010). As a result, no hair bundle polarity abnormality was observed in the cochlea of Gfi1 mutants (Figure 5K–O), similar to the LES and IR. Consistent with the normal expression pattern of Emx2 and these GOF results, Emx2 mutants have no apparent phenotype in the cristae but the outer HCs are absent and inner HCs are poorly organized into two rows (Figure 2—figure supplement 2H–K; Holley et al., 2010). We attributed these cochlear phenotypes to an earlier requirement of Emx2 function in the organ of Corti prior to kinocilium positioning.The Gfi1mice survived until early postnatal ages and they exhibited balance deficits that are presumably caused by the polarity phenotype in the cristae and maculae. Taken together, these results suggest that Emx2 has a dominant, cell-autonomous effect in dictating hair bundle polarity pattern in the inner ear which is likely to be important for normal inner ear functions.
Distribution of intercellular and intracellular polarity components in Emx2 mutants
To determine how downstream effectors of Emx2 mediate hair bundle orientation, we investigated whether an intercellular polarity pathway, cPCP, responsible for hair bundle alignment was altered in Emx2 mutants. Comparing the distribution of some of the cPCP proteins such as Pk2 and Vangl2 between control and Emx2 mutant utricles, we confirmed that Pk2 immunoreactivity in control utricles is always concentrated on the medial side of the HC-supporting cell border despite the hair bundle polarity reversal across the LPR (Figure 6A–C; Deans et al., 2007). This expression pattern of Pk2 is maintained in both loss- and gain-of Emx2 function utricles, including the respective lateral and medial regions of mutants where the hair bundle polarity is reversed (Figure 6D–G, Figure 2—figure supplement 2F–G). Similar to Pk2, the distribution of Vangl2 in control utricles, though strongest between supporting cells, is not changed across the LPR (Figure 6—figure supplement 1A–B; Jones et al., 2014). This expression pattern of Vangl2 is also maintained in the Emx2 mutants (Figure 6—figure supplement 1C–F). Together, these results indicate that the distribution of intercellular polarity proteins in the utricle is not altered by loss- or gain- of Emx2 function and suggest that Emx2 functions independently or downstream of the cPCP complex.
Figure 6—figure supplement 1.
Distribution of Vangl2 and Par6 immunoreactivites in apical HCs is not changed in Emx2 mutant utricles.
(A–B) In controls (n = 3), Vangl2 immunostaining (green) are restricted, stronger between adjacent supporting cells and weaker between HC and supporting cell junction. The staining pattern of Vangl2 is not changed across the LPR (Jones et al., 2014). (C–F) In the lateral region of Emx2utricle (C-D; n = 3) and medial region of Gfi1 utricle (E-F; n = 3), in which the hair bundle polarity is reversed compared to controls (B), there is no obvious change in the distribution of Vangl2 immunostaining. (G–L) In control utricles (G-H; n = 3), Par6 (green) is localized in the apical surface of HCs opposite to the kinocilium (H). This relationship between kinocilium and Par6 is consistent in all HCs and the staining pattern of Par6 is reversed across the LPR (yellow line). Similar relationship between Par6 immunostaining and kinocilium position (lack of phalloidin staining) is observed in Emx2 (I-J; n = 3) and Gfi1 (K-L; n = 3) utricles as controls. (M–N”) Activating Emx2 at a later age by administering tamoxifen at E15.5 and E16.5 causes mixed phenotypes in Sox2 utricles (GOF-SE late; n = 3): normal (black arrows), reversed (red arrows) or misoriented (blue arrows) kinocilia. In some HCs with normal hair bundle polarity, anti-Par6 distribution is no longer complementary to the kinocilium position (asterisks).
DOI:
http://dx.doi.org/10.7554/eLife.23661.017
Hair bundle polarity reversal is associated with reversed Gαi but not Pk2 localization in Emx2 mutants.
(A) Schematic diagram illustrates the distribution of Pk2 and Gαi in HCs across the LPR of a control utricle. (B–C) In control utricles, Pk2 staining (green) is concentrated on the medial side of HC-supporting cell border across the LPR (n = 15). (D–G) In the lateral region of Emx2 (D-E; n = 5) and medial region of Gfi1 utricles (F-G; n = 4), in which the hair bundle polarity is reversed compared to the respective left and right side of the LPR in controls (C), Pk2 staining remained on the medial side (green). (H–M) In control utricles (H–I), Gαi immunostaining (green) is associated with the kinocilium. This relationship is consistent among all HCs of the utricle and the staining pattern of Gαi is reversed across the LPR (yellow line) (I; n = 8). A similar spatial relationship between Gαi and the kinocilium position is observed in Emx2 (J-K; n = 4) and Gfi1 (L-M; n = 5) utricles as controls. (N–O”) Sox2 utricles ( GOF-SE late) show mixed phenotypes including normal (black arrows), misoriented (blue arrows), and reversed (red arrows) kinocilia (n = 3). Some HCs with normal polarity show the abnormal Gαi distribution (asterisks).DOI:
http://dx.doi.org/10.7554/eLife.23661.016
Distribution of Vangl2 and Par6 immunoreactivites in apical HCs is not changed in Emx2 mutant utricles.
(A–B) In controls (n = 3), Vangl2 immunostaining (green) are restricted, stronger between adjacent supporting cells and weaker between HC and supporting cell junction. The staining pattern of Vangl2 is not changed across the LPR (Jones et al., 2014). (C–F) In the lateral region of Emx2utricle (C-D; n = 3) and medial region of Gfi1 utricle (E-F; n = 3), in which the hair bundle polarity is reversed compared to controls (B), there is no obvious change in the distribution of Vangl2 immunostaining. (G–L) In control utricles (G-H; n = 3), Par6 (green) is localized in the apical surface of HCs opposite to the kinocilium (H). This relationship between kinocilium and Par6 is consistent in all HCs and the staining pattern of Par6 is reversed across the LPR (yellow line). Similar relationship between Par6 immunostaining and kinocilium position (lack of phalloidin staining) is observed in Emx2 (I-J; n = 3) and Gfi1 (K-L; n = 3) utricles as controls. (M–N”) Activating Emx2 at a later age by administering tamoxifen at E15.5 and E16.5 causes mixed phenotypes in Sox2 utricles (GOF-SE late; n = 3): normal (black arrows), reversed (red arrows) or misoriented (blue arrows) kinocilia. In some HCs with normal hair bundle polarity, anti-Par6 distribution is no longer complementary to the kinocilium position (asterisks).DOI:
http://dx.doi.org/10.7554/eLife.23661.017
Distribution of Pk2 immunoreactivites in apical HCs is maintained in Emx2 GOF-SE late mutant utricles.
In the GOF-SE late utricle (A–B"), hair bundles can be normal (black arrows), reversed (red arrows), or misoriented (blue arrows). However, the immunoreactivities of Pk2 is maintained on the medial side of HC-supporting cell boundary regardless of the hair bundle polarity.DOI:
http://dx.doi.org/10.7554/eLife.23661.018The intracellular signaling complex, Insc/LGN/Gαi, is required to guide the migration of the kinocilium to its asymmetrical apical location in HCs (Ezan et al., 2013; Tarchini et al., 2013). This complex is distributed as a crescent shape that is always associated with the kinocilium at the apical surface of HCs (Ezan et al., 2013; Tarchini et al., 2013). In other systems, the Insc/LGN/Gαi complex is often associated with one of the members of Par membrane proteins (Di Pietro et al., 2016). By contrast, a Par protein, Par6, is found complementary to the Insc/LGN/Gαi complex in HCs and located opposite the kinocilium (Figure 6—figure supplement 1G–H; Ezan et al., 2013). The distribution patterns of Gαi and Par6 are reversed across the LPR, in alignment with the position of the kinocilium (Figure 6H–I, Figure 6—figure supplement 1G–H), in contrast to the cPCP proteins. These spatial relationships among Gαi, Par6, and the kinocilium are preserved in the loss- and gain- of Emx2 function mutants (Figure 6J–M, Figure 6—figure supplement 1I–L). However, in the GOF-SE late utricles, in which the hair bundle reversal phenotype was only partially penetrant, some of the HCs with normally-positioned kinocilia in the medial utricle showed mislocalization of Gαi and Par6 (Figure 6N–O”, Figure 6—figure supplement 1M–N”, black arrows with asterisks), whereas Pk2 localization remained unchanged (Figure 6—figure supplement 2). Therefore, these results suggest that by delaying ectopic Emx2 expression until after E15.5, while Emx2 can no longer change the position of kinocilia that has already been established, it can still effectively alter the distribution of Gαi and Par6. This suggests that downstream effectors of Emx2 may normally mediate hair bundle polarity by altering the intracellular polarity complex.
Figure 6—figure supplement 2.
Distribution of Pk2 immunoreactivites in apical HCs is maintained in Emx2 GOF-SE late mutant utricles.
In the GOF-SE late utricle (A–B"), hair bundles can be normal (black arrows), reversed (red arrows), or misoriented (blue arrows). However, the immunoreactivities of Pk2 is maintained on the medial side of HC-supporting cell boundary regardless of the hair bundle polarity.
