Methane biogenesis in methanogens is mediated by methyl-coenzyme M reductase, an enzyme that is also responsible for the utilization of methane through anaerobic methane oxidation. The enzyme uses an ancillary factor called coenzyme F430, a nickel-containing modified tetrapyrrole that promotes catalysis through a methyl radical/Ni(ii)-thiolate intermediate. However, it is unclear how coenzyme F430 is synthesized from the common primogenitor uroporphyrinogen iii, incorporating 11 steric centres into the macrocycle, although the pathway must involve chelation, amidation, macrocyclic ring reduction, lactamization and carbocyclic ring formation. Here we identify the proteins that catalyse the biosynthesis of coenzyme F430 from sirohydrochlorin, termed CfbA-CfbE, and demonstrate their activity. The research completes our understanding of how the repertoire of tetrapyrrole-based pigments are constructed, permitting the development of recombinant systems to use these metalloprosthetic groups more widely.
Methane biogenesis in methanogens is mediated by methyl-coenzyme M reductase, an enzyme that is also responsible for the utilization of methane through anaerobic methane oxidation. The enzyme uses an ancillary factor called coenzyme F430, a nickel-containing modified tetrapyrrole that promotes catalysis through a methyl radical/Ni(ii)-thiolate intermediate. However, it is unclear how coenzyme F430 is synthesized from the common primogenitor uroporphyrinogen iii, incorporating 11 steric centres into the macrocycle, although the pathway must involve chelation, amidation, macrocyclic ring reduction, lactamization and carbocyclic ring formation. Here we identify the proteins that catalyse the biosynthesis of coenzyme F430 from sirohydrochlorin, termed CfbA-CfbE, and demonstrate their activity. The research completes our understanding of how the repertoire of tetrapyrrole-based pigments are constructed, permitting the development of recombinant systems to use these metalloprosthetic groups more widely.
Coenzyme F430 is a modified tetrapyrrole that is required by methyl-coenzyme M reductase (MCR), the terminal enzyme in the process of methanogenesis (Figure 1)1,2. This cofactor is responsible for the generation of about a billion tons of methane gas per annum, roughly one third of which escapes into the atmosphere where it is photochemically converted into CO22, thus contributing to the greenhouse effect and global warming. More recently, MCR has also been implicated in the process of reverse methanogenesis (anaerobic methane oxidation)3–6, which is mediated by bacterial/archaeal mats on the ocean floor. MCR is an enzyme ensemble consisting of a dimer of heterotrimers (α2β2γ2), catalyzing the reversible reduction of methyl-coenzyme M (CH3-S-CoM) and coenzyme B (HS-CoB) into the heterodisulfide CoM-S-S-CoB and methane7. Central to the mechanism of this powerful redox catalyst8,9 is the nickel porphinoid, coenzyme F430 (-650 mV Ni+/2+ redox couple). Despite the indispensable role played by coenzyme F430 in the process of methanogenesis and carbon cycling, the assembly of this unique cofactor had not been determined10.
Figure 1
Coenzyme F430 and biosynthesis gene clusters in methanogens.
(A) Coenzyme F430 structure showing the numbering of the pyrrole rings A-D, lactam ring E and cyclohexanone ring F, and the C- and N-atoms. (B) Coenzyme F430 biosynthesis (cfb) gene clusters identified in this study. Homologous genes are shown in the same colour. Gene designations below the arrows represent the original annotation. The genes are: M. barkeri: cfbA (Mbar_A0344), cfbB (Mbar_A0345), cfbC (Mbar_A0346), cfbD (Mbar_A0347), cfbE (Mbar_A0348); M. conradii: cfbA (MTC_0061), cfbB (MTC_0062), cfbC (MTC_0063), cfbD (MTC_0064), cfbE (MTC_0065); M. intestinalis: cfbA (H729_08045), cfbB (H729_08040), cfbC (H729_08035), cfbD (H729_08030), cfbE (H729_08025).
As a modified tetrapyrrole the synthesis of coenzyme F430 is based upon the macrocyclic template of uroporphyrinogen III11,12, from which all hemes, chlorophylls, sirohemes, corrins, bilins and heme d are derived. However, coenzyme F430 differs from these other modified tetrapyrroles in the nature of the centrally chelated metal ion and in the oxidation state of the macrocycle, a tetrahydroporphyrinogen, the most reduced member of the family13. As well as the four pyrrole-derived rings found in all modified tetrapyrroles (labelled A-D; Figure 1), coenzyme F430 also contains two extra rings (E and F; Figure 1). Ring E is a lactam derived from the amidated acetic acid side chain attached to ring B, whilst the keto-containing ring F originates from the propionic acid side chain on ring D. Radiolabelling experiments indicated that the biosynthesis of coenzyme F430 proceeds via sirohydrochlorin, the metal-free precursor of siroheme14. Moreover, under depleted nickel growth conditions, Methanothermobacter marburgensis was found to accumulate a 15,173-seco intermediate (seco-F430) missing ring F15. This intermediate could be converted into coenzyme F430 by cell-free extracts in the presence of ATP15 indicating that this seco-F430 may represent the penultimate intermediate in the biosynthetic pathway.
