Literature DB >> 28248921

Development of improved vaccine cell lines against rotavirus.

Weilin Wu1, Nichole Orr-Burks1, Jon Karpilow2, Ralph A Tripp1.   

Abstract

Rotavirus is a major cause of severe gastroenteritis among very young children. In developing countries, rotavirus is the major cause of mortality in children under five years old, causing up to 20% of all childhood deaths in countries with high diarrheal disease burden, with more than 90% of these deaths occurring in Africa and Asia. Rotavirus vaccination mimics the first infection without causing illness, thus inducing strong and broad heterotypic immunity against prospective rotavirus infections. Two live vaccines are available, Rotarix and RotaTeq, but vaccination efforts are hampered by high production costs. Here, we present a dataset containing a genome-wide RNA interference (RNAi) screen that identified silencing events that enhanced rotavirus replication. Evaluated against several rotavirus vaccine strains, hits were validated in a Vero vaccine cell line as well as CRISPR/Cas9 generated cells permanently and stably lacking the genes that affect RV replication. Knockout cells were dramatically more permissive to RV replication and permitted an increase in rotavirus replication. These data show a means to improve manufacturing of rotavirus vaccine.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28248921      PMCID: PMC5332008          DOI: 10.1038/sdata.2017.21

Source DB:  PubMed          Journal:  Sci Data        ISSN: 2052-4463            Impact factor:   6.444


Background & Summary

Rotaviruses (RV) belong to the Reoviridae family, and have a linear segmented double-stranded RNA genome composed of 11 segments coding for 12 viral proteins. RV is a major cause of severe gastroenteritis among very young children in developing countries, and is a major cause of mortality in children under 5 years old, causing up to 20% of all childhood deaths in countries with high diarrheal disease burden with >90% of these deaths occurring in Africa and Asia. Initial RV infections usually occur by 9 months of age, and 80% occur before 1-year of age[1-5]. Serogroup A RV are the leading causative agent of childhood (<5 years) severe gastroenteritis worldwide, accounting for approximately 3.4% of child deaths annually[6]. The WHO has recommended, since 2009, that rotavirus vaccines be included in all national vaccination programs[7]. There are two RV vaccines in use. Rotarix is a live vaccine containing the attenuated monovalent G1, P[8] human rotavirus strain. RotaTeq is a live-attenuated bovine-human reassortant rotavirus vaccine containing the most common rotavirus antigens seen in humans (G1, G2, G3, G4, and P). Both vaccines are efficacious as has been demonstrated in clinical trials, i.e., 90–100% effective in preventing severe gastroenteritis, and clinical trial data have shown both vaccines to have acceptable safety profiles. Both vaccines are orally administered in multiple doses to mimic natural sequential rotavirus infections in an effort to promote the development of homotypic and heterotypic protective immunity against relevant group A rotavirus[8]. Current efforts to disseminate these vaccines to economically distressed areas are hindered largely by bioproduction costs. Mammalian cells such as the Vero cell line have proven to be a safe production platform for developing human vaccines[7,9]. Unfortunately, currently available Vero vaccine cell lines have relatively low yields compared to other vaccine production platforms. In an effort to rectify low-yield issues, as part of this study, we have identified host virus-resistant genes in a monkey kidney cell line, MA104 cells. The MA104 cells are highly susceptible to RV. Using small interfering RNA (siRNA) human library screening, a subset of genes in MA104 cells were identified that considerably increased RV replication when knocked down. The primary siRNA screen in the MA104 cells was achieved by reverse-transfecting the cells with pooled ON-TARGETplus siRNAs (SMARTpools) (4 siRNA targeting each gene) with the siRNA library targeting protein-coding host genes. Cytotoxic siRNAs as well as those which negatively affected cell viability were identified and excluded. Two days post-transfection cells were infected with activated simian rotavirus (RV3). Twenty-four hours post-infection cells were fixed and virus quantified by fluorescence focus assay (IF ELISA) (Fig. 1). Seventy hits increased viral replication ≥3 s.d.s. (z-score≥3.0) above non-targeting control (Fig. 2). A WHO-derived Vero cell line, previously utilized in the production of vaccine cell lines, was used to re-screen hits in an effort to eliminate false-positives. The top 20 hits that recapitulated the primary MA104 cell line screen were subjected to deconvolution studies. In this case, individual siRNAs included in SMARTpools were tested individually to determine if they induced the phenotype observed of the pool, i.e., increased RV replication and changes in viral antigen production. As part of this validation screen, Vero cells were reverse-transfected with individual siRNAs (4 siRNAs per gene) in triplicate per a transfection protocol optimized for Vero cells. Forty-eight hours post-transfection cells were infected with the RV3 rotavirus strain. Viral replication was evaluated via IF ELISA (Fig. 3). Ten hits showed an increased in RV3 replication of 1.75 fold or higher (NEU2, NAT9, COQ9, SVOPL, NDUFA9, COX9, LRGUK, WDR62, RAD51AP1 and CDK6) (Table 1). Messenger RNA knockdown (KD) under infection conditions was confirmed with qRT-PCR (Fig. 4). Gene knockout (KO) Vero cell lines were generated with CRISPR-cas 9 plasmids. KO was confirmed via Sanger sequencing (data not shown). RV3, CDC-9 and Rotarix replication was evaluated by qPCR in these engineered cell lines. In the NEU2-KO Vero cells generated, Rotarix infection had the highest increase of viral transcript at ~18-fold increase, followed by the RV3 (reference strain) at ~10-fold, and CDC-9 at ~7.5-fold increase (Fig. 5).
Figure 1

Experimental workflow.