DOI:
http://dx.doi.org/10.7554/eLife.23661.018
Blocking Gαi partially rescues the polarity reversal phenotype induced by ectopic Emx2
Blocking the Gαi activity with pertussis toxin (Ptx) or knocking out one of the genes that encodes Gαi, Gnai3, can lead to misoriented or reversed hair bundle polarity (Ezan et al., 2013; Tarchini et al., 2013) in cochlear HCs. The polarity-reversal phenotype is rarely observed among cPCP mutants (Montcouquiol et al., 2003; Wang et al., 2005, 2006) but resembles those in the Emx2 mutants. The relocated hair bundle to the same side of the HC in Ptx mutants where the cPCP protein Fz is located, is similar to other epithelial cells in the brain and wing, which we considered to be the default pattern (Strutt, 2001; Vladar et al., 2012; Tree et al., 2002; Boutin et al., 2014; Guirao et al., 2010). The bundle polarity phenotype caused by Ptx suggests that heterotrimeric G proteins are normally required to reverse the kinocilium from its default location in the cochlea. Since cochlear HCs express Emx2 and ectopic Emx2 is capable of affecting Gαi localization independent of the kinocilium (Figure 6N–O”), we hypothesized that Emx2 normally utilizes the Insc/LGN/Gαi complex to change the kinocilium from the default location in cochlear HCs. Under this scenario, Ptx should affect the hair bundle position in macular regions where Emx2 is expressed and may have no effect in the Emx2-negative regions. Additionally, Ptx should block polarity changes induced by ectopic Emx2.We tested this hypothesis by first examining hair bundle polarity in maculae overexpressing the catalytic S1 subunit of Ptx by crossing Rosa mice (Regard et al., 2007) with Foxg1 strain, in which Cre is activated early at the otic placode stage (Hébert and McConnell, 2000). Compared to controls (Figure 7A–B’,G–H’), hair bundle misorientation (blue arrows) and reversal (red arrows) were observed only in Emx2-positive, LES of utricles (Figure 7C–C’,E–F, 15%) and IR of saccules (Figure 7I–I’,K–L, 46%) of Foxg1 ears as predicted by the hypothesis. No apparent phenotype was observed in the Emx2-negative medial utricle or the OR of the saccule (Figure 7D–D’,E–F,J–J’,K–L). Despite the preferential hair bundle phenotype in the Emx2-positive regions, diffuse or reduced Gαi immunostaining was broadly evident, indicating that Ptx affected the entire mutant maculae (Figure 7C’,D’,I’,J’, arrowheads). These results indicate that Ptx affects the distribution of Gαi in macular HCs, similar to cochlear HCs (Ezan et al., 2013; Tarchini et al., 2013). Additionally, within the Emx2-positive domain, some Gαi staining was no longer associated with the kinocilium, regardless of whether the kinocilium location was normal or reversed (Figure 7C–C’,I–I’, asterisks). The uncoupling of Gαi and kinocilium observed in the Emx2-positive domains suggests a stronger effect of Ptx in these regions. More importantly, only the kinocilium positions within the Emx2-positive domain were affected by Ptx is consistent with the hypothesis that Ptx only affects the kinocilium position in the regions where Emx2 is expressed.
Figure 7.
Inhibition of Gαi reverses hair bundle orientation in the Emx2-positive domain of maculae.
(A–B’) In control utricles, hair bundles are pointing toward medial and lateral in the respective LES and MES (arrows), and Gαi staining (A’,B’) is associated with the kinocilium (A,B; n = 3). (C–D’) In Foxg1 utricles, hair bundles in the LES (C) are sometimes reversed (red arrows) or misoriented (blue arrows) but not in the MES (D; n = 3). The accumulation of Gαi in HCs is reduced across the utricle (C’,D’, arrowheads). Occasionally, uncoupling between the kinocilium and Gαi is found in HCs of the LES (C-C’, asterisks). (E,F) Quantification of the hair bundle orientation in regions L and M of control and Foxg1 utricles are plotted in a bar graph (E; Figure 7—source data 1) and circular histogram (F). HCs with the kinocilium positioned within 30°-150° are green (pointing medial), between 210°-330° are pink (pointing lateral), and intermediates (misoriented) are denoted by grey. In region L of mutants, 15% HCs showed abnormal hair bundle orientations. (G–J’) Compared to controls (G-H’; n = 3), reduced Gαi is observed across Foxg1 saccules (I-J’; n = 3) but misoriented (blue arrows) or reversed (red arrows) kinocilia are only found in the IR (I–I’) but not the OR (J–J’). (K–L) Quantification of hair bundle orientation pointing toward inner or outer margin are defined as 30°–150° (green) or 210°–330° (pink), respectively (Figure 7—source data 1). In the IR of mutants, 46% of hair bundles showed reversed or misoriented polarity. Red asterisks, arrows, and lines represent hair bundle reversal, misorientation, and average degree of HC orientation, respectively. Schematic diagrams indicate the locations of where the corresponding panels were taken as well as positions of all HCs with reversed hair bundles are found in the sample (red dots). **p<0.01, ***p<0.001.
DOI:
http://dx.doi.org/10.7554/eLife.23661.019
DOI:
http://dx.doi.org/10.7554/eLife.23661.020
Inhibition of Gαi reverses hair bundle orientation in the Emx2-positive domain of maculae.
(A–B’) In control utricles, hair bundles are pointing toward medial and lateral in the respective LES and MES (arrows), and Gαi staining (A’,B’) is associated with the kinocilium (A,B; n = 3). (C–D’) In Foxg1 utricles, hair bundles in the LES (C) are sometimes reversed (red arrows) or misoriented (blue arrows) but not in the MES (D; n = 3). The accumulation of Gαi in HCs is reduced across the utricle (C’,D’, arrowheads). Occasionally, uncoupling between the kinocilium and Gαi is found in HCs of the LES (C-C’, asterisks). (E,F) Quantification of the hair bundle orientation in regions L and M of control and Foxg1 utricles are plotted in a bar graph (E; Figure 7—source data 1) and circular histogram (F). HCs with the kinocilium positioned within 30°-150° are green (pointing medial), between 210°-330° are pink (pointing lateral), and intermediates (misoriented) are denoted by grey. In region L of mutants, 15% HCs showed abnormal hair bundle orientations. (G–J’) Compared to controls (G-H’; n = 3), reduced Gαi is observed across Foxg1 saccules (I-J’; n = 3) but misoriented (blue arrows) or reversed (red arrows) kinocilia are only found in the IR (I–I’) but not the OR (J–J’). (K–L) Quantification of hair bundle orientation pointing toward inner or outer margin are defined as 30°–150° (green) or 210°–330° (pink), respectively (Figure 7—source data 1). In the IR of mutants, 46% of hair bundles showed reversed or misoriented polarity. Red asterisks, arrows, and lines represent hair bundle reversal, misorientation, and average degree of HC orientation, respectively. Schematic diagrams indicate the locations of where the corresponding panels were taken as well as positions of all HCs with reversed hair bundles are found in the sample (red dots). **p<0.01, ***p<0.001.DOI:
http://dx.doi.org/10.7554/eLife.23661.019
Quantification of hair bundle orientation in Ptx mutants.
DOI:
http://dx.doi.org/10.7554/eLife.23661.020Next, we investigated whether hair bundle polarity reversal caused by ectopic Emx2 can be inhibited by Ptx. Since Foxg1 compound mutants are early lethal, we generated compound mutants of Emx2 and Ptx using Gfi1mice. First, HC-specific induction of Ptx in Gfi1 utricles (Figure 8) showed similar but milder polarity phenotypes than Foxg1 mutants (Figure 7). Only 7% of hair bundle in the LES were affected, whereas hair bundle polarity was normal in the MES of Gfi1 utricles (Figure 8C–D’,I–K). Additionally, a similar abnormality in Gαi distribution and its uncoupling from the kinocilium as Foxg1 maculae was observed (Figure 8C–D’, arrowheads and asterisks). Comparing Ptx single (Gfi1) with Ptx and Emx2 compound mutant utricles (Gfi1) revealed no significant change in hair bundle polarity in the LES (Figure 8C–C’,G–G’,I, 7% versus 9%). However, despite the absence of polarity defect in the medial utricle of Ptx mutants (Figure 8D–D’,I–K), a moderate but significant rescue of bundle polarity reversal induced by ectopic Emx2 (Figure 8E–F) was observed in Ptx and Emx2 compound mutants (Figure 8H–H’, yellow arrows, I, 22%). These results suggest that Ptx not only blocks endogenous hair bundle polarity within the Emx2 domain, it also rescues polarity effects induced by ectopic Emx2 in regions that is not normally affected by Ptx. Taken together, our results indicate Emx2 requires heterotrimeric G proteins in mediating hair bundle position.
(A–H’) Compared to Rosa controls (A–B), some hair bundles show reversed polarity in the LES (C–C’) but not the MES (D–D’) of Gfi1 utricles. Ectopic Ptx and Emx2 in Gfi1 utricles rescued -bundle polarity reversal in the MES (H–H’) but has no additional effect in the LES (G–G’). Red, blue and yellow arrows represent reversed, misoriented and rescued hair bundle polarity, respectively. Arrowheads and asterisks represent anti-Gαi staining that is reduced/diffuse or no longer associated with the kinocilium, respectively. Schematic diagrams indicate the locations where panels A-H were taken as well as the positions where reversed hair bundles were found (red dots). (I) Quantification of the hair bundle orientation (Figure 8—source data 1). Ptx causes abnormal hair bundle polarity in region L of controls (7%) and ectopic Emx2 (9%). Reversed hair bundle polarity induced by Emx2 in region M is partially rescued by ectopic Ptx (22%, **p<0.01; n = 3 for each group). (J) Plots of kinocilium location (red dots) in HCs within regions L and M of one specimen. (K) Circular histograms summarizing HC orientation distributions in regions L and M for each genotype indicated (n = 3). ***p<0.001. (L) Model of Emx2 effectors in kinocilium positioning by directly regulating the Insc/LGN/Gαi complex (purple) or indirectly regulating the interaction between intercellular (light blue) and intracellular polarity pathways.