Potential gene clusters
With the knowledge that the biosynthesis of coenzyme F430 has to involve metal ion chelation, side chain amidation and macrocyclic ring reduction, we sought the clustering of corresponding potential genes for coenzyme F430
biosynthesis (given the acronym cfb) within the genomes of a range of methanogens. Strikingly, this approach allowed us to identify such a grouping in a number of methanogens, including Methanosarcina barkeri, Methanomassiliicoccus intestinalis and Methanocella conradii, as shown in Figure 1. These clusters all contain genes for a small type II chelatase16 (CfbA), followed by a MurF-like ligase17 (CfbB) and orthologues of the NifD and NifH components of nitrogenase (CfbC and CfbD, respectively). Interestingly, the latter are also orthologues of BchN and BchL of the tetrapyrrole-reducing protochlorophyllide reductase (DPOR)18, which are involved in bacteriochlorophyll synthesis. Finally, the last gene of the cluster encodes an amidase (CfbE) that is similar to the CobB/CbiA a,c-diamide synthetase enzymes found in cobalamin biosynthesis19. Significantly, M. intestinalis, further, contains the genes for the transformation of glutamic acid into precorrin-2, the direct precursor of sirohydrochlorin, within the same gene cluster. The cfb genes from M. barkeri were amplified and cloned to allow for the characterisation of the encoded products (Extended Data Table 1).
Extended Data Table 1
Plasmids and primers used in this study.
Plasmid
Source
pMH003 – Iron sulfur cluster (isc) biogenesis operon from E. coli
(7)
pET22b-nixA – Nickel transporter from H. pylori
This work
pETcoco-2KAN
(8)
pETcoco-2KAN-cobA
This work
pETcoco-2KAN-cobA-sirC
This work
pETcoco-2KAN-cobA-sirC-cfbA
This work
pETcoco-2KAN-cobA-sirC-cfbA-nixA
This work
pET 14b-cfbA (Mbar_A0344)
This work
pET14b-cfbB (Mbar_A0345)
This work
pET14b-cfbC (Mbar_A0346)
This work
pET14b-cfbD (Mbar_A0347)
This work
pET14b cfbE (Mbar_A0348)
This work
pET14b-cfbC-cfbD-isc
This work
pET14b-cfbD-cfbC-isc
This work
pET22b-cfbA
This work
pET3a-cobA
This work
pET3a-sirC
This work
pET3a-cfbA (Mbar_A0344)
This work
pET3a-nixA
This work
Primer
Sequence
Site
MB0344 F
CACCATATGACAGAAAAACTCG
Ndel
MB0344 R
GTGGGATCCACTAGTTAAAGGGCTTCCTGAACC
BamHI/Spel
MB0345 F
CACCATATGGACCTGTACCGGAAG
Ndel
MB0345 R
GTGGGATCCACTAGTTAACGGAAGCATTTTACC
BamHI/Spel
MB0346 F
CACCATATGGCTGAAAAAGAGATTTC
Ndel
MB0346 R
GTGGGATCCACTAGTCAGGCTTCCTTTGCAAC
BamHI/Spel
MB0347 F
CACATGAAAAACCAGAAGATC
Ndel
MB0347 R
GTGGGATCCACTAGTTATTTTGTTAATTCC
BamHI/Spel
MB0348 F
CGCCATATGCTTAACGACAAGCAATCC
Ndel
MB0348 R
ATGGGATCCACTAGTTCACGGAAGAACCCTGG
BamHI/Spel
cbiX_Ascl_fo
TATAGGCGCGCCAAGAAGGAGATATACC
AscI
cbiX_Sall_re
TATAGTCGACTTAAAGGGCTTCCTGAACC
Sail
Nickel chelatase CfbA
We had previously shown that CfbA (Mbar_A0344) is able to act as a cobaltochelatase and named it CbiXS. In this current study, using a higher concentration of Ni2+ in the assays, 50 µM rather than 20 µM, the conversion of sirohydrochlorin to Ni2+-sirohydrochlorin by CfbA/CbiXS could be followed by UV/Vis absorption spectroscopy (Extended Data Figure 1), demonstrating that CfbA/CbiXS is able to catalyse the insertion of nickel as well as cobalt into sirohydrochlorin in vitro. The specific activity of CfbA/CbiXS for Ni2+ insertion in vitro was determined as 3.4±0.5 nmol min-1 mg-1, which is considerably lower than that observed for Co2+ insertion (122 nmol min-1 mg-1)16. The assays were performed with reagents that were originally devised for cobalt insertion and therefore optimization is required through the use of different buffers and pH values to determine conditions that may allow for enhanced Ni2+ insertion. Hence, the in vivo activity of the chelatase enzyme might be much faster than that observed in vitro.
Extended Data Figure 1
Nickel chelatase activity of CfbA.