This study included a tiered siRNA screening approach coupled with CRISPR-generated knockout Vero cell lines to evaluate host genes and their implication during RV infection. The primary siRNA screen was performed with pooled OTP-siRNA in MA104 cell line using the simian rotavirus strain RV3. Top hits were selected by a z-score analysis and subjected to deconvoluted validation siRNA screens in Vero cells with the rotavirus strains RV3-BB, Rotarix, CDC-9. Resulting hits were evaluated in CRISPR generated Vero cell lines with CDC-9 and Rotarix (GSK P5) strains.

Figure 2

Primary genome-wide siRNA screen in MA104 cell line.

Eighteen thousand two hundred forty genes were targeted with siRNAs. Forty-eight hours post-transfection cells were infected with the strain RV3. Twenty-four hours post-infection the cells were fixed and IF ELISA was completed. KD of 76 genes resulted in an enhancement of viral replication ≥3 s.d.s. (z-score≥3.0) as compared to non-targeting control. All samples were completed in triplicate (n=3). These 76 genes were validated by deconvolution of pooled siRNAs.

Figure 3

Deconvolution and validation of hits in Vero cell line.

Presented is the relative fold-change of RV3 replication in siRNA transfected Vero cells compared to non-targeting control cells. The data is shown as mean values±s.d. To efficiently remove false positive from the siRNA primary screen in MA104, we re-screened these 76 hits using SMARTpool siRNAs targeting these genes in Vero cells. siRNAs were transfected into Vero cells following the methods optimized for Vero cells. Forty-eight hours post-siRNA transfection, cells were infected with RV3 using an MOI=0.2, and cells were harvested for RV3 IF ELISA 48 h.p.i. All samples were completed in triplicate (n=3). a.u., arbitrary units.

Table 1

Top 10 gene hits in Vero cells following deconvolution and subsequent validation.

Gene IDOfficial Gene NameEntrez NumberSMARTpool Catalog Number
NEU2Neuraminidase 2 (Cytosolic sialidase)4,759L-012058-02-0005
NAT9N-acetyltransferase 9 (Putative)26,151L-017635-02-0005
COQ9Coenzyme Q957,017L-022565-02-0005
SVOPLSynaptic vesicle glycoprotein 2 (SV2) related protein homolog1,36,306L-007346-01-0005
NDUFA9NADH:ubiquinone oxidoreductase subunit A94,704L-016044-01-0005
COX20Cytochrome c oxidase assembly factor1,16,228L-021429-01-0005
LRGUKLeucine-rich repeats and guanylate kinase containing domain1,36,332L-015997-01-0005
WDR62WD repeat domain 622,84,403L-015997-01-0005
RAD51AP1RAD51 recombinase associated protein 110,635L-017166-00-0005
CDK6Cyclin-dependent kinase 61,021L-003240-00-0005
Figure 4

Validation of gene silencing by siRNA transfection in Vero cell line using qPCR.

For the top 10 hits selected to perform gene editing the siRNA silencing was confirmed in Vero cells using SMART pool siRNAs. MRNA levels of each gene were measured 48 h post-siRNA transfection by qPCR. Each qPCR reaction utilized 1 ug RNA as part of the reverse transcription reaction. Each gene was evaluated in triplicate and average values normalized to 18s rRNA. Values are presented as fold-change compared to non-targeting control (NTC). All samples were completed in triplicate (n=3). Values represent the mean of the triplicates±s.e.m.

Figure 5

RV replication in NEU2-KO Vero cells.

Using the CRISPR-Cas system a functinal NUE2 gene was edited and the RV3, CDC-9 and Rotarix rotavirus strains were evaluated. QPCR was performed in triplicate and the value was normalized to 18s RNA and compared to wild type Vero cell control (wt ctrl). All samples were completed in triplicate (n=3). The value presented here represents the mean of the triplicates±s.e.m.

Methods

Cell culture and viral stocks

The rhesus monkey epithelial cell line (MA104) was chosen to perform the primary RNAi screen because these cells support rotavirus replication and are easily transfected. The effects of gene silencing on rotavirus replication in MA104 cells can be detected 16–24 h (h) post-infection (pi). Hits produced from this primary screen were validated in the African green monkey kidney cell line (Vero), which is used for the production of the licensed polio virus vaccine. Vero cells are an approved cell line for vaccine production, and the cell line was received from the Centers of Disease Control and Prevention (CDC, Atlanta) who obtained it from the Serum Institute of India (SI). Both cell lines were cultivated under conditions of 37 °C, 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM; Hyclone, GE Healthcare) supplemented with 10% heat inactivated fetal bovine serum (FBS; Hyclone, GE Healthcare) and 1% penicillin-streptomycin. A master cell stock was created with low passage cells for both cell types. Briefly, master cell stocks were generated for low-passaged Vero and MA104 cells, where cells were cultured 6 days prior to screening experiments. The primary RNAi screens were done in MA104 cells by seeding MA104 cells in 96-well plates at a cell density of 10,000 cells per well. Rescreening and validation screening was accomplished in the same 96-well plate format with Vero cells seeded at a cell density of 8,000 cells per well. Passage numbers were consistent throughout the screen and validation steps to reduce variability. The primary RNAi screening was done using a single lot of a attenuated RV vaccine strain, RV3-BB (RV3)[10]. RV3 was initially prepared as a vaccine at a low titer (6.5×105 FFU ml−1) in Melbourne, Australia by the Carl Kirkwood lab. High titer RV3 virus was produced in the WHO-approved Vero cell line under Good Manufacturing Practice (GMP) conditions at Meridian Life Sciences, Memphis. RV3 is currently propagated in monkey kidney cell cultures (Vero cells) and subjected to downstream purifications. We expect that other RV strains may share the same pathways for virus replication as the currently licensed RV3 vaccine strain. For this reason, other RV strains were examined as part of the validation experiments to determine whether silencing the top hits determined as part of the primary screening with RV3 also lead to increased viral replication in vaccine cell lines with a variety of RV strains. Subsequent validation steps were completed in Vero cells with the RV3-BB strain, RotaTeq (G1P7, G2P7, G3P7, G4P7, G6P1A), Rotarix (89-12/G1P) and CDC-9 rotavirus strains.