(A–H’) Compared to Rosa controls (A–B), some hair bundles show reversed polarity in the LES (C–C’) but not the MES (D–D’) of Gfi1 utricles. Ectopic Ptx and Emx2 in Gfi1 utricles rescued -bundle polarity reversal in the MES (H–H’) but has no additional effect in the LES (G–G’). Red, blue and yellow arrows represent reversed, misoriented and rescued hair bundle polarity, respectively. Arrowheads and asterisks represent anti-Gαi staining that is reduced/diffuse or no longer associated with the kinocilium, respectively. Schematic diagrams indicate the locations where panels A-H were taken as well as the positions where reversed hair bundles were found (red dots). (I) Quantification of the hair bundle orientation (Figure 8—source data 1). Ptx causes abnormal hair bundle polarity in region L of controls (7%) and ectopic Emx2 (9%). Reversed hair bundle polarity induced by Emx2 in region M is partially rescued by ectopic Ptx (22%, **p<0.01; n = 3 for each group). (J) Plots of kinocilium location (red dots) in HCs within regions L and M of one specimen. (K) Circular histograms summarizing HC orientation distributions in regions L and M for each genotype indicated (n = 3). ***p<0.001. (L) Model of Emx2 effectors in kinocilium positioning by directly regulating the Insc/LGN/Gαi complex (purple) or indirectly regulating the interaction between intercellular (light blue) and intracellular polarity pathways.DOI:
http://dx.doi.org/10.7554/eLife.23661.021
Quantification of hair bundle orientation in utricles of Ptx single and Ptx and Emx2 compound mutants.
DOI:
http://dx.doi.org/10.7554/eLife.23661.022
Conserved role of Emx2 in establishing hair bundle polarity pattern
Since the LPR is conserved among vertebrates (Desai et al., 2005; Huss et al., 2010; Hammond and Whitfield, 2006), we asked whether Emx2 has a role in establishing the LPR in other species. We first investigated the chicken inner ear, which has an additional macular organ, the lagena, which exhibits the LPR. Our immunostaining results indicate that Emx2 is expressed in the LES and IR of the respective utricle and saccule in chicken (Figure 9A–B’,D). In the lagena, its expression is restricted to the region closer to the auditory sensory epithelium, the basilar papilla (Figure 9C–D). Consistent with the mouse, the border of the Emx2 expression domain (green line) coincides with the LPR (yellow line) in all three chicken maculae.
Figure 9.
Conserved expression of Emx2 in the three chicken maculae.
(A–C’) Anti-Emx2 immunostaining of the chicken utricle (A,A’), saccule (B,B’) and lagena (C,C’) at E12. (A–C) Anti-spectrin staining (red) shows opposite hair bundle orientation across the LPR (yellow line). In the same regions shown in (A), (B), and (C) but at the level of the cell body, the border (green line) of the Emx2-positive region (green) is restricted to only one side of the LPR: lateral region of the utricle (A’), inner region of the saccule (B’), and proximal region of the lagena, which is closer to the cochlea/basilar papilla (BP) (C’), respectively (n = 3). (D) Schematic diagrams of the chicken inner ear and its three macular organs.
DOI:
http://dx.doi.org/10.7554/eLife.23661.023
Conserved expression of Emx2 in the three chicken maculae.
(A–C’) Anti-Emx2 immunostaining of the chicken utricle (A,A’), saccule (B,B’) and lagena (C,C’) at E12. (A–C) Anti-spectrin staining (red) shows opposite hair bundle orientation across the LPR (yellow line). In the same regions shown in (A), (B), and (C) but at the level of the cell body, the border (green line) of the Emx2-positive region (green) is restricted to only one side of the LPR: lateral region of the utricle (A’), inner region of the saccule (B’), and proximal region of the lagena, which is closer to the cochlea/basilar papilla (BP) (C’), respectively (n = 3). (D) Schematic diagrams of the chicken inner ear and its three macular organs.DOI:
http://dx.doi.org/10.7554/eLife.23661.023The lateral line system is responsible for detecting water pressure changes, which allows aquatic vertebrates to participate in schooling behavior, avoid predators and catch preys (Chitnis et al., 2012). This system is made up of clusters of HCs called neuromast. Within each neuromast organ, HCs are arranged in pairs with their hair bundles pointing toward each other, aligned in either anterior-posterior (A-P) or dorsal-ventral (D-V) direction (depending on the neuromast) along the body axis (Figure 10A–B; López-Schier et al., 2004). Core PCP proteins also regulate hair bundle polarity in neuromasts but their normal distribution is similar between HCs with opposite bundle polarities (Mirkovic et al., 2012). These similarities to the maculae prompted us to investigate the role of emx2 in the neuromast.
Figure 10.
emx2 regulates hair bundle polarity in neuromasts.
(A) Surface view of an A-P and D-V oriented neuromast and a sagittal view of the cellular architecture of a neuromast in the lateral line of zebrafish. (B) HCs with opposite orientation are in a 1:1 ratio. (C–C”) An example and (C”’) quantification showing only HCs (parvalbumin-positive, blue) with hair bundles (phalloidin, red) oriented toward the posterior (C, asterisks) or ventral direction are positive for anti-Emx2 staining (green) in A-P and D-V neuromasts, respectively (55 neuromasts from 26 larvae, ***p<0.001; Figure 10—source data 1). (D–D”) An example and (D”’) quantification of HCs in emx2 knockouts showing all HCs are emx2-negative (D’) and pointing towards the same direction (36 neuromasts, 18 larvae, ***p<0.001; Figure 10—source data 1). (E–E”’) All hair bundles (visualized using m6b:βactin-GFP, red) are Emx2-positive (E’,E’’, green) and pointing toward the posterior in the A-P oriented neuromasts of gof mutants. (E’”) Quantification of hair bundle polarity in 43 A-P and D-V neuromasts from 23 larvae (Figure 10—source data 1). ***p<0.001. (F–J) In response to an anterior-to-posterior stimulus (F’) or posterior-to-anterior stimulus (G’) a similar percentage of wildtype HCs show mechanically-evoked increase in calcium levels (J; Figure 10—source data 2). Emx2 gof HCs only respond to an anterior-to-posterior stimulus (H’) and are inhibited by a posterior-to-anterior stimulus (I’). The heatmap indicates the change in calcium levels during the first half of the 2s-step stimulus (2 larvae and 4 neuromasts in control, 2 larvae and 7 neuromasts in emx2 gof). Error bar represents SEM.
DOI:
http://dx.doi.org/10.7554/eLife.23661.024
DOI:
http://dx.doi.org/10.7554/eLife.23661.025
DOI:
http://dx.doi.org/10.7554/eLife.23661.026
(A) Two targeted sites of deletion (red site 1 and green site 2) in exon1 of emx2 using CRISPR/Cas9 technology. Guide targets (blue), PAM sequences (red), and examples of deletions found are shown. (B–D) Utricle and (E–J) lateral crista of controls (B,E,F), emx2 knockout (C,G,H), and emx2 gain-of-function, m6b:emx2-mCherry, zebrafish (D,I,J). (B–D) The LPR is by the lateral edge of the utricle in zebrafish (B; n = 10), which is absent in emx2 knockout utricles (C; n = 13) as well as in gof (m6b:emx2-mCherry) utricles (D; n = 9). Based on phalloidin staining (red), HCs at the edge of emx2 knockout utricles point toward the lateral (inset in C), whereas HCs in the medial region of gof utricles now point toward the medial (inset in D), opposite from controls (inset in B). (E–J) Arrows indicate the direction of hair bundle polarity based on βactin-GFP label (red). Hair bundles in the lateral crista of control are pointing toward the anterior direction (E,F; n = 6) and this polarity is not affected in the emx2 knockout fish (G,H; n = 3) but reversed in the gof cristae (I,J; n = 3).
DOI:
http://dx.doi.org/10.7554/eLife.23661.027
emx2 regulates hair bundle polarity in neuromasts.