(A) and (B) In vitro activity assay of CfbA. Purified CfbA was incubated with sirohydrochlorin and NiSO4 at 37°C (A). The insertion of nickel was monitored by UV/Vis absorption spectroscopy every 15 min. When CfbA was omitted from the assay mixture (B), no nickel insertion was observed. (C)
In vivo activity of CfbA. Cell pellets of E. coli cells transformed with either pETcoco-2-cobA-sirC-cfbA or pETcoco-2-cobA-sirC-cfbA-nixA grown in the presence of nickel.
To this end the activity of CfbA as a nickel-chelatase was also probed in vivo. Under aerobic conditions E. coli does not import nickel, although anaerobically a high affinity multicomponent system, nikA-E, is activated20–22. We attempted to produce Ni2+-sirohydrochlorin in E. coli by linking the expression of the genes for the production of precorrin-2 (cobA) and sirohydrochlorin (sirC) with the nickel chelatase (cfbA/cbiX) by cloning them consecutively on the same plasmid to give pETcoco-2-cobA-sirC-cfbA. Additionally, to maximise the availability of Ni2+ for CfbA, we added the gene for the Helicobacter pylori nickel transporter (nixA)23 to the construct to give pETcoco-2-cobA-sirC-cfbA-nixA. E. coli cells containing pETcoco-2-cobA-sirC-cfbA grown in the presence of nickel, at concentrations between 25 µM and 100 µM, were dark brown in colour. However, E. coli containing pETcoco-2-cobA-sirC-cfbA-nixA grown under the same conditions were observed to have a dark violet pigmentation (Extended Data Figure 1). The violet pigment was identified as Ni2+-sirohydrochlorin by mass spectrometry (Extended Data Figure 2). Altogether, these results show that CfbA/CbiXS can act as a nickel-chelatase both in vitro and in vivo. Given the large accumulation of Ni2+-sirohydrochlorin within the recombinant E. coli, several milligrams per litre of culture, and the lack of free sirohydrochlorin, we can state that CfbA is more than active enough in vivo to support F430 synthesis. The discrimination between metals such as Ni2+ and Co2+
in vivo by the chelatase must reflect the different availabilities of these divalent metal ions in the bacterial cytoplasm24.
Extended Data Figure 2
Amidotransferase activity of CfbE.
(A)
In vivo activity of CfbE. E. coli cells transformed with pETcoco-2-cobA-sirC-cfbA-nixA and pET14b-cfbE and grown in the presence of nickel produce a dark violet pigment that co-purifies with CfbE during IMAC. (B) and (C)
15N labelling of nickel-sirohydrochlorin a,c-diamide. (B) Reverse-phase HPLC chromatogram of (i) nickel-sirohydrochlorin substrate, m/z = 919; (ii) unlabelled nickel-sirohydrochlorin a,c-diamide, m/z = 917; (iii) 15N labelled nickel-sirohydrochlorin a,c-diamide, m/z = 919. (C)
15N 1H HSQC of an ATP limited titration with nickel-sirohydrochlorin, CfbE and 15NH3. The a and c amide groups increase proportionally in intensity as the level of ATP increases.
Amidase CfbE
To investigate the in vivo activity of the putative a,c-diamide synthetase (amidotransferase or amidase), CfbE (Mbar_A0348), we co-transformed E. coli with the CfbE-producing plasmid pET14b-cfbE and pETcoco-2-cobA-sirC-cfbA-nixA. The resulting strain was grown in the presence of exogenous nickel and was harvested as a dark violet pellet. Extraction of the His6-tagged CfbE by IMAC from the lysed cell pellet resulted in the co-isolation of a tightly bound violet coloured pigment (Extended Data Figure 2) in line with the observation that many tetrapyrrole biosynthetic enzymes bind their products tightly in order to facilitate direct metabolite channelling25. Analysis of this pigment by HPLC-MS revealed that it elutes as a single peak at 20.5 min with a mass of 917 Da, consistent with the expected molecular weight for Ni2+-sirohydrochlorin diamide (C42H46N6O14Ni). In comparison, a standard of Ni2+-sirohydrochlorin (C42H44N4O16Ni) eluted on HPLC-MS as a triple peak between 23-25 min with the predominant species showing a mass of 919 Da (Extended Data Figure 2).The amidase activity of CfbE was investigated by incubating purified enzyme with Ni2+-sirohydrochlorin, MgATP and glutamine. HPLC-MS analysis of the reaction products showed a single peak at 20.5 min with a mass of 917 Da (Extended Data Figure 2). By replacing glutamine with 15NH3 in the CfbE reaction, it was found that the main product peak eluted at the same retention time, but exhibited an increased mass of two units to 919 Da, consistent with the incorporation of the heavy isotope into the tetrapyrrole side chains during the reaction (Extended Data Figure 2). NMR analysis of Ni2+-sirohydrochlorin a,c-diamide after labelling of the side chains with 15NH3 confirmed the incorporation of the two amide groups into the acetic acid side chains attached to rings A and B (Extended Data Figures 2 and 3; Supplementary Information Table 1).