SiRNA transfection

An ON-TARGETplus small interfering RNA (SMARTpools) library (GE Healthcare) was utilized to screen protein-coding host genes in MA104 cells as part of the primary screen. Primate-specific siRNA libraries are not currently readily available, therefore we used a human library of siRNAs to target the entire genome. According to the Chimpanzee Sequencing and Analysis Consortium, primates share 96% DNA sequence identity with humans. Therefore, utilizing siRNAs targeting human genes should target monkey sequences with strong complementarity[11]. SMARTpools utilize sense strand inaction and seed-region modifications that reduce off-target effects while maintaining high selectivity and effectiveness. As part of the primary RNAi screen, each gene was targeted with pooled SMARTpools. Each pool contained four siRNAs targeting a different seed region of the target gene’s mRNA. Briefly, in a 96-well plate format, MA104 cells were reverse transfected with 50 nM siRNA pools using 0.4% DharmaFECT 4 transfection reagent (0.4 ul well−1) (GE Healthcare). SMARTpools were pre-incubated with DharmaFECT 4 reagent in serum-free DMEM media at room temperature for 20 min to allow for complex formation. MA104 cells (1.4×104 cells well−1) in DMEM supplemented with 10% heat inactivated fetal bovine serum (FBS) were added to each well. Transfection plates were cultured at 37 °C, 5% CO2. Forty-eight hours post-transfection media was removed and cells infected with rotavirus strain as previously stated. Subsequent deconvolution studies utilized the same method of transfection except each siRNA was delivered individually. Each transfection experiment includes a non-targeting control siRNA (NTC; GE Healthcare). This siRNA targets no known mRNA sequence and should have no effect on mRNA. A siRNA targeting RV3 was used as a positive control, siTOX (GE Healthcare) served as a transfection control. All siRNAs were transfected to a final concentration of 50 nM.

Elimination of false-positive hits

Genome-wide RNAi screen data shows that the percentage of false-positive hits produced following primary screening can be high, in part due to the working with high numbers of assays including transfection, infection, fixation, variations from plate to plate, and delays in sequential plate reads. In the current study, the primary siRNA screening was performed in a MA104 cell line, which supports rotavirus replication. However, our endpoint for gene editing was performed in a Vero cell line that we used to support current vaccine development. To help aid in removal of potential false-positive hits in the primary screening, we performed a secondary screen of this collection of hits in a Vero cell line. The pooled siRNAs were transfected into Vero cells in a 96-well cell culture plate in triplicate. Rotavirus replication was examined by ELISA assay and the data was normalized to non-targeting control (NTC) as described. Seventy-six genes were selected for secondary screening in the Vero cell line. The majority of genes selected for re-screening studies were selected based upon z-score analysis. Initially, genes that exhibited a z-score≥3.0 were included. This list was further modified to include genes that were predicted to be relevant during virus replication following a brief study that assessed genes with a z-score ranging from 2.9–3.0 by conducting basic pathway analysis and a literature search. Genes were excluded during this process based upon their predicted relevance to virus replication. The finalized list of 76 genes is outlined in Fig. 2.

Deconvolution studies

Twenty hits that repeated in the primary screen results following screening in Vero cells were chosen based upon the increased virus replication with a relative value >1.4 (normalized to NTC) and subjected to deconvolution studies (Table 2 (available online only)). As part of these studies the siRNAs included in each SMARTpool were individually tested to determine whether individual siRNAs gave rise to changes in viral antigen production determined by IF ELISA. For each gene, 4 individual siRNAs from SMARTpools were evaluated. Forty-eight hours post-transfection, the cells were infected with RV3 at a MOI 0.2. Forty-eight hours post-infection, cells were fixed for the IF ELISA assay as discussed in methods section. A siRNA targeting RV3 was used as a positive control, siTOX served as a transfection control and a non-target siRNA served as a negative control. Gene targets were considered confirmed if two individual siRNAs enhanced RV3 replication during the deconvolution screening with a relative value >1.4 (normalized to NTC). To confirm siRNA efficacy, mRNA levels for each gene target were evaluated following transfection and subsequent infection by qPCR. All data represents the mean of triplicates±s.e.m., and normalized to non-targeting control.
Table 2

The top 76 hits were re-screened in a Vero vaccine cell line utilizing SMARTpools.