(A) Surface view of an A-P and D-V oriented neuromast and a sagittal view of the cellular architecture of a neuromast in the lateral line of zebrafish. (B) HCs with opposite orientation are in a 1:1 ratio. (C–C”) An example and (C”’) quantification showing only HCs (parvalbumin-positive, blue) with hair bundles (phalloidin, red) oriented toward the posterior (C, asterisks) or ventral direction are positive for anti-Emx2 staining (green) in A-P and D-V neuromasts, respectively (55 neuromasts from 26 larvae, ***p<0.001; Figure 10—source data 1). (D–D”) An example and (D”’) quantification of HCs in emx2 knockouts showing all HCs are emx2-negative (D’) and pointing towards the same direction (36 neuromasts, 18 larvae, ***p<0.001; Figure 10—source data 1). (E–E”’) All hair bundles (visualized using m6b:βactin-GFP, red) are Emx2-positive (E’,E’’, green) and pointing toward the posterior in the A-P oriented neuromasts of gof mutants. (E’”) Quantification of hair bundle polarity in 43 A-P and D-V neuromasts from 23 larvae (Figure 10—source data 1). ***p<0.001. (F–J) In response to an anterior-to-posterior stimulus (F’) or posterior-to-anterior stimulus (G’) a similar percentage of wildtype HCs show mechanically-evoked increase in calcium levels (J; Figure 10—source data 2). Emx2 gof HCs only respond to an anterior-to-posterior stimulus (H’) and are inhibited by a posterior-to-anterior stimulus (I’). The heatmap indicates the change in calcium levels during the first half of the 2s-step stimulus (2 larvae and 4 neuromasts in control, 2 larvae and 7 neuromasts in emx2 gof). Error bar represents SEM.DOI:
http://dx.doi.org/10.7554/eLife.23661.024
Quantification of hair bundle orientation in neuromasts of emx2 loss- and gain-of-function mutants.
DOI:
http://dx.doi.org/10.7554/eLife.23661.025
Quantification of calcium-activated HCs with oriented stimuli in emx2 gain-of-function neuromasts.
DOI:
http://dx.doi.org/10.7554/eLife.23661.026
Polarity phenotypes in the utricle and lateral crista of emx2 loss- and gain-of function zebrafish mutants.
(A) Two targeted sites of deletion (red site 1 and green site 2) in exon1 of emx2 using CRISPR/Cas9 technology. Guide targets (blue), PAM sequences (red), and examples of deletions found are shown. (B–D) Utricle and (E–J) lateral crista of controls (B,E,F), emx2 knockout (C,G,H), and emx2 gain-of-function, m6b:emx2-mCherry, zebrafish (D,I,J). (B–D) The LPR is by the lateral edge of the utricle in zebrafish (B; n = 10), which is absent in emx2 knockout utricles (C; n = 13) as well as in gof (m6b:emx2-mCherry) utricles (D; n = 9). Based on phalloidin staining (red), HCs at the edge of emx2 knockout utricles point toward the lateral (inset in C), whereas HCs in the medial region of gof utricles now point toward the medial (inset in D), opposite from controls (inset in B). (E–J) Arrows indicate the direction of hair bundle polarity based on βactin-GFP label (red). Hair bundles in the lateral crista of control are pointing toward the anterior direction (E,F; n = 6) and this polarity is not affected in the emx2 knockout fish (G,H; n = 3) but reversed in the gof cristae (I,J; n = 3).DOI:
http://dx.doi.org/10.7554/eLife.23661.027We found that in zebrafish, emx2 is expressed in half of the HCs, oriented towards the posterior or ventral direction within the respective A-P and D-V neuromast (Figure 10C–C’’’). To test the role of emx2 in establishing hair bundle polarity in zebrafish, we generated loss- and gain- of emx2zebrafish mutants. Using CRISPR/Cas9, we generated emx2 knockouts (Figure 10—figure supplement 1A). In emx2 knockouts, all hair bundles were uniformly polarized toward the anterior or dorsal direction in the respective A-P and D-V neuromasts (Figure 10D–D”’). In contrast, neuromasts of m6b:emx2-mCherry transgenic fish (emx2 gof), which overexpress emx2 under a HC-specific promoter myosin6b, showed hair bundles pointing only toward the posterior or ventral direction in A-P and D-V neuromasts, respectively (Figure 10E–E’’’). Additionally, in zebrafish utricle and cristae, we found the predicted polarity reversal phenotype in loss- and gain- of emx2 function larvae comparable to what we observed in mice (Figure 10—figure supplement 1B–J). Taken together, these results indicate that Emx2 has an evolutionarily conserved role in determining hair bundle polarity of sensory HCs and establishing the LPR.
Figure 10—figure supplement 1.
Polarity phenotypes in the utricle and lateral crista of emx2 loss- and gain-of function zebrafish mutants.
(A) Two targeted sites of deletion (red site 1 and green site 2) in exon1 of emx2 using CRISPR/Cas9 technology. Guide targets (blue), PAM sequences (red), and examples of deletions found are shown. (B–D) Utricle and (E–J) lateral crista of controls (B,E,F), emx2 knockout (C,G,H), and emx2 gain-of-function, m6b:emx2-mCherry, zebrafish (D,I,J). (B–D) The LPR is by the lateral edge of the utricle in zebrafish (B; n = 10), which is absent in emx2 knockout utricles (C; n = 13) as well as in gof (m6b:emx2-mCherry) utricles (D; n = 9). Based on phalloidin staining (red), HCs at the edge of emx2 knockout utricles point toward the lateral (inset in C), whereas HCs in the medial region of gof utricles now point toward the medial (inset in D), opposite from controls (inset in B). (E–J) Arrows indicate the direction of hair bundle polarity based on βactin-GFP label (red). Hair bundles in the lateral crista of control are pointing toward the anterior direction (E,F; n = 6) and this polarity is not affected in the emx2 knockout fish (G,H; n = 3) but reversed in the gof cristae (I,J; n = 3).
DOI:
http://dx.doi.org/10.7554/eLife.23661.027
Next, we investigated whether the unidirectional hair bundle polarity shown in emx2zebrafish mutants exhibit the predicted functional change in directional sensitivity. Specifically, we tested whether all HCs in A-P neuromasts only respond to stimulus from the anterior direction in emx2 gof fish. We used a fluid jet to stimulate control and emx2 gof neuromasts expressing m6b:GCaMP6s-CAAX in either the anterior or posterior direction and measured mechanically evoked calcium responses (Figure 10F–J). Our results showed that in controls, a similar proportion of HCs exhibited mechanically evoked calcium responses from either direction (Figure 10F–G’,J). In contrast, in emx2 gof A-P neuromasts, all HCs showed a robust increase in calcium during a stimulus directed towards the posterior, and a corresponding decrease in calcium when the stimulus was directed towards the anterior. Our calcium imaging results show that emx2 gof HCs only respond to anterior-to-posterior stimuli, which are consistent with the unidirectional posterior-pointing hair bundles in these mutants (Figure 10H–J). In support of these - hair bundle polarity defects, the emx2 gof larvae showed abnormal swimming behavior before their demise. We predict that Emx2 knockouts in both zebrafish and mouse are likely to change the directional sensitivity of their HCs and exhibit behavioral deficits if viable.
Discussion
Emx2 is a global polarity cue
The intrinsic polarity of individual cells within a tissue is regulated by global and intercellular polarity cues, which collectively give rise to the tissue’s polarity. The molecular mechanisms of these cross-talks are not well understood (Figure 8L). The regional expression pattern of Emx2 in the maculae and its role in reversing hair bundle polarity within its expression domain qualifies this transcription factor as a global polarity cue. Since distribution of the cPCP proteins in maculae is not changed between Emx2-positive and negative regions across the LPR suggests that HCs in the Emx2 domain normally do not undergo cellular rotation to acquire the polarity reversal pattern, as in the case of ommatidia formation in Drosophila (Jenny, 2010). Furthermore, the normal distribution of cPCP proteins in Emx2 mutants indicates that Emx2 effectors function either independently or downstream from the cPCP proteins.In most other epithelial tissues, trichomes or cilia are associated with the side of the cell where Fz is located and opposite to the side where Vangl and Pk are located (Strutt, 2001; Vladar et al., 2012; Tree et al., 2002; Boutin et al., 2014; Guirao et al., 2010). A similar pattern is observed in the medial utricle. However, the relationship between distribution of cPCP proteins and hair bundle polarity appears to be reversed in the presence of Emx2. For example, hair bundles in Emx2-positive domains are located opposite to the Fz expression in cochlear HCs and are associated with Pk in lateral utricular HCs (Figure 6C,E; Deans et al., 2007; Montcouquiol et al., 2006; Wang and Nathans, 2007). These results suggest that the interpretation of normal polarity cues is changed by Emx2.Although Emx2 does not normally function by regulating cPCP proteins but Emx2 changing downstream effectors of cPCP proteins remains a distinct possibility (Figure 8L). Regulating downstream effectors that resulted in altered tissue polarity has been reported when a cPCP component, pk, was disrupted in Drosophila (Gubb et al., 1999). The abnormal ratio of isoforms between pk and spiny-legs (pk:sple) does not affect the distribution of Dachsous or Fat but changes the effective dose of Dachs (atypical myosin), an effector of the Dachsous-Fat polarity pathway (Olofsson et al., 2014; Ayukawa et al., 2014; Ambegaonkar and Irvine, 2015). Consequently, localization of fz and strabismus (Vangl in mammals) as well as the trichomes are reversed in the wing and abdomen of fly mutants. In a similar manner, Emx2 could regulate downstream effectors of the cPCP proteins and alter the intrinsic hair bundle polarity (Figure 8L). The cPCP effectors are known to affect the cilia position in other systems (Park et al., 2006; Wong and Adler, 1993; Carvajal-Gonzalez et al., 2016a, 2016b) and centrioles/basal body positioning could be the level where the Emx2 effectors alter the interpretation of the intercellular polarity cues.