Extended Data Figure 3
NMR characterisation of Ni2+-sirohydrochlorin a,c-diamide.
1H-13C HSQC (A) and 1H-15N HSQC (B) of 4 mM Ni2+-sirohydrochlorin a,c-diamide in D2O.
Single turnover reactions demonstrated that the order of side chain amidation was random whilst time course studies indicated a direct conversion of the substrate into the diamide product, without release of the monoamide. Sirohydrochlorin also acted as a substrate for CfbE but only produced a monoamide species in a much slower reaction, highlighting that Ni2+-sirohydrochlorin is the preferred substrate for the amidotransferase.Finally, kinetic parameters were determined for the amidation reaction from a study of both the ATPase and glutaminase activities of CfbE in the presence of Ni2+-sirohydrochlorin (Extended Data Figure 4). With glutamine as the variable substrate and ATP fixed at 0.5 mM, the Km and turnover number were estimated at 46 μM and 0.78 min-1, respectively. When the concentration of ATP was varied, with glutamine fixed at 1 mM, Km and turnover number were estimated at 28 μM and 1.03 min-1, respectively. Further, the enzyme was found to be inactive with other metallo-sirohydrochlorins such as siroheme and Co2+-sirohydrochlorin.
Extended Data Figure 4
Steady-state kinetics of the M. barkeri CfbE amidotransferase with glutamine or ATP as a variable.
(A) 1 mM glutamine with ATP varied between 0.05 – 1.5 mM ATP. (B) 0.5 mM ATP with glutamine varied between 0.05 – 10 mM. Fixed conditions: Buffer B, 20°C, 2.5 μM M. barkeri CfbE, 25 μM nickel-sirohydrochlorin, 5 mM MgCl2. The mean values and error bars were calculated from 3 technical repeats.
Reductase CfbC/D
The CfbC/D proteins (Mbar_A0346, Mbar_A0347) belong to the family of the so-called class IV nitrogenase NflD/H26,27 that was shown to lack nitrogenase activity in Methanocaldococcus jannaschii but was suspected of being involved in a methanogen specific process18. Recombinant CfbC and CfbD were produced as His6-tagged proteins in E. coli and purified under anaerobic conditions, but UV/Vis absorption spectra and iron and sulfide determination assays indicated that Fe-S cluster incorporation were very low (<0.5 mol of iron and about 1 mol of sulfide per mol of protein). These values were improved through chemical Fe-S cluster reconstitution. The resulting iron and sulfide contents suggested the presence of inter-subunit [4Fe-4S] clusters. Consistent with this, both CfbC and CfbD migrated as dimers during gel filtration chromatography, although CfbD migrated as a monomer in the absence of the cluster. The presence of [4Fe-4S] centres on dithionite reduced CfbC/D was confirmed by EPR spectroscopy, where features in the g = 4 and g = 2 regions arise from the S = 3/2 and S = ½ spin states of [4Fe-4S]1+ clusters present in both proteins (Figure 2). Although CfbC is insensitive to the presence of MgATP, CfbD shows both MgADP and MgATP-dependent changes in the S = ½ and S = 3/2 signals (Figure 2, ii-iv). In mixtures of CfbC and CfbD the S = ½ signal for CfbD is much more intense than that of CfbC at the same protein concentration (Figure 2, vii), suggesting that CfbC has the lower midpoint redox potential (EM) and hence the need for ATP-coupled ‘uphill’ electron transfer. The addition of MgATP to the protein mixtures produces the spectrum of Figure 2, viii, showing a greater reduction of CfbC and less reduced CfbD in keeping with the proposed MgATP-dependent electron transfer from CfbD to CfbC.
Figure 2
EPR characterization of CfbC/D.
X band continuous wave EPR spectra of dithionite reduced proteins: (i), CfbC: (ii), CfbD: (iii), CfbD plus excess MgADP: (iv), CfbD plus excess MgATP. ii – iv have the same vertical scale, protein concentration and dithionite concentration. (v), CfbC: (vi), CfbD: (vii), one-to-one mixture of CfbC and CfbD: (viii), one-to-one mixture of CfbC and CfbD plus excess MgATP. v-viii have the same vertical scale, protein concentration and dithionite concentration. Experimental parameters: microwave power 0.5 mW, field modulation amplitude 7 G, temperature 15 K.
The reductase activity was investigated by incubating reconstituted CfbC/D with Ni2+-sirohydrochlorin a,c-diamide, MgATP and sodium dithionite as the source of electrons. During the incubation, the characteristic UV/Vis absorbance of Ni2+-sirohydrochlorin a,c-diamide at 594 nm decreased, and new absorption features around 446 and 423 nm appeared (Figure 3). Interestingly, the decrease in absorbance at 594 nm and the concomitant increase in absorbance at 446 nm were observed only during the first 1.5 h of incubation, and the absorption feature at 446 nm shifted to 423 nm during prolonged incubation for 14-22 h without any further signal decrease at 594 nm. When CfbC or MgATP were omitted from the assay as a control, the UV/Vis absorption spectrum did not change (Figure 3).