Gene TargetEntrez IDDeconvoluted siRNACatalog numberFold changes (versus NTC)
The top 20 hits that repeated the primary screen’s findings were subjected to deconvolution studies. The data for these hits is outlined here. Data is presented as fold change compared to non-targeting siRNA control.    
None NTCD-001810-0X1
NEU24,759siRNA 1J-012058-171.196
NEU24,759sIRNA 2J-012058-181.465
NEU24,759siRNA 3J-012058-191.353
NEU24,759siRNA 4J-012058-201.606
NAT926,151siRNA 1J-017635-130.823
NAT926,151sIRNA 2J-017635-141.241
NAT926,151siRNA 3J-017635-151.484
NAT926,151siRNA 4J-017635-161.442
SVOPL1,36,306siRNA 1J-007346-130.777
SVOPL1,36,306sIRNA 2J-007346-141.48
SVOPL1,36,306siRNA 3J-007346-151.632
SVOPL1,36,306siRNA 4J-007346-161.044
COQ957,017siRNA 1J-022565-180.948
COQ957,017sIRNA 2J-022565-191.531
COQ957,017siRNA 3J-022565-201.477
COQ957,017siRNA 4J-022565-211.26
NDUFA94,704siRNA 1J-016044-091.085
NDUFA94,704sIRNA 2J-016044-101.648
NDUFA94,704siRNA 3J-016044-111.641
NDUFA94,704siRNA 4J-016044-121.233
RAD51AP110,635siRNA 1J-017166-051.094
RAD51AP110,635sIRNA 2J-017166-061.217
RAD51AP110,635siRNA 3J-017166-071.568
RAD51AP110,635siRNA 4J-017166-081.478
COX201,16,228siRNA 1J-021429-091.021
COX201,16,228sIRNA 2J-021429-101.478
COX201,16,228siRNA 3J-021429-111.602
COX201,16,228siRNA 4J-021429-120.937
MAPK65,597siRNA 1J-003594-111.361
MAPK65,597sIRNA 2J-003594-121.405
MAPK65,597siRNA 3J-003594-131.378
MAPK65,597siRNA 4J-003594-141.067
WDR622,84,403siRNA 1J-031771-091.361
WDR622,84,403sIRNA 2J-031771-101.485
WDR622,84,403siRNA 3J-031771-111.402
WDR622,84,403siRNA 4J-031771-121.622
LRGUK1,36,332siRNA 1J-015997-091.101
LRGUK1,36,332sIRNA 2J-015997-101.585
LRGUK1,36,332siRNA 3J-015997-111.161
LRGUK1,36,332siRNA 4J-015997-121.568
CDK61,021siRNA 1J-003240-101.315
CDK61,021siRNA 2J-003240-111.434
CDK61,021siRNA 3J-003240-121.529
CDK61,021siRNA 4J-003240-130.951
KIAA168380,726siRNA 1J-031251-051.158
KIAA168380,726siRNA 2J-031251-061.242
KIAA168380,726siRNA 3J-031251-071.24
KIAA168380,726siRNA 4J-031251-081.097
CRISP310,321siRNA 1J-020092-090.969
CRISP310,321siRNA 2J-020092-101.454
CRISP310,321siRNA 3J-020092-111.436
CRISP310,321siRNA 4J-020092-121.218
GRPR2,925siRNA 1J-005624-051.039
GRPR2,925siRNA 2J-005624-061.535
GRPR2,925siRNA 3J-005624-071.925
GRPR2,925siRNA 4J-005624-080.971
DPH792,715siRNA 1J-016561-091.121
DPH792,715siRNA 2J-016561-101.343
DPH792,715siRNA 3J-016561-111.573
DPH792,715siRNA 4J-016561-121.275
GEMIN854,960siRNA 1J-020841-171.1
GEMIN854,960siRNA 2J-020841-181.047
GEMIN854,960siRNA 3J-020841-191.501
GEMIN854,960siRNA 4J-020841-201.437
KIAA140757,577siRNA 1J-014068-171.154
KIAA140757,577siRNA 2J-014068-181.292
KIAA140757,577siRNA 3J-014068-191.424
KIAA140757,577siRNA 4J-014068-201.089
RFXAP5,994siRNA 1J-011104-051.005
RFXAP5,994siRNA 2J-011104-061.514
RFXAP5,994siRNA 3J-011104-071.532
RFXAP5,994siRNA 4J-011104-081.669
SMARCA46,597siRNA 1J-010431-051.493
SMARCA46,597siRNA 2J-010431-061.51
SMARCA46,597siRNA 3J-010431-071.462
SMARCA46,597siRNA 4J-010431-081.698
CFAP581,59,686siRNA 1J-026312-171.452
CFAP581,59,686siRNA 2J-026312-181.4
CFAP581,59,686siRNA 3J-026312-191.366
CFAP581,59,686siRNA 4J-026312-201.558

Toxicity and cellular viability screening

The top 76 hits were tested for effects on cellular viability and toxicity by CellTiter96 Non-Radioactive Cell Proliferation Assay Kit and ToxiLight bioassay (Lonza, Walkersville, MD) (Fig. 6). SiRNAs were reverse transfected into MA104 cells (10,000 per well) to a final concentration of 50 nM. Seventy-two hours post-transfection, 20 μl per well of CellTiter 96 Non-Radioactive Cell Proliferation Assay (G4000, Promega Inc) was added to the siRNA transfected cells and incubated at 37 °C in cell culture incubator for 1 h. Following incubation, 100 μl of the solubilization solution/stop mix was added to each well. Absorbance was evaluated at a wavelength of 570 nm with a plate spectrophotometer (Tecan). Absorbance values were normalized to non-targeting siRNA control absorbance values.
Figure 6

