| Literature DB >> 28255391 |
K Sharifi-Sarasiabi1, S Hosseiniteshnizi2, F Dehghan3, A Madani4.
Abstract
Despite declining the number of malaria cases in Iran, increased prevalence of malaria is supposed to be due to migration from eastern neighboring countries of Iran, which are abundant in Plasmodium vivax (P. vivax). The circumsporozoite protein (CSP) of the P. vivax, is one of the candidate antigens for antimalaria vaccine. The diversity of P. vivax populations circulating in Iran has been investigated by using circumsporozoite protein (CSP) in this study. A hundred and eighteen blood samples were collected from patients diagnosed with P. vivax malaria from south of Iran during 2007-2008. All samples were analyzed by using nested PCR/ RFLP and 18 were sequenced. Genotyping of Pvcsp gene showed that VK210 type was predominant (95%) in south of Iran. Sequence analysis of Pvcsp gene revealed 6 distinct allelic variants in VK210 type. The present data indicate that there is some degree of genetic diversity among P. vivax populations in Hormozgan province of Iran. It seems that in neighbors of Iran, VK210 type is predominant, probably due to similar vector of malaria in these regions.Entities:
Keywords: Iran; Plasmodium vivax; malaria; malaria vaccines; protozoan circumsporozoite protein
Year: 2015 PMID: 28255391 PMCID: PMC5327707
Source DB: PubMed Journal: J Med Life ISSN: 1844-122X
Primers sequence in this study
| Primer names | Primer sequence | size of PCR product |
| ATGTAGATCTGTCCAAGGCCATAAA | 1100bp | |
| TAATTGAATAATGCTAGGACTAACAATAG | ||
| GCAGAACCAAAAAATCCACGTGAAAATAAG | 680bp | |
| CCAACGGTAGCTCTAACTTTATCTAGGTAT |