Figure 3
Enzymatic activity of CfbC/D.
(A) Left, UV/Vis absorption spectra of the conversion of Ni2+-sirohydrochlorin a,c-diamide (green line) to Ni2+-hexahydrosirohydrochlorin a,c-diamide (blue line) catalysed by CfbC/D during 1.5 h and autocatalytic formation of the lactam ring E yielding seco-F430 (pink and red lines) during 14-22 h of incubation. Right, UV/Vis absorption spectra of the control reaction lacking CfbC. (B) HPLC analysis (left) of the reaction products from (A) after 1.5 and 22 h of incubation with diode-array detection (right). Characteristic absorption features of the reaction products are indicated.
HPLC analysis of the tetrapyrrole content of the CfbC/D assay mixture after 1.5 and 22 h of incubation revealed that the respective reaction products eluted at the same retention time but exhibited clearly different UV/Vis absorption spectra (Figure 3). Whereas the product formed after 1.5 h exhibited absorption features at 309, 358 and 446 nm, which is very similar to the spectrum of a synthetic Ni2+-tetrahydrocorphinat28, the product formed after 22 h showed absorption at 305 and 428 nm, strikingly similar to the absorption spectrum of seco-F43015. Both reaction products exhibited a mass of 923 Da consistent with the theoretical mass of Ni2+-hexahydrosirohydrochlorin a,c-diamide or seco-F430 (Extended Data Figure 5). Together these results suggest that during the first part of the reaction (1.5 h) CfbC/D reduces the macrocycle through the addition of 6 electrons and 7 protons. The subsequent reaction (22 h), which may be spontaneous15,29,30, represents lactam formation on ring E and the generation of seco-F430. Indeed, the structure of the seco-F430 intermediate was confirmed using 2D heteronuclear NMR spectroscopy in D2O (Extended Data Figure 6; Supplementary Information Table 2). The overall effect of the reduction process and ring lactamisation is to introduce 7 new steric centres into the macrocycle, indicating that the CfbC/D catalyses a highly orchestrated spatial and regio-selective reaction.
Extended Data Figure 5
Characterization of the CfbC/D assay reaction products by mass spectrometry after HPLC separation.
(A) Mass spectrum with the isotopic pattern of the reaction product after 1.5 h of incubation measured in positive ion mode. (B) Mass spectrum with the isotopic pattern of the reaction product after 22 h of incubation measured in positive ion mode.
Extended Data Figure 6
NMR characterization of seco-F430.
1H-13C HSQC (A) and 1H-15N HSQC (B) of 4 mM seco-F430 in D2O.
It is interesting to note that Nature employs nitrogenase-like proteins (NifD, H, K) to catalyse difficult reduction reactions, or at least reactions that require a low redox potential, including the reduction of N2 to NH331, protochlorophyllide to chlorophyllide26 and Ni2+-sirohydrochlorin diamide to Ni2+-hexahydrosirohydrochlorin diamide. Clearly, the role of CfbC/D more closely parallels the stereospecific reduction of the C17-C18 double bond catalysed by the orthologous DPOR during chlorophyll and bacteriochlorophyll biosynthesis26, but the requirement in F430 biosynthesis for only the NifD and NifH homologues suggests that this system may provide a simpler model for the coupling of ATP hydrolysis to such biological reduction processes. Significantly, we have yet to identify the source of the electrons, such as a ferredoxin, for the saturation of the three double bonds during F430 biosynthesis, an omission that may hinder the heterologous production of the coenzyme in E. coli.
seco to F430 by CfbB
To investigate the function of recombinant, purified CfbB (Mbar_A0345), the protein was added to an assay mixture containing either Ni2+-hexahydrosirohydrochlorin a,c-diamide formed by the action of CfbC/D or seco-F430 together with MgATP. At different time points, the tetrapyrrole content of the mixtures was analysed by HPLC with diode-array detection and HPLC-MS. As shown in Figure 4, CfbB converted both substrates into new reaction products as indicated by the changes of the characteristic UV/Vis absorption spectra. For the mixture containing the Ni2+-hexahydrosirohydrochlorin a,c-diamide the major absorption peak at 446 nm slightly shifted to 448 nm and the features at 309 and 358 nm disappeared. For the reaction mixture containing seco-F430 the newly formed product exhibited absorption features identical to those of authentic coenzyme F430 with maxima at 276 and 436 nm (Figure 3 and Extended Data Figure 7). For both reaction products, HPLC-MS revealed a mass of 905 Da, consistent with the theoretical mass of coenzyme F430 (Extended Data Figure 7). Considering the different absorption spectra, we propose that CfbB converts Ni2+-hexahydrosirohydrochlorin a,c-diamide into a coenzyme F430 variant lacking the lactam ring E and seco-F430 into coenzyme F430. Further activity assays with less CfbB showed that the conversion of seco-F430 occurs much faster than that of Ni2+-hexahydrosirohydrochlorin a,c-diamide establishing seco-F430 as the true substrate for CfbB.