Cell viability assay.

siRNAs were reverse-transfected into MA104 cells (10,000 per well) to a final concentration of 50 nM. Seventy-two hours post-transfection, 20 μl per well of CellTiter 96 Non-Radioactive Cell Proliferation Assay (G4000, Promega Inc) was added to the siRNA transfected cells and incubated at 37 °C in cell culture incubator for 1 h. Following incubation, 100 μl of the Solubilization Solution/Stop Mix was added to each well. Absorbance was evaluated at a wavelength of 570 nm with a plate spectrophotometer (Tecan).

qRT-PCR

Gene silencing by siRNA transfection in Vero cells was confirmed for the top ten genes. Cells were transfected in triplicate with individual siRNAs as previously described. Forty-eight hours post-transfection, cells were harvested for RNA isolation using RNeasy Mini Kit (Qiagen) following manufacturer instructions. qRT-PCR was performed in triplicate to measure mRNA levels of targeted genes using 1 ug RNA (SYBR Green RT Kit; ThermoFisher). The cycle threshold (CT) values were normalized to the house keeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or 18s ribosomal RNA. Values are presented as the mean of the triplicates±s.e.m.

RV infection

For both primary and deconvolution experiments, MA104 cells or Vero cells were infected with an activated simian rotavirus (RV3) 48 h post-transfection. Briefly, RV stocks were activated by adding 10 ug ml−1 of L-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK) treated trypsin (Worthington; Lakewood, NJ) and heating for 1 h in a 37 °C water bath. Following activation, rotavirus was diluted to a multiplicity of infection (MOI) of 0.2 in media containing trypsin at a 1 ug ml−1 concentration. One hundred microliters of diluted RV was added to each well after first washing plates ×2 with HBSS to remove all traces of FBS. Infected plates were incubated for 4 h at 37 °C, 5% CO2. Subsequent to incubation, 100 ul of DMEM containing 10% FBS was added to the plates on top of existing infection and incubated for a total of 24 h under the same conditions. Twenty-four hours post-infection supernatants were harvested and cells fixed with acetone:PBS for 20–30 min and stored at 4 °C until ready to perform the IF ELISA. KO cell lines were examined for virus replication using two RV vaccine strains CDC-9 and Rotarix (GSK P5) (CDC) following the same protocol.

IF ELISA

Fixed plates were washed ×2 with PBS for rehydration then blocked with 0.05% phosphate buffered saline with Tween 20 (PBST) containing 1% BSA for 1 h at room temperature on a rotator. The primary polyclonal rabbit anti-Rotavirus antibody (Rab A-SA11; Melbourne, Australia) 1:1,000 in blocking solution was added at 50 ul well−1 for 1 h at room temperature. The primary antibody was removed and plates were washed ×4 with 0.05% PBST followed by the addition 50 ul well−1 of a fluorescently labeled secondary antibody (goat/Anti-rabbit Alexa 488) at 1:1,000 dilution for 1 h at room temperature. Secondary antibody was removed by washing ×2 with PBST and ×2 with PBS. Plates were read with the Beckman Coulter Paradigm spectrophotometer capable of detecting fluorescence. Plates were read individually using a 450 nm wavelength filter at an exposure time of 1 min. Values were normalized to non-targeting control wells in the same plate.

CRISPR-Cas9

Following the re-screening and deconvolution studies, KOs of the top 10 hits were generated in Vero cells using CRISPR-Cas9. These 10 genes were chosen based upon assay results i.e., they resulted in the highest fold-change compared to NTC (enhanced virus replication versus non-targeting control). CRISPRs (GE) were used to generate 5 of the 10 knockouts. Utilization of the CRISPRs requires the co-transfection of a GFP-Cas9, the CRISPR RNA (crRNA) and the trans-activating RNA (tracrRNA). Briefly, the crRNA associates with Cas9. This complex locates and binds the target DNA via base pairing interaction with the tracrRNA. The clones generated using this system did not produce targeted gene cleavage in Vero cells, CRISPRs (Sigma) were utilized in further gene editing experiments. The CRISPRs (Sigma) system utilizes a single plasmid that expresses both green fluorescent protein (GFP) and guide RNA (gRNA). Four guide strands were evaluated per gene target. Currently, we have successfully generated a KO cell line for the NEU2 gene in Vero cells. Other KO was attempted, and generation of other KO cell lines is on-going. The CRISPR (Sigma) sequences utilized in these experiments are presented in Table 3.
Table 3

Knockouts of the top 10 hits identified by the primary and validation RNAi screens were generated in Vero cells using CRISPR-Cas9.