Emx2 mediates hair bundle positioning via the heterotrimeric G proteins
As a transcription factor, Emx2 regulates diverse cellular pathways such as regional specification, cell proliferation and fates (Pellegrini et al., 1996; Tole et al., 2000; Heins et al., 2001; Mallamaci et al., 2000). Therefore, it is possible that Emx2’s effects on hair bundle reversal is indirect, resulting from changing the HC fate or other cellular pathways. Nevertheless, whichever the pathway(s) might be, the outcome is a cell-autonomous switch in the location of the hair bundle by 180°, in part, via the heterotrimeric G proteins (Figure 8L). This conclusion is based on several lines of evidence. First, ectopic Emx2 is sufficient to relocate Gαi and Par6 even after the kinocilium is established suggests that Emx2 effectors regulate intracellular polarity signaling. Second, the ability of Ptx to block hair bundle polarity of Emx2-positive HCs in cochlea and maculae, though variable in efficiency among different mutant strains (Figures 7–8; Ezan et al., 2013; Tarchini et al., 2013), suggest that heterotrimeric G proteins are critical for this process. Third, the ability of Ptx to block ectopic Emx2’s effects on polarity further supports the requirement of G proteins by Emx2 effectors. Extrapolating from previous results (Ezan et al., 2013; Tarchini et al., 2013), Emx2 effectors most likely mediate the change in hair bundle position via the Insc/LGN/Gαi complex. Additionally, our results suggest that this Insc/LGN/Gαi complex is more important for Emx2-positive than negative regions and other mechanisms are required for targeting the kinocilium in Emx2-negative HCs. Taken together, our results illustrate a global polarity cue bypasses the cPCP proteins and functions at the intracellular level.
Other roles of Emx2
Our results link Emx2 to basal body positioning in sensory HCs. Notably, Emx2 has been implicated in regulating symmetric versus asymmetric cell division in the brain (Galli et al., 2002; Heins et al., 2001), which could also be a result of altering spindle orientation. Though speculative, it is possible that Emx2 effectors could function at multiple steps of a cell cycle: spindle orientation during mitosis and/or basal body positioning during differentiation. Identifying these effectors will be important. Furthermore, in both maculae and neuromasts, HCs with opposite hair bundle polarities are innervated by different populations of neurons that project, at least in the maculae, to different regions of the brain (Maklad et al., 2010; Nagiel et al., 2008; Pujol-Martí et al., 2014). These innervation patterns could be guided by downstream targets of Emx2, and Emx2 has also been implicated in mediating neuronal migration in the brain (Shinozaki et al., 2002). In summary, our results demonstrated a conserved role of Emx2 in mediating hair bundle polarity in sensory HCs. This largely unexplored cellular process of planar targeting of the cilium at the apical cell surface has profound effects on HC function and may have broader implications in other ciliated cells and neuronal pathfinding.
Materials and methods
Mouse strains
The Rosa(designated Rosa) mouse strain was generated by knocking in the cassette, attb-pCA promoter-lox-stop-lox-Emx2-T2A-Gfp-WPRE-polyA-attb, to the Rosa locus using integrase technology (conducted by Applied StemCell, Inc., Milpitas, CA, Tasic et al., 2011). One founder with the correct insertion, identified based on PCR analyses, was propagated and maintained in the FVB background. Primers used for genotyping offspring are as follow: PR425 (GGTGATAGGTGGCAAGTGGTATTC) and pCA-R2 (GGCTAT GAACTAATGACCCCGT) for the Rosa allele, and R10 (CTCTGCTGCCTCCTGGCTTCT) and R11 (CGAGGCGGATACAAGCAATA) for the wildtype allele with expected fragment sizes of 369 and 311 base pairs, respectively.Emx2mice were provided by Peter Gruss at the Max-Planck Institute (RRID:IMSR_EM:00065; Pellegrini et al., 1996) and maintained in a mixed C57BL/6J and CD1 background. Emx2mice were obtained from Shinichi Aizawa at RIKEN Center for Developmental Biology and maintained in the C57BL/6J background (RRID:IMSR_RBRC02272; Kimura et al., 2005). Gfi1knock-in mice were obtained from Lin Gan at University of Rochester (RRID:MGI:4430834; Yang et al., 2010]), Sox2mice from Konrad Hochedlinger at Harvard University (RRID:IMSR_JAX:017593; Arnold et al., 2011), and the Foxg1mice from Susan McConnell at Stanford University (RRID:IMSR_JAX:004337; Hébert and McConnell, 2000). Rosa mice were generated by Shaun Coughlin at University of California at San Francisco (RRID:MGI:3784870; Regard et al., 2007) and provided by Yingzi Yang at Harvard Medical School. Gfi1and Sox2strains were maintained in a CD-1 background, while Foxg1 strain was maintained in a mixed background of C57BL/6J and Swiss Webster. Rosa26R (designated Rosa, RRID:IMSR_JAX:007914, Madisen et al., 2010) and Rosa26R (designated Rosa, RRID:IMSR_JAX:007576, Muzumdar et al., 2007) were purchased from Jackson laboratory and maintained in a C57BL/6J background. All animal experiments were conducted under approved NIH animal protocols (#1212-14, #1362-13) and according to NIH animal user guidelines.
Zebrafish strains
Zebrafish were maintained under standard conditions. All transgenic fish were maintained in a TAB5 wildtype background (S Burgess, NIH). The transgenic line, Tgmyosin6b:emx2-p2A-nls-mCherry, designated as m6b:emx2-mCherry, was generated using a Gateway cloning Technology. First, a middle entry clone, pME-emx2, was constructed using a zebrafishemx2 cDNA clone (IMAGE: 7403786) with PCR primers encoding attB sites: attB1 emx2 forward primer (GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGTTTCAACCCACACCGAAGAGGTG) and attB2 emx2 reverse primer (GGGGCACTTTGTACAAGAAAGCTGGGTGATCGTCTGAGGTGACGTCAATTTCCTC). Then, the myosin6b:emx2-p2A-nls-mCherry plasmid was constructed using a 5’ entry clone containing the HC-specific promoter of 6myosin6b (Obholzer et al., 2008), the middle entry clone pME-emx2, a 3’ entry clone encoding p2A-nuclear localized mCherry (p3E-p2A-nls-mCherry, gift from Kristen Kwan at the University of Utah), and a destination vector containing the transgensis marker pcmcl2-gfp (tol2kit #395; Kwan et al., 2007). Larvae injected with this plasmid at the one-cell stage were selected based on the GFP signal within the heart and raised to adulthood. These founders were bred to wildtype or to the previously described transgenic line, Tgmyo6b:βactin(actb1)-EGFP, designated as m6b:βactin-GFP fish (Kindt et al., 2012)for hair bundle polarity analyses. Double transgenic fish were identified based on green hair cells (βactin-GFP) and mCherry-positive nuclei (emx2).Knockout emx2zebrafish were generated using CRISPR/Cas9 technology as described (Varshney et al., 2015). Two target sites on Exon1 of emx2 were chosen for generating guide RNA: GGTAAAACACCTCTTCGGTGTGG and GGCTTTCACTCCAGCGGCAGGGG (Figure 10—figure supplement 1A). Genotyping of injected larvae and F1 larvae was conducted by PCR using the primers emx2-fPCR-Fwd (TCACTTAAACTGGGGAATCTTGA) and emx2-fPCR-Rev (GGAGGAGGTACTGAATGGACTG), followed by subcloning and sequencing of the PCR fragments. F1 generated fish were analyzed for hair bundle polarity between 3 to 5 days post fertilization (dpf).To create a transgenic line for calcium imaging to examine the directional sensitivity of HCs, a middle entry GCaMP6s-CAAX clone was created. This version of GCaMP6s was modified for zebrafish and has been used previously (Tabor et al., 2014). From the tol2 kit, vectors p3E-polyA (301) and pDestTol2CG2 (395), were recombined with p5E-6myosin6b (Kindt et al., 2012), and the middle entry GCaMP6s-CAAX to create Tgmyosin6b:GCaMP6s-CAAX, designated as m6b:GCaMP6s-CAAX. Then, double transgenic fish expressing emx2 and GCaMP6s-CAAX was generated by crossing emx2 gof with Tgmyosin6b:GCaMP6s-CAAX and screened for larvae expressing green HCs (GCaMP6s-CAAX) with mCherry-positive nuclei (emx2).
In situ hybridization
Section and whole mount in situ hybridization of the utricle and saccule were performed as described previously (Morsli et al., 1998). In situ probes for Emx2 (Simeone et al., 1992), β-tectorin (Rau et al., 1999), and Lfng (Morsli et al., 1998) were prepared as described.