Figure 4
Enzymatic activity of CfbB.
(A) UV/Vis absorption spectra (after HPLC separation) of the substrate Ni2+-hexahydrosirohydrochlorin a,c-diamide (blue line) and the reaction product observed after incubation with CfbB and ATP for 2 h (pink line). (B) UV/Vis absorption spectra (after HPLC separation) of the substrate seco-F430 (red line) and the reaction product observed after incubation with CfbB and ATP for 1 h (orange line).
Extended Data Figure 7
Characterization of the CfbB assay reaction products.
(A) UV/Vis absorption spectrum of an F430 standard in 0.01 % formic acid / acetonitrile. (B) CfbB assay with Ni2+-hexahydrosirohydrochlorin a,c-diamide as the substrate. Mass spectrum with the isotopic pattern of the reaction product after 2 h of incubation measured in positive ion mode after HPLC separation. (C) CfbB assay with seco-F430 as the substrate. Mass spectrum with the isotopic pattern of the reaction product after 22 h of incubation measured in positive ion mode after HPLC separation.
The structure of coenzyme F430 formed by CfbB was confirmed by 2D heteronuclear NMR spectroscopy. It was not possible to obtain a complete data set for coenzyme F430 in D2O as the ROESY and HMBC spectra were of poor quality. Therefore, we used the non-coordinating solvent TFE-d3, which allowed us to assign all resonances and thereby confirm the structure.. Cyclisation of the ring D propionate side chain was confirmed through absence of a proton at the C10 position and the carbon chemical shift of C173 observed at 200.34 ppm. The chemical shifts were in close agreement with previously published data (Extended Data Figure 8; Supplemental Information Table 3)32. A mechanism for CfbB is shown in Extended Data Figure 9.
Extended Data Figure 8
NMR characterisation of F430 synthesised by CfbB.
1H-13C HSQC and 1H-15N HSQC of F430 in TFE-d3.
Extended Data Figure 9
Proposed mechanism for the reaction catalyzed by CfbB.
Initially, CfbB promotes the ATP-dependent phosphorylation of the propionic acid side chain on ring D of seco-F430. This activated side chain is then able to undergo cyclisation to form ring F and thereby generate coenzyme F430.
Conclusion
The elucidation of the pathway for coenzyme F430 biosynthesis (Figure 5) completes our understanding of how the major members of the modified tetrapyrrole family are constructed. By using a rich tapestry of enzymes Nature has shown how it is possible to construct a broad range of complex small molecules, such as heme, chlorophyll, vitamin B12 and coenzyme F430, that are all derived from a common tetrapyrrole template and which are all involved in fundamental cellular processes, ranging from photosynthesis through to respiration. Although the biosynthesis of molecules such as heme and chlorophyll have been understood for some time12 recent research has led to the determination of the aerobic25,33 and anaerobic34 pathways for vitamin B12 biosynthesis and the unexpected discovery of alternative routes for heme synthesis35,36. By identifying the enzymes responsible for the transformation of sirohydrochlorin into coenzyme F430 we have been able to show how the assembly of the molecular framework that is used to house nickel is orchestrated and optimised for its role in methanogenesis. Three of these biosynthetic steps require MgATP reflecting the high energetic cost in making this specialised metallo-prosthetic group. Our understanding of F430 synthesis will not only allow the opportunity to explore the development of recombinant MCR systems, a key component of which requires the synthesis of the essential F430 coenzyme, but also lead to mechanistic studies of some very interesting enzymes.
Figure 5
Biosynthesis of coenzyme F430 from sirohydrochlorin.
The overall series of reactions required for the transformation of sirohydrochlorin into coenzyme F430. There are four enzymatic steps, requiring CfbA, E, C/D and B, as well as one spontaneous process (in vitro), which might be enzyme-catalysed in vivo. The formal chemical changes for each step are given below the arrows not reflecting required cofactors or enzymatic mechanisms. The introduced structural changes are highlighted in red.
Methods
Cloning of putative coenzyme F430 biosynthetic genes
Genomic DNA of Methanosarcina barkeri strain Fusaro DSM804 was provided by Prof. Dr. Rolf Thauer from the Max-Planck-Institute for Terrestrial Microbiology (Marburg, Germany). A list of the plasmids used in this work is given in Extended Data Table 1. Genes were PCR amplified using a forward primer containing NdeI or AseI and a reverse primer with both SpeI and BamHI restriction sites (see Extended Data Table 1). The SpeI site was added on the reverse primer for subsequent link and lock cloning37. PCR fragments were digested with the relevant restriction enzymes and ligated into the pET14b plasmid. Genes were sequenced by GATC Biotech (Konstanz, Germany) or Source BioScience LifeSciences (Nottingham, UK). For the subcloning of Mbar_A0344, the gene was PCR amplified from pET14b-cfbA using primers cbiX_AscI_fo and cbiX_SalI_re (Extended Data Table 1). The resulting PCR fragment was digested with AscI and SalI and ligated into the correspondingly digested vector pETDuet-1 (Novagen / Merck Millipore, Darmstadt, Germany). The gene Mbar_A0344 was then cut from this construct using the restriction enzymes NdeI and SalI and the purified fragment was ligated into the correspondingly digested plasmid pET22b (Novagen) yielding expression plasmid pET22b-cfbA (Extended Data Table 1). For cloning of multi-gene constructs, sequenced genes were transferred into pET3a (to remove the His6-tag), then constructed piecewise by the link and lock cloning method37 in the pETcoco-2KAN plasmid.