Gene symbolGene IDRefSeq IDSpeciesTarget exonOrder formatTarget site
The CRISPR (Sigma) sequences utilized in these experiments are presented (4 target sites per gene).      
NEU24,759NM_005383Human1Plasmid(U6-gRNA/CMV-Cas9-GFP) AGGAGAGCGTGTTCCAGTCGGG
NEU24,759NM_005383Human1Plasmid(U6-gRNA/CMV-Cas9-GFP) TGTTCCGCGAAGGCCAGCAGGG
NEU24,759NM_005383Human1Plasmid(U6-gRNA/CMV-Cas9-GFP) GCTGGCCTTCGCGGAACAGCGG
NEU24,759NM_005383Human1Plasmid(U6-gRNA/CMV-Cas9-GFP) AGCTGATTGTCCTGCGCAGAGG
NAT926,151NM_015654Human2Plasmid(U6-gRNA/CMV-Cas9-GFP) CTCCGAGGTGTAGGGTACAAGG
NAT926,151NM_015654Human3Plasmid(U6-gRNA/CMV-Cas9-GFP) CTCTGATTTCATCCACTCGTGG
NAT926,151NM_015654Human4Plasmid(U6-gRNA/CMV-Cas9-GFP) TCTTCGGTGGCGCCTGGCTGGG
NAT926,151NM_015654Human4Plasmid(U6-gRNA/CMV-Cas9-GFP) AGCTCTCTTCGGTGGCGCCTGG
SVOPL1,36,306NM_001139456Human1Plasmid(U6-gRNA/CMV-Cas9-GFP) CGGCGGTATCTGGTGCGCTTGG
SVOPL1,36,306NM_001139456Human1Plasmid(U6-gRNA/CMV-Cas9-GFP) GGTATCTGGTGCGCTTGGCCGG
SVOPL1,36,306NM_001139456Human2Plasmid(U6-gRNA/CMV-Cas9-GFP) ACGCGGCACCAGGGCTTGTCGG
SVOPL1,36,306NM_001139456Human2Plasmid(U6-gRNA/CMV-Cas9-GFP) AAACTCAAGGGCTGCCGTCAGG
COQ957,017NM_020312Human1Plasmid(U6-gRNA/CMV-Cas9-GFP) GCTCAATTTCCGAAGGCTGAGG
COQ957,017NM_020312Human1Plasmid(U6-gRNA/CMV-Cas9-GFP) GCCTTCGGAAATTGAGCCTGGG
COQ957,017NM_020312Human2Plasmid(U6-gRNA/CMV-Cas9-GFP) CTTCCACGGTGAACGTCTTTGG
COQ957,017NM_020312Human3Plasmid(U6-gRNA/CMV-Cas9-GFP) CAGTGGAGACTATCGGCTTCGG
NDUFA94,704NM_005002Human4Plasmid(U6-gRNA/CMV-Cas9-GFP) GCTGTGTTGTACTACTCGTCGG
NDUFA94,704NM_005002Human9Plasmid(U6-gRNA/CMV-Cas9-GFP) CGGTACCTCCTTTTCCACCTGG
NDUFA94,704NM_005002Human9Plasmid(U6-gRNA/CMV-Cas9-GFP) CGATAGGCAAAAAGCGGCAAGG
NDUFA94,704NM_005002Human11Plasmid(U6-gRNA/CMV-Cas9-GFP) GCGTCATCGCACTTACCGCTGG
Gene editing was applied to generate KO vaccine cell lines (Sigma) using CRISPR-Cas selected genes was done in Vero cells maintained in Dulbecco’s modified Earle’s medium (DMEM, Invitrogen) supplemented with 10% fetal bovine serum. Lipofectamine LTX Reagent (Life Technologies) was utilized to transfect CRISPR plasmids into the Vero cells in 12-well culture plates, with a ratio of DNA/Lipofectamine at 1.0 ug/3.0 ul. Briefly, both 1.0 ug of CRISPR plasmid DNA and Lipofectamine were diluted into 100 ul of OPTI-MEM separately (Gibco Life Technologies; Carlsbad, CA). Diluted CRISPR plasmids were then mixed with transfection reagents and incubated at room temperature for 30 min. The cells were washed using ×1 PBS before the CRISPR/Lipofectamine mixture was added to the plate. Positive cells are sorted by flow cytometry into 96-well cell culture plates, with one cell/per well. Afterwards, the cell clones were grown in 12 well plates until confluence, and then divided into two plates: one plate was harvested for isolation of genomic DNA and then subjected to in-house Sanger sequencing; the second plate was frozen down at −80C until knockouts were validated by the sequencing data.

Data analysis

For all experiments a non-targeting control siRNA (GE; D-001810-0X) was used as a negative control. The raw data was normalized to the non-targeting control results for the respective plate and then converted to a standard Z-score. For the initial screen hits were normalized and scored based on wells showing ≥3 s.d. above or below a non-targeting control. siRNAs that elicited an enhancement of viral replication>3 s.d.s. (z-score≥3.0) as compared to non-targeting control were considered top hits. These 76 genes were subjected to re-screening in Vero cells using SMARTpools.

Data Records

Data record 1

In this primary RNAi screen using small interfering RNA (siRNA), a library of siRNAs targeting human genes (GE Healthcare Dharmacon, # G-005005-01) was screened and a subset of genes in MA104 cells were identified that when silenced dramatically increased the ability of rotavirus replication. Also, included within this dataset, are the genes that when silenced dramatically decreased the ability of rotavirus replication. Sub-libraries included within this library: GPCR (G-103605-01), Phosphatase (G-103705-01), Ion Channel (G-103805-01), Drug targets (G-104655-025), Protease (G-105105-01), Ubiquitin (GU-105615-01, G-105625-01 and G-105635-01 for Ubiquitin Subset 1, 2 and 3 respectively), Protein Kinase (G-103505-01), and Genome (G-105005-025). Included within this dataset is the raw ELISA data and calculated z-scores for each gene hit. Anti-RV hits with a z-score greater than 1 are considered to be plausible antiviral host genes. The siRNA primary screen data presented is stored at PubChem (Data Citation 1).