Whole mount immunostaining
In general, E18.5 mouse embryos were harvested and fixed with 4% paraformaldehyde in PBS at 4°C overnight. For anti-Pk2 and anti-Vangl2 staining, hemi-sectioned embryo heads were fixed for 30 min at 4°C. After fixation, samples were washed with PBS and various inner ear sensory organs were dissected, blocked with PBS containing 0.2% Triton-X and 4% donkey serum for 30 min before incubating with primary antibodies diluted in blocking solution overnight at 4°C. Then, samples were washed extensively with PBS before incubating with secondary antibodies at 1:250 dilutions in blocking solution for 2 hr at room temperature. Samples were mounted with ProLong Gold Antifade (Invitrogen) after extensive washing with PBS and imaged with a Zeiss LSM780 confocal microscope. All low power immunostaining pictures are composite images taken at 40x magnification.For staining zebrafish larvae, 3–5 dpf embryos were fixed with 4% paraformaldehyde in PBS for 3.5 hr at 4°C. Post-fixed larvae were rinsed with PBS and treated with pre-chilled acetone for 3–5 min at −20°C. Then, larvae were incubated with a blocking solution (2% goat serum, 1% BSA in PBS solution for 2 hr at room temperature), followed by incubation with primary antibodies diluted in PBS with 1% bovineserum albumin (BSA) at 4°C overnight. The next day, larvae were washed four times with PBS for 5 min each before incubating with secondary antibodies at 1:250 dilutions in blocking solution for 2 hr at room temperature. Then, larvae were washed and mounted with Antifade and imaged with a Zeiss LSM780 confocal microscope.Primary antibodies used in this study are listed as follow: mouse anti-βII-spectrin (1:500; BD Biosciences Cat# 612562 RRID:AB_399853), rabbit anti-Emx2 (1:250; KO609, Trans Genic, Fukuoka, Japan), rabbit anti-Gαi (1: 1000; provided by B. Nurnberg; (Gohla et al., 2007; Ezan et al., 2013), goat anti-oncomodulin (1:250; Santa Cruz Biotechnology Cat# sc-7446 RRID:AB_2267583), rabbit anti-Pard6 (1:250; Santa Cruz Biotechnology Cat# sc-67393 RRID:AB_2267889), mouse anti-parvalbumin (1:5000; Millipore Cat# MAB1572 RRID:AB_2174013), rabbit anti-Pk2 (1:250; Deans et al., 2007) and goat anti-Vangl2 (1:250; Santa Cruz Biotechnology Cat# sc-416561 RRID:AB_2213082). In addition, two rabbit polyclonal antibodies, anti-Pk2 and anti-Emx2 were generated for this study (Thermo Fisher Scientific, Waltham, MA) using the synthetic peptide of Pk2 as described (Deans et al., 2007) and the full-length mouseEmx2 protein, respectively. Both antibodies were affinity-purified and used at a 1:1000 dilution and show immunostaining patterns indistinguishable from those of the anti-Pk2 and anti-Emx2 described above. Fluorescence-labeled phalloidin (1:50; #F432, Thermo Fisher Scientific, Waltham, MA) was used to visualize actin in the stereocilia on top of sensory HCs.Secondary antibodies that were used in these studies are listed as follow: Alexa Fluor 405 Donkey anti rabbit IgG (ab175651, Abcam, Cambridge, MA), Alexa Fluor 405 Donkey anti mouse IgG (ab175658, Abcam, Cambridge, MA), Alexa Fluor 405 Donkey anti goat IgG (ab175664, Abcam, Cambridge, MA), Alexa Fluor 488/568/647 Donkey Anti-Rabbit IgG (Thermo Fisher Scientific Cat# A21206 RRID:AB_2535792/Cat# A10042 RRID:AB_2534017/Cat# A-31573 RRID:AB_2536183), Alexa Fluor 488/568/647 Donkey Anti-Mouse IgG (Thermo Fisher Scientific Cat# A-21202 RRID:AB_2535788/Cat# A10037 RRID:AB_2534013/Cat# A-31571 RRID:AB_162542), Alexa Fluor 488/568/647 Donkey Anti-Goat IgG (Thermo Fisher Scientific Cat# A-11055 also A11055 RRID:AB_2534102/Cat# A-11057 RRID:AB_2534104/Cat# A-21447 RRID:AB_2535864), Alexa Fluor 647Goat Anti-Mouse IgG (Thermo Fisher Scientific Cat# A-21235 RRID:AB_2535804), and Alexa Fluor 568Goat Anti-Rabbit IgG (Molecular Probes Cat# A-11011 RRID:AB_143157).
Tamoxifen administration
A stock solution of 30 mg tamoxifen (T5648, Sigma Aldrich, St. Louis, MO) in 1 ml of corn oil was prepared. To avoid premature abortion of fetuses due to tamoxifen, 0.2 mg β-estradiol (20 mg/ml of ethanol; E8875, Sigma Aldrich, St. Louis, MO) was added per ml of tamoxifen stock solution. On designated gestation days at noon, pregnant females were gavaged with the tamoxifen containing β-estradiol stock solution at 1 mg/10 g body weight. The morning of a found plug was considered as embryonic day 0.5.
EdU administration and cell cycle exit analysis
Pregnant mice were injected intraperitonealy with 5-ethynyl-2'-deoxyuridine (EdU; 1 mg/ml solution; Thermo Fisher Scientific, Waltham, MA) three times (10 am, 12 pm and 2 pm) on a given day between embryonic day (E) 11.5 and E16.5 at an amount of 10 mg EdU/g of body weight, and all embryos were harvested and fixed with 4% paraformaldehyde at E18.5 (Figure 3G). EdU-labeled cells were detected with a Click-iT reaction (Bok et al., 2013; Thermo Fisher Scientific, Waltham, MA). Processed utricles were then flat-mounted and imaged using LSM780 confocal microscopy.Under this injection regiment, HC precursors that underwent terminal mitosis soon after EdU incorporation should be strongly labeled, whereas precursors that have already exited from the cell cycle at the time of EdU delivery should not be labeled. HC precursors that underwent several rounds of cell division after EdU incorporation should have weak or no EdU labeling in the nucleus. Since weak EdU labeling can also be a result of HC precursors that incorporated EdU at the end of S phase of the last cell cycle, we scored all Myosin VIIa-positive HCs that have robust or distinct EdU labeling in the nuclei (Figure 3I). For quantification of EdU-labeled HCs, the utricle was divided into three regions: striola, lateral and medial extrastriolar regions (LES and MES). Oncomodulin-positive region was marked as striola. The separation between LES and MES was defined by drawing a straight line linking the two ends of oncomodulin-positive striolar region to the edge of the utricle as shown in Figure 3H. Approximately 300, 450, and 500 HCs were counted in the striola, LES and MES of each utricle, respectively.
Quantification and statistical analyses
For quantification of HC density and surface area in the utricle, a straight A-P line between the two widest points of a given utricle along the anterior-posterior axis was drawn on a stitched confocal image taken at 40x magnification. Two lines perpendicular to the A-P line, marking the middle-third region were drawn and this region was sub-divided into four equal parts marked as 1, 2, 3, and 4 (Figure 4O). Within regions 1 and 3, total number of HCs per 0.01 mm2 and apical surface area of HCs were scored as representatives for the lateral and medial region of the utricle, respectively.For hair bundle orientation analyses, regions 1 and 3 were further divided into three equal sections. Hair bundle angles were measured in the middle one-third, defined as regions L (lateral) and M (medial, Figure 4P). Each region contains at least 50 HCs. The hair bundle angle of each HC was measured based on the position of the kinocilium on the apical surface by defining 0° as the anterior apex of the utricle and the medial side as 90o. Since LPR falls within region L of controls, we identified two different groups of HCs in controls (Figure 4Q).In Ptx alone or Emx2 and Ptx epistatic experiments of utricles, we defined HC polarity between 30-150° as pointing medial (Figures 7E–F and 8I,K, green) and between 210-330° as pointing lateral (Figures 7E–F and 8I,K, pink). Polarities of hair bundles that are outside of these ranges are considered misorientated (Figures 7E and 8I, grey, and Figures 7F, 8K, white). In order to avoid confusion in accessing polarity phenotypes of mutants, oncomodulin-positive HCs in control and Ptx specimens of region L, in which HCs are pointing toward the lateral edge were not included in the quantification of hair bundle angles shown in regions L of Figures 7E–F and and 8I–K.To quantify the hair bundle orientation in the saccule, a line drawn along the notch of the saccule was defined as the anterior-posterior axis. Then a perpendicular dorsal-ventral line was drawn, which bisected the A-P line into two halves. We defined the dorsal end as 0° and the posterior end as 90°. Three 50 µm2 squares in the anterior region of the IR and OR were selected and hair bundle polarity within were scored (Figure 7K). These regions were selected to avoid variation in polarity among HCs of controls and to specifically exclude the striola, which is bisected by the LPR in the saccule (Figures 1B,H and 2P). At least 50 HCs were counted from each region. hair bundle polarity in the IR and OR of a normal saccule is between 30°–150° (Figure 7K–L, green) and 210o−330° (Figure 7K–L, pink), respectively. The hair bundle polarity of HCs outside of these two ranges is considered misorientated (Figure 7K, grey and 7L, white).Statistical analyses of our quantification were performed using Prism 5 (GraphPad Soft-ware). HC density, apical surface area of HC, and hair bundle orientation were analyzed using an unpaired Student’s t test or one-way ANOVA with the appropriate post hoc test.