Recombinant protein production and purification of His6-tagged proteins
E. coli Rosetta pLysS was transformed with plasmids containing putative coenzyme F430 biosynthesis genes cloned into pET14b and selected on LB agar with 34 μg mL-1 chloramphenicol and 100 μg mL-1 ampicillin. For protein production, an overnight pre-culture was grown in LB medium for 16 h at 37 °C, 150 rpm. The next day 10 mL of pre-culture was transferred into 1-4 L of LB medium with 34 μg mL-1 chloramphenicol and 100 μg mL-1 ampicillin. The cells were grown at 37 °C, 150 rpm until an OD600 of 1.0 was reached. Protein production was induced with 0.4 mM IPTG and cells were left overnight at 19 °C with 150 rpm shaking. For increased production of iron-sulfur enzymes, 1 mM ammonium ferric citrate was added to the cultures at the induction stage. Proteins containing Fe-S clusters were purified in an anaerobic glovebox (Belle Technologies or Coy Laboratory Products), with O2 levels at less than 2 ppm. All buffers and solutions were purged with argon prior to use in the glovebox. E. coli cultures were centrifuged at 5,180 × g at 4 °C for 20 min. Cells were then resuspended in 15 mL of binding buffer (20 mM Tris-HCl pH 8, 500 mM NaCl and 5 mM imidazole), followed by sonication under anaerobic conditions at 4 °C for 5 minutes with 10 and 30 second pulse and rest cycles, respectively. Cell lysates were centrifuged at 37,044 × g at 4 °C for 20 min. The supernatant was then purified using 5 mL of pre-charged nickel chelated sepharose. This was then washed with 50 mL of binding buffer, followed by washing steps (25 mL) containing increasing concentrations of imidazole from 30 to 70 mM. Elution was performed with buffer containing 400 mM imidazole. Purified protein was desalted on a pre-packed PD-10 column equilibrated in buffer without imidazole.
Recombinant production and purification of non-tagged CfbA
E. coli Rosetta pLysS containing plasmid pET22b-cfbA was cultivated as described above with the exception that the induction of protein production with IPTG was initiated when the cells had reached an OD600 of about 0.4. After overnight cultivation the cells were harvested by centrifugation and the cell pellet from 1 L of culture was resuspended in 20 mL of buffer A (50 mM Tris-HCl, pH 8) containing 1 mM phenylmethylsulfonyl fluoride (PMSF). Cells were disrupted by sonication and the resulting cell lysate was centrifuged in an ultracentrifuge at 175,000 × g at 4 °C for 60 min. The soluble protein fraction was loaded onto a 1 mL HiTrap Q XL column (GE Healthcare) at a flow rate of 1 mL min-1. The column was washed with 10 mL of buffer A and the bound proteins were then eluted using a linear NaCl gradient (0 – 400 mM NaCl in buffer A) developed over 20 mL. The CfbA-containing elution fractions were pooled, concentrated to 5 mL and then loaded onto a HiLoad 16/600 Superdex 75 prep grade column (GE Healthcare) equilibrated with 50 mM Tris-HCl, pH 8, 150 mM NaCl at a flow rate of 1 mL min-1. The elution fractions containing CfbA were pooled and the buffer of the purified protein was exchanged inside the anaerobic chamber using a PD-10 column equilibrated with anaerobic test buffer (25 mM Tris-HCl, pH 8, 150 mM NaCl, 10 mM MgCl2, 10 % (v/v) glycerol). The purified CfbA was stored at -80°C until further use.
Reconstitution of iron-sulfur clusters
The reconstitution of iron-sulfur clusters within CfbC and CfbD was performed as described previously38. After reconstitution, the excess of iron and sulfide was removed by centrifugation and subsequent passage of the protein solution through a NAP-25 column (GE Healthcare) which was used according to the manufacturer’s instructions. The iron and sulfide concentrations for Mbar_A0346 (CfbC) and Mbar_A0347 (CfbD) were determined as previously described39. Protein concentration was estimated separately using Bradford reagent (Bio-Rad Laboratories) with bovine serum albumin as a calibration standard.