Data record 2

The top anti-RV hits from the primary screening assays were re-screened in a WHO-derived Vero vaccine cell line, which was the cell substrate to be used for enhanced vaccine cell line develop, to eliminate false-positive hits. In this case, individual siRNAs included in SMARTpools were tested to determine if they induced the phenotype observed of the pool, i.e., increased RV replication and changes in viral antigen production. Included within this dataset is the raw ELISA data for and calculated fold change for the host virus-resistant genes identified. Included within this dataset the host virus-resistant genes identified. This deconvolution validation dataset is stored at PubChem (Data Citation 2).

Technical Validation

Optimization of transfection in Vero cell line

To establish a highly efficient siRNA transfection protocol for high-throughput screening (HTS), the effectiveness of four DharmaFECT transfection reagents (DF1–4, Dharmacon) were tested with MA104 cells. From this collection, DF4 was identified to be the most effective reagent for introducing siRNAs into the cell line for primary screening (Fig. 7). A result showing optimal DF4 transfection conditions is shown in Fig. 8. Using a siRNA targeting the GAPDH gene, >80% silencing was achieved with 0.4% DF4 and a siRNA concentration of 50 nM. These conditions are consistent with previously published data[12]. Under these conditions, cell toxicity was not observed by either microscopy examination or MTT assay. Transfection optimization for the Vero cell line (used for validation studies) was previously performed during the polio cell line engineering program[12]. Pilot studies were completed prior to screening to develop an assay with low variation and strong signal to noise ratio. Effective concentrations of siRNAs were determined by titration. Responses to negative and positive control siRNAs were evaluated and optimized to determine reference values and the s.d. for the z-score calculation. Z-scores were subsequently used to evaluate and determine hits.
Figure 7

DharmaFECT 4 was the most effective transfection reagent for introducing siRNAs into MA104 cells.

Prior to screening, DharmaFECT 1–4 were evaluated for their efficiency in delivering siRNAs to MA104 cells. A positive control siRNA targeting RV was transfected into MA104 cells using either 0.4 ul of DhamrmaFECT 1, 2, 3 or 4 following the protocol (ref). GAPDH expression was measured using QPCR assay. Results are presented as GAPDH expression versus non-targeting control.

Figure 8

Transfection optimization.

MA104 cells were transfected with DF4 and 50 nM GAPDH siRNA and allowed to incubate for 48 h. Following incubation cells were harvested to assess GAPDH silencing by qPCR. Shown is fold change in GAPDH mRNA following transfection with anti-GAPDH siRNA relative to control with no transfection reagent. DF4 at 0.4% concentration showed the highest mRNA reduction with the lowest toxicity as compared to DF1, DF2 and DF3.

Transfection controls

All experiments were performed in at least two independent replicates. Each replicate included duplicates for each siRNA targeting a specific mRNA transcript for the gene of interest, and quadruplicates of a positive control siRNA targeting Rotavirus, a negative non-targeting control siRNA and a transfection control siRNA (siTOX). A high-quality RNAi screen requires a clear distinction between positive and negative controls. A control siRNA that targets Rotavirus directly was utilized to monitor the silencing effects on rotavirus replication (NSP-842: AGTTGAACGTGACGACAATT). A non-targeting siRNA (siNTC) (GE Healthcare Dharmacon: Cat. # D-001810-0X) was used as a negative control. These controls were clearly distinguished from each other in all experiments. A mock control (no siRNA) was used as background normalization. The effectiveness of these controls is outline in Fig. 7. In an effort to evaluate screening efficiency, we used siTOX (GE Healthcare Dharmacon TOX Transfection Control, Cat. # D0015000120) to visually monitor the transfection efficiency. Successful transfection with siTOX results in cell death by apoptosis. All siRNAs were tested for effects on cellular viability and toxicity by CellTiter96 Non-Radioactive Cell Proliferation Assay Kit and ToxiLight bioassay (Lonza, Walkersville, MD) following manufacturer’s instructions. Cellular toxicity was evaluated 48 h post-transfection. Data was normalized to siTOX control (100% cytotoxicity). siRNAs which resulted in >20% toxicity were excluded as is standard operating procedure.

Data normalization and statistical analysis

In the current study, we used Z-score analysis according to previously established methods[13-15]. A Z′-factor was utilized in the current screen (3>Z′>0.5: Excellent assay; 0.5>Z′>3: acceptable) to evaluate its quality. The majority of our screen fell into a Z′ factor (0.5Turkey’s multiple comparisons at 95% confidence level. All data are presented as mean±s.e. P-values <0.05 were considered statistically significant.

Additional Information

How to cite this article: Wu, W. et al. Development of improved vaccine cell lines against rotavirus. Sci. Data 4:170021 doi: 10.1038/sdata.2017.21 (2017). Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
  13 in total

1.  A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays.

Authors: 
Journal:  J Biomol Screen       Date:  1999

2.  The use of strictly standardized mean difference for hit selection in primary RNA interference high-throughput screening experiments.

Authors:  Xiaohua Douglas Zhang; Marc Ferrer; Amy S Espeseth; Shane Douglas Marine; Erica M Stec; Michael A Crackower; Daniel J Holder; Joseph F Heyse; Berta Strulovici
Journal:  J Biomol Screen       Date:  2007-04-13

Review 3.  Vero cell platform in vaccine production: moving towards cell culture-based viral vaccines.

