Draft Genome Sequences of Five Shiga Toxin-Producing Escherichia coli Isolates Harboring the New and Recently Described Subtilase Cytotoxin Allelic Variant subAB2-3.

We present here the draft genome sequences of five Shiga toxin-producing Escherichia coli (STEC) strains which tested positive in a primary subAB screening. Assembly and annotation of the draft genomes revealed that all strains harbored the recently described allelic variant subAB2-3 Based on the sequence data, primers were designed to identify and differentiate this variant.

GENOME ANNOUNCEMENT

The subtilase cytotoxin (SubAB) is an AB5 cytotoxin identified in certain Shiga toxin-producing Escherichia coli (STEC) strains, in particular in locus of enterocyte effacement (LEE)-negative strains, and was originally discovered to be encoded by subAB on the large conjugative virulence plasmid pO113 (1). In addition to subAB, two chromosomal variants, subAB, located on the pathogenicity island (PAI) SE-PAI (2, 3), and its allelic variant subAB, contained on an outer membrane efflux protein (OEP) locus, have been described (4). Recently, we described an isolate (E. coli strain 48) originating from a roe deer and testing positive in the primary subAB screening but which was negative in subsequent subtyping for subAB variants (5). This strain harbored a new subAB allelic variant that has been designated subAB and was associated with a gene predicted to encode a hypothetical protein of yet-unknown function, which is located 527 bp upstream of the subAB locus. The new genetic location of this subAB operon did not show any sequence similarity to those associated with subAB and subAB alleles. As such, this allele cannot be typed using the current subAB typing primer sets that include binding targets located in terpenoid indole alkaloid (Tia)- and OEP-encoding genes.

Here, we describe the draft genome sequences of five new STEC strains (strain E. coli N11-1317, a clinical human isolate, and strains E. coli 113, E. coli 117, E. coli 256, E. coli 453 isolated from healthy reindeers at slaughter) which tested positive in the primary subAB screening but which were negative in subsequent subtyping for subAB variants. Genomic DNA was isolated from these strains and sequenced using Pacific Biosciences single-molecule real-time sequencing (SMRT) technology at the Functional Genomics Centre of the University of Zurich. The obtained sequences were assembled de novo using the SMRT Analysis 2.3.0 software and annotated using the NCBI Prokaryotic Genome Automatic Annotation Pipeline (http://www.ncbi.nlm.nih.gov/genome/annotation_prok/). Draft genomes that were determined in the five strains, including the chromosomes and plasmids, ranged from 5.38 Mb to 6.18 Mb, with each genome containing 5,278 to 6,046 coding sequences (Table 1).

TABLE 1 

Sequenced subAB-positive strains and their genome accession numbers

E. coli strain	Source	Genome size (Mb)	No. of coding sequences	Accession no.
N11-1317	Human	5.63	5,465	MPGQ00000000
453	Reindeer	5.79	5,771	MPGR00000000
113	Reindeer	6.18	6,046	MPGP00000000
117	Reindeer	5.38	5,278	MPGS00000000
256	Reindeer	5.54	5,425	MPGT00000000

An analysis of the draft genome sequences revealed that in all five strains, the subAB2-3 operon was chromosomally located. Sequence comparison with the E. coli 48 genome (accession no. JPQG00000000) showed that all five strains harbored the subAB allelic variant. Within all five strains, the subAB operon is located between two genes that encode hypothetical proteins of yet-unknown functions and correspond to JD73_15220 and JD73_15240 in the E. coli 48 genome. Based on these sequence data, we designed a new primer, subAB2-3rv (GAGGCGACTAATGAAGAATTAA), which binds within the gene for JD73_15240. Use of this primer in combination with a previously described subAB_out primer (GAATCAACAACAGATACGAC [4]) allows the identification of the subAB2-3 variant based on a 943-bp PCR amplification product. This new primer, subAB2-3rv, can thus also be included in the current subAB PCR subtyping scheme to identify the subAB2-3 variant.

Accession number(s).

These whole-genome shotgun projects for the five strains have been deposited in GenBank under accession numbers provided in Table 1. The versions described in this paper are the first versions.