Calcium imaging
For calcium imaging, measurements were made as previously described (Kindt et al., 2012; Zhang et al., 2016). Briefly, larvae were anesthetized with 0.03% 3-amino benzoic acid ethylester (MESAB, Western Chemical, Ferndale, WA) in E3, and mounted with tungsten pins onto a Sylgard recording chamber. Larvae were then microinjected in the heart with 125 μM α-bungarotoxin (Tocris, Bristol, UK) to suppress muscle activity. After paralysis, calcium imaging was performed in extracellular solution in mM: 130 NaCl, 2 KCl, 2 CaCl2, 1 MgCl2 and 10 HEPES, pH 7.3, 290 mOsm. A pressure clamp (HSPC-1, ALA Scientific, New York, NY) attached to a glass pipette (tip diameter ~30–50 μm) was filled with extracellular solution and used to mechanically stimulate HCs along the anterior-posterior axis of the fish. Calcium measurements were made on a Nikon Eclipse NiE microscope using a 60 × 1.0 NA CFI Fluor water-immersion objective and the following filter set: excitation: 480/30 and emission: 535/40. The microscope was equipped with an Orca D2 camera (Hamamatsu, Hamamatsu City, Japan), and images were acquired using Elements software (Nikon Instruments Inc., Melville, NY).In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your manuscript "Transcription factor Emx2 to eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous. As you will see, all of the reviewers were impressed with the importance and novelty of your work. I was, too.I am including the three reviews (lightly edited) at the end of this letter, as there are a variety of specific and useful suggestions in them.Reviewer #1:In the manuscript "Transcription factor Emx2 controls stereocilia polarity of sensory hair cells" by Tao Jiang and colleagues, the role of the transcription factor Emx2 is analyzed within the context of the polarization of mechanosensory hair cells in the murine inner ear, as well as the ear of the chicken and the ear and lateral line of zebrafish.This manuscript tackles an important question, and a problem that has remained puzzling. It is well written and generally of very high quality. Overall, I believe that it will have a major impact and be of general interest. I support its publication.Reviewer #2:This manuscript describes the role of Emx2 in the development of planar polarity and specifically the role of Emx2 in coordinating the orientation of polarized stereociliary bundles about a line of polarity reversal (LPR) in the utricular and saccular maculae. This effort builds upon a prior study of Emx2 mutants that showed loss of the LPR and vestibular hair cells with bundles oriented in a single, uniform direction (Holley et al). The current work provides an in-depth analysis of Emx2 expression, characterization of a complementary overexpression model, and establishes a regulatory connection with the Gαi/Par signaling pathway. Based upon this body of work Emx2 is proposed to function as a global regulator of planar polarity, and principles of this function are shown to be conserved in zebrafish and chick. This is an important contribution to the planar polarity and inner ear research fields. Unfortunately, the figures are assembled in a very dense style which in some instances is a disservice to the complicated and beautiful anatomy of the system and may be difficult to interpret by readers outside of the inner ear field.1) inconsistencies between Emx2 and stereociliary bundle orientationEmx2 lineage tracing data presented in Figure 2C and K each reveal hair cells with stereociliary bundle orientations that match the lateral region of the utricle (2C) or the inner region of the saccule (2K), but do not show evidence of Emx2 activity. This contradicts an untested theme of the manuscript that Emx2 (b/c it is a transcription factor) functions autonomously within cells to direct stereociliary bundle orientation.An alternative interpretation raised by this lineage tracing data is that Emx2 functions non-cell autonomously. – Perhaps by regulating the expression of a short range secreted factor that is sufficient to initiate all of the cell polarity functions attributed to Emx2. At a minimum, the difference between Emx2 lineage tracing and stereociliary bundle orientation should be a point of discussion. Preferably experiments can be conducted to test the autonomy of the Emx2 mutant phenotype or whether this difference is corrected postnatally.2) No evaluation of maculae size or areaIn the original Holley et al. paper it was reported that, in addition to the changes in stereociliary bundle orientation, there was a reduction in the overall area of the sensory epithelia of the saccule. This could be interpreted as evidence that this region of the saccule is specified by Emx2, and as a result is missing in Emx2 mutant thereby yielding a smaller saccule. The authors could address this lingering interpretation of the Holley et al. study, that Emx2 has a role in specification (in addition to or rather than global polarity), by measuring sensory epithelia area for the utricle and saccule in these Emx2 mutant lines. This would be a complement to the EDU experiments already presented.3) Incomplete analysis of late-stage Emx2 overexpression (Sox2) experimentsBased upon experiments in which Emx2 expression is activated at later stages of development it is proposed that Emx2 regulates stereociliary bundle orientation by directing the polarized distribution of Gαi/Par6 relative to the core PCP axis. In these experiments Emx2 is proposed to rapidly alter Gαi or Par6 distribution but occurs too late to alter stereociliary bundle orientation. However, in each figure there are also hair cells with misoriented stereociliary bundles that do not appear to have either a lateral or a medial orientation (blue arrows). Investigating the basis of these hair cells further may provide mechanistic insight.One possibility is that the distribution of PCP proteins are also changed in these cells and that these bundles remain properly oriented along this new PCP protein axis – independent of Gαi. This could be evaluated by looking at Pk2 distribution in Sox2 tissue. A second possibility is that the stereociliary bundles are dynamically reorienting in response to the Emx2-dependent changes in Gαi or Par6 distributions, and that hair cells represented by blue arrows in these figures are actually in a transition state. This latter point could be evaluated by looking at a later stage when reorientation might be complete.Other concerns:1) For Figure 2O, this image should span the Emx2 boundary (similar to 2C, 2G and 2K) in order to demonstrate these hair cells have the same orientation in Emx2 mutants.2) It is very difficult to see the polarity of hair cells in Figure 7. Are the overview images necessary and if removed could the hair cell images be enlarged?3) In Figure 3 black boxes obscure the lateral region of the utricle in several panels.4) Several instances where triple labeling is presented that might not be critical for presentation or data interpretation. Simplifying the figures might make the data more accessible. For example, 1E' and 1H' do not need the red channel, similarly in Figure 3 the relative distribution of EDU and the striola could be easier to see without myosin VII labeling (red, 3A', 3D', etc.)5) Text and grammatical errors are present throughout.A) 'Stereocilia bundle' is not the correct term for this structure. It is either a 'bundle of stereocilia' or a 'stereociliary bundle'.B) 'Stereocilia polarity' is similarly not an accurate term. Individual stereocilia do not show planar polarity and instead are polarized based upon actin filament organization and the position of the barbed end. The organization that is being referred to in the manuscript is the 'polarity of the stereociliary bundle' and it should be described as such.Reviewer #3:The manuscript by Jiang et al. reports the identification of the transcription factor Emx2 as a global regulator of hair bundle orientation in vertebrates. Specifically, hair bundles of sensory hair cells in vertebrate maculae and in zebrafish neuromasts adopt mirror-image polarity along the line of polarity reversal (LPR). Polarity reversal in one domain was found to correlate with Emx2 expression in all species examined (mouse, chick and zebrafish). The authors then performed a series of elegant genetic manipulations in mice and zebrafish to demonstrate that Emx2 is both necessary and sufficient to pattern and re-pattern hair bundle polarity in a cell-autonomous manner. Importantly, the effect of Emx2 on hair bundle polarity was not due to a loss of the Emx2 expressing cell lineage or altered timing of cell cycle exit in the affected region, indicating a specific effect on polarity establishment. At a mechanistic level, the authors provided evidence that Emx2 mediates polarity reversal in part through heterotrimeric G protein signaling. Interestingly, G protein signaling is not required for the "default" orientation of hair bundles in regions where Emx2 is not expressed, suggesting the existence of additional polarity mechanisms. Finally, calcium imaging in zebrafish demonstrated that Emx2-mediated polarity reversal is important for neuromast hair cells' directional response to mechanical stimuli.While inter- and intra-cellular Planar Cell Polarity (PCP) signaling mechanisms have been extensively studied, a long-standing question of PCP regulation is how positional information along the body axis generates global patterns of PCP. Through thorough loss- and gain-of-function analyses of Emx2 in both mice and zebrafish, this study convincingly demonstrated that Emx2 plays a key role in dictating global patterns of hair cell PCP in the ear and lateral line. While Emx2 target genes important for this process remain to be determined, they likely act to control basal body positioning through the hair cell-intrinsic polarity machinery. Thus, these findings provide significant new insights into the establishment of global PCP patterns essential for the proper function of these sensory end organs.I have a couple of suggestions to help strengthen the conclusions of the manuscript:1) Figure 4 and related text. In addition to the cell-autonomous effect of Emx2 OE (overexpression), which was nicely shown using the Gfi1 driver, could the authors comment on whether there was any non-autonomous effect on re-orienting the hair bundles upon mosaic Emx2 OE driven by Sox2 (i.e. were there any GFP negative hair cells being repolarized)? This would be informative in gauging whether Emx2 had any role in regulating intercellular PCP signaling. It is difficult to see which hair cells are GFP positive in Figure 4F and I. It would be helpful to enhance the signals of the GFP channel.2) Figure 4J–L. Did Emx2 OE in hair cells result in loss of oncomodulin+ type I hair cells in the utricle? Figure 5C showed that oncomodulin expression was not affected by Emx2 OE in saccular hair cells. It would be nice to also show that for the utricle, to further demonstrate