Authors:  P Noel Barrett; Wolfgang Mundt; Otfried Kistner; M Keith Howard
Journal:  Expert Rev Vaccines       Date:  2009-05       Impact factor: 5.217

4.  Initial sequence of the chimpanzee genome and comparison with the human genome.

Authors: 
Journal:  Nature       Date:  2005-09-01       Impact factor: 49.962

5.  Comparison of sensitivity of VERO cell line versus primary monkey kidney cells in the detection of residual live polio virus during and after inactivation.

Authors:  B J Montagnon; A J Nicolas; B Fanget; L Peyron
Journal:  Dev Biol Stand       Date:  1981

6.  Complete genome sequence analysis of candidate human rotavirus vaccine strains RV3 and 116E.

Authors:  Christine M Rippinger; John T Patton; Sarah M McDonald
Journal:  Virology       Date:  2010-06-26       Impact factor: 3.616

7.  Rotavirus surveillance--worldwide, 2001-2008.

Authors: 
Journal:  MMWR Morb Mortal Wkly Rep       Date:  2008-11-21       Impact factor: 17.586

8.  A prospective study of rotavirus infection in infants and young children.

Authors:  M Gurwith; W Wenman; D Hinde; S Feltham; H Greenberg
Journal:  J Infect Dis       Date:  1981-09       Impact factor: 5.226

9.  Engineering Enhanced Vaccine Cell Lines To Eradicate Vaccine-Preventable Diseases: the Polio End Game.

Authors:  Sabine M G van der Sanden; Weilin Wu; Naomi Dybdahl-Sissoko; William C Weldon; Paula Brooks; Jason O'Donnell; Les P Jones; Cedric Brown; S Mark Tompkins; M Steven Oberste; Jon Karpilow; Ralph A Tripp
Journal:  J Virol       Date:  2015-11-18       Impact factor: 5.103

10.  Global illness and deaths caused by rotavirus disease in children.

Authors:  Umesh D Parashar; Erik G Hummelman; Joseph S Bresee; Mark A Miller; Roger I Glass
Journal:  Emerg Infect Dis       Date:  2003-05       Impact factor: 6.883

View more
  12 in total

1.  A universal mammalian vaccine cell line substrate.

Authors:  Jackelyn Murray; Kyle V Todd; Abhijeet Bakre; Nichole Orr-Burks; Les Jones; Weilin Wu; Ralph A Tripp
Journal:  PLoS One       Date:  2017-11-27       Impact factor: 3.240

2.  Knocking down the obstacles to functional genomics data sharing.

Authors:  Kaylene J Simpson; Jennifer A Smith
Journal:  Sci Data       Date:  2017-03-01       Impact factor: 6.444

3.  In Vitro Evaluation of Anti-Rift Valley Fever Virus, Antioxidant and Anti-Inflammatory Activity of South African Medicinal Plant Extracts.

Authors:  Garland K More; Raymond T Makola; Gerhard Prinsloo
Journal:  Viruses       Date:  2021-01-31       Impact factor: 5.048

4.  Experimental Methods to Study the Pathogenesis of Human Enteric RNA Viruses.

Authors:  Somya Aggarwal; Ebrahim Hassan; Megan T Baldridge
Journal:  Viruses       Date:  2021-05-25       Impact factor: 5.048

5.  Enhancing viral vaccine production using engineered knockout vero cell lines - A second look.

Authors:  F Hoeksema; J Karpilow; A Luitjens; F Lagerwerf; M Havenga; M Groothuizen; G Gillissen; A A C Lemckert; B Jiang; R A Tripp; C Yallop
Journal:  Vaccine       Date:  2018-03-16       Impact factor: 3.641

6.  A pooled genome-wide screening strategy to identify and rank influenza host restriction factors in cell-based vaccine production platforms.

Authors:  David M Sharon; Sean Nesdoly; Hsin J Yang; Jean-François Gélinas; Yu Xia; Sven Ansorge; Amine A Kamen
Journal:  Sci Rep       Date:  2020-07-22       Impact factor: 4.379

7.  Gene-edited vero cells as rotavirus vaccine substrates.

Authors:  Nichole Orr-Burks; Jackelyn Murray; Weilin Wu; Carl D Kirkwood; Kyle V Todd; Les Jones; Abhijeet Bakre; Houping Wang; Baoming Jiang; Ralph A Tripp
Journal:  Vaccine X       Date:  2019-10-08

8.  Vero Cells as a Mammalian Cell Substrate for Human Norovirus.

Authors:  Kyle V Todd; Ralph A Tripp
Journal:  Viruses       Date:  2020-04-14       Impact factor: 5.048

Review 9.  Cell Cultures for Virology: Usability, Advantages, and Prospects.

Authors:  Alexander A Dolskiy; Irina V Grishchenko; Dmitry V Yudkin
Journal:  Int J Mol Sci       Date:  2020-10-27       Impact factor: 5.923

10.  CRISPR-Csy4-Mediated Editing of Rotavirus Double-Stranded RNA Genome.

Authors:  Guido Papa; Luca Venditti; Luca Braga; Edoardo Schneider; Mauro Giacca; Gianluca Petris; Oscar R Burrone
Journal:  Cell Rep       Date:  2020-09-29       Impact factor: 9.423

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.