the specific effect of Emx2 on hair bundle polarity.Reviewer #2:[...]1) inconsistencies between Emx2Cre and stereociliary bundle orientationEmx2Cre lineage tracing data presented in Figure 2C and K each reveal hair cells with stereociliary bundle orientations that match the lateral region of the utricle (2C) or the inner region of the saccule (2K), but do not show evidence of Emx2Cre activity. This contradicts an untested theme of the manuscript that Emx2 (b/c it is a transcription factor) functions autonomously within cells to direct stereociliary bundle orientation.An alternative interpretation raised by this lineage tracing data is that Emx2 functions non-cell autonomously. Perhaps by regulating the expression of a short range secreted factor that is sufficient to initiate all of the cell polarity functions attributed to Emx2. At a minimum, the difference between Emx2Cre lineage tracing and stereociliary bundle orientation should be a point of discussion. Preferably experiments can be conducted to test the autonomy of the Emx2 mutant phenotype or whether this difference is corrected postnatally.We thank the reviewer for pointing out those cells in Figure 2C and K that show reversed polarity but no ere reporter activity, which we have inadvertently neglected to explain. Those cells with reversed bundle polarity in Figure 2C and K, though negative for cre reporter activity, are indeed positive for Emx2 immunostaining. We took advantage of the fact that Figures 1 and 2 are taken from the same specimen, and we are now showing identical regions in Figure 1E,E’ and H,H’ as Figure 2c and k to illustrate this relationship. In the utricle shown in Figure 2C, we counted a total of only 18 hair cells that are immediately lateral to the LPR with reversed polarity and no cre-reporter activity, but these cells are invariably positive for Emx2 immunostaining. In addition, there are also a total of 21 hair cells in this specimen that are immediately medial to the LPR, which show the default polarity and are positive for cre-reporter activity but lack Emx2 immunoreactivity in the nucleus. A similar pattern is observed in the saccule except there are many more cre-positive hair cells with normal polarity but negative for Emx2 staining in the posterior-ventral region(numbers provided in the legend of Figure 2). Together, these results indicate that Emx2 immunostaining is a much better indicator of hair bundle polarity than the Emx2-lineage reporter (subsection “The LES and IR regions are preserved in Emx2-/- maculae”, first paragraph and Figure 2—figure supplements 1).A model of non-cell autonomous effect of Emx2 in reversing bundle polarity would predict at least some hair cells with reverse bundle polarity that are negative for Emx2 staining. This was not the case. Hair bundle polarity reversal correlates extremely well with Emx2 immunoreactivities.To this end, we added data from another 2 samples in Figure 2—figure supplement 1 to illustrate this fact.2) No evaluation of maculae size or areaIn the original Holley et al. paper it was reported that, in addition to the changes in stereociliary bundle orientation, there was a reduction in the overall area of the sensory epithelia of the saccule. This could be interpreted as evidence that this region of the saccule is specified by Emx2, and as a result is missing in Emx2 mutant thereby yielding a smaller saccule. The authors could address this lingering interpretation of the Holley et al. study, that Emx2 has a role in specification (in addition to or rather than global polarity), by measuring sensory epithelia area for the utricle and saccule in these Emx2 mutant lines. This would be a complement to the EDU experiments already presented.We did not observe a change in the size of the maculae or total number of hair cells in mutant utricles. Those results are now in Figure 2—source data 1 and Figure 2—source data 2.3) Incomplete analysis of late-stage Emx2 overexpression (Sox2CreERt2, RosaEmx2/+) experimentsBased upon experiments in which Emx2 expression is activated at later stages of development it is proposed that Emx2 regulates stereociliary bundle orientation by directing the polarized distribution of Gαi/Par6 relative to the core PCP axis. In these experiments Emx2 is proposed to rapidly alter Gαi or Par6 distribution but occurs too late to alter stereociliary bundle orientation. However, in each figure there are also hair cells with misoriented stereociliary bundles that do not appear to have either a lateral or a medial orientation (blue arrows). Investigating the basis of these hair cells further may provide mechanistic insight.One possibility is that the distribution of PCP proteins are also changed in these cells and that these bundles remain properly oriented along this new PCP protein axis – independent of Gαi. This could be evaluated by looking at Pk2 distribution in Sox2Cre, RosaEmx2+ tissue.The specimen shown in Figure 6N-O" was not processed for anti-PK2 staining, we have now added another specimen in Figure 6—figure supplement 2 showing anti-Pk2 staining after tamoxifen treatment at E15.5 and E16.5. There is no change in the distribution of Pk2 in hair cells with reversed or misoriented bundles, supporting our interpretation that Emx2 functions independently from the cPCP proteins.A second possibility is that the stereociliary bundles are dynamically reorienting in response to the Emx2-dependent changes in Gαi or Par6 distributions, and that hair cells represented by blue arrows in these figures are actually in a transition state. This latter point could be evaluated by looking at a later stage when reorientation might be complete.Unfortunately, we cannot evaluate the polarity of misoriented hair cells later than the harvesting ages of E18.5 because the Sox2 (now relabeled as GOF SE late) mice don't survive at birth. However, we do know that percentages of reversed or misoriented hair bundles in the utricles were even lower when tamoxifen was administered postnatally instead of E15.5 and E16.5, confirming that the ability of hair cells to respond to Emx2 is age-dependent.Other concerns:1) For Figure 2O, this image should span the Emx2Cre boundary (similar to 2C, 2G and 2K) in order to demonstrate these hair cells have the same orientation in Emx2 mutants.Corrected.2) It is very difficult to see the polarity of hair cells in We have incorporated the reviewer's suggestions in the revised manuscript for both Figures 7 and 8 by replacing the low power views with schematic diagrams, which allowed more room to show higher magnifications of the hair cells.3) In Figure 3 black boxes obscure the lateral region of the utricle in several panels.Corrected.4) Several instances where triple labeling is presented that might not be critical for presentation or data interpretation. Simplifying the figures might make the data more accessible. For example, 1E' and 1H' do not need the red channel, similarly in Figure 3 the relative distribution of EDU and the striola could be easier to see without myosin VII labeling (red, 3A', 3D', etc.)Yes, the revised Figure 3 is much clearer now with the suggested changes. However, we feel the red channel in Figure 1E' and H' helps to better delineate the boundary of individual hair cells and we kept it.5) Text and grammatical errors are present throughout.A) 'Stereocilia bundle' is not the correct term for this structure. It is either a 'bundle of stereocilia' or a 'stereociliary bundle'.For simplification, we have changed the wording to hair bundle in most of the text.B) 'Stereocilia polarity' is similarly not an accurate term. Individual stereocilia do not show planar polarity and instead are polarized based upon actin filament organization and the position of the barbed end. The organization that is being referred to in the manuscript is the 'polarity of the stereociliary bundle' and it should be described as such.We now use the term hair bundle polarity.Reviewer #3: […] I have a couple of suggestions to help strengthen the conclusions of the manuscript:1) Figure 4 and related text. In addition to the cell-autonomous effect of Emx2 OE (overexpression), which was nicely shown using the Gfi1Cre driver, could the authors comment on whether there was any non-autonomous effect on re-orienting the hair bundles upon mosaic Emx2 OE driven by Sox2-CreER (i.e. were there any GFP negative hair cells being repolarized)? This would be informative in gauging whether Emx2 had any role in regulating intercellular PCP signaling. It is difficult to see which hair cells are GFP positive in Figure 4F and I. It would be helpful to enhance the signals of the GFP channel.In Emx2 OE driven by Sox2-creER (now labeled as GOF-SE) specimens, GFP is expressed in the entire sensory domain, including both hair cells and supporting cells and we cannot definitively identify any GFP negative hair cells. See Author response image 1 showing only the green channel for Figure 4D-F and G-I. These data are not informative and we decided not to include them in the manuscript. However, please refer to our response to reviewer#2 item#1 for the lack of evidence for non-cell autonomous effect of Emx2 in altering hair bundle polarity.
Author response image 1.
DOI:
http://dx.doi.org/10.7554/eLife.23661.028
DOI:
http://dx.doi.org/10.7554/eLife.23661.0282) .The presence of oncomodulin in the Emx2 OE samples is variable but is consistent between the two maculae. For example, in Figure 4J, the oncomodulin staining in the utricle (Figure 4J) is sparsely labeled. A similar pattern is observed in the saccule of that specimen (not shown). In contrast, oncomodulin staining is clear in the saccule shown in Figure 5C as well as the utricle (not shown). However, this is the only specimen that shows good antioncomodulin staining out of the five that were processed in a similar manner. These results indicate that ectopic Emx2 does have other effects on hair cells that do not normally express this gene and this effect may be genetic background dependent. This information has been added in the text (subsection “Ectopic Emx2 reverses hair bundle polarity”, first paragraph).
Authors: N Heins; F Cremisi; P Malatesta; R M Gangemi; G Corte; J Price; G Goudreau; P Gruss; M Götz Journal: Mol Cell Neurosci Date: 2001-11 Impact factor: 4.314
Authors: Mireille Montcouquiol; Rivka A Rachel; Pamela J Lanford; Neal G Copeland; Nancy A Jenkins; Matthew W Kelley Journal: Nature Date: 2003-04-30 Impact factor: 49.962
Authors: Mireille Montcouquiol; Nathalie Sans; David Huss; Jacob Kach; J David Dickman; Andrew Forge; Rivka A Rachel; Neal G Copeland; Nancy A Jenkins; Debora Bogani; Jennifer Murdoch; Mark E Warchol; Robert J Wenthold; Matthew W Kelley Journal: J Neurosci Date: 2006-05-10 Impact factor: 6.167
Authors: Bo Gao; Hai Song; Kevin Bishop; Gene Elliot; Lisa Garrett; Milton A English; Philipp Andre; James Robinson; Raman Sood; Yasuhiro Minami; Aris N Economides; Yingzi Yang Journal: Dev Cell Date: 2011-02-15 Impact factor: 12.270