EPR of CfbC and CfbD
Samples were prepared and then flash frozen in liquid nitrogen. EPR experiments were performed on a Bruker ELEXSYS E500 spectrometer operating at X-band, employing a Super High Q cylindrical cavity (Q factor ~ 16,000) equipped with an Oxford Instruments ESR900 liquid helium cryostat linked to an ITC503 temperature controller. Experimental parameters: microwave power 0.5 mW, field modulation amplitude 7 G, field modulation frequency 100 KHz, temperature 15 K.
Nickel chelatase activity assay (CfbA)
Sirohydrochlorin was synthesized using the one-pot incubation method described previously40. For the CfbA activity assay, 5 µM sirohydrochlorin and 50 µM of NiSO4 were incubated at 37°C with varying amounts of purified CfbA (0, 1, 1.5 and 2.5 µM) in anaerobic test buffer (50 mM Tris-HCl, pH 8, 150 mM NaCl, 10 mM MgCl2, 10 % (v/v) glycerol) inside the anaerobic chamber. For each enzyme concentration the assay was performed at least three times. The deduced specific activity represents the mean value of all measurements. The chelation of nickel into sirohydrochlorin was monitored by recording UV/Vis absorption spectra at different time points using a V-650 spectrophotometer (Jasco, Gross-Umstadt, Germany).
Synthetic production of nickel-sirohydrochlorin a,c-diamide in E. coli
E. coli KRX auto-induction strain was transformed with the pETcoco-2KAN-cobA-sirC-cbiX-nixA and pET14b-Mbar_A0348 plasmids using 0.2% (w/v) glucose to maintain the single copy state of the pETcoco-2KAN derived plasmid and 25 μg mL-1 kanamycin and 100 μg mL-1 ampicillin for antibiotic selection. An overnight pre-culture was grown for 16 h at 28 °C, 150 rpm. The next day 10 mL of pre-culture was transferred into 1 L of 2YT medium with 50 μg mL-1 kanamycin, 100 μg mL-1 ampicillin, 0.05% glucose (w/v), 0.1% rhamnose (w/v), 0.01% (w/v) arabinose and between 25 µM and 100 μM NiCl2.6H2O. The cells were grown at 28 °C and 150 rpm for 24 h. This yields approximately 1-2 mg L-1 of nickel-sirohydrochlorin a,c-diamide in complex with the His6-tagged amidotransferase Mbar_A0348 (CfbE) enzyme, which can be purified using IMAC purification under low-salt (100 mM) buffer conditions.
Amidotransferase kinetics (CfbE)
The protocol for the antimony-phosphomolybdate colorimetric based stopped-assay41 was used for determining the ATPase activity of the M. barkeri CfbE amidotransferase in the presence of its substrate nickel-sirohydrochlorin. 0.2% (w/v) citric acid was added after a time delay of 2 min to prevent background increases in absorbance from acid hydrolysis of ATP. Assays were performed in buffer B (20 mM Tris-HCl, pH 8 and 100 mM NaCl buffer) at 20 °C.
Amide 15N labelling ATP titration experiment and NMR of nickel-sirohydrochlorin a,c-diamide
(15NH3)2SO4 (Cambridge Isotope Laboratories) was used for labelling of the amide side chains. Single-turnover reactions were prepared in 10 mL of buffer B with 25 μM of pure M. barkeri CfbE, 25 μM nickel-sirohydrochlorin, 1 mM MgCl2, 25 mM (15NH3)2SO4. Turnover was controlled by an ATP titration series of 0, 25, 50 and 100 μM. Reactions were left for 30 min at 37 °C. The reaction product was purified in d6-DMSO in order to reduce proton solvent exchange to allow observation of the NH amide signals, which are barely detectable in D2O or acidic (pH 5) 1:10 H2O/D2O mixtures. Two-dimensional datasets were collected including 1H-15N HSQC, 1H-1H NOESY and 1H-15N HSQC-TOCSY spectra. The 1H-15N correlation spectra were collected by the SOFAST-HSQC method, which increases sensitivity using fast repetition rates42. This method resolved four clear amide peaks with no background signals (Extended Data Figure 2). These were correlated to show clear NOE through space interactions with the ring A and C propionate side chains as indicated in the ROESY and NOESY spectra (Extended Data Figure 3; Supplementary Information Table 1). This provides strong evidence for the positioning of the amide groups at the a and c positions, thus confirming the product of the CfbE amidation reaction as Ni2+-sirohydrochlorin a,c-diamide.
LC-MS of nickel-sirohydrochlorin and nickel-sirohydrochlorin a,c-diamide
Samples (10-100 μL) were injected onto an Ace 5 AQ column (2.1 x 150 mm, 5 μm, Advanced Chromatography Technologies) that was attached to an Agilent 1100 series HPLC coupled to a micrOTOF-Q (Bruker) mass spectrometer and equipped with online diode array and fluorescence detectors and run at a flow rate of 0.2 mL min-1. Tetrapyrroles were routinely separated with a linear gradient of acetonitrile in 0.1% TFA. Mass spectra were obtained using an Agilent 1100 liquid chromatography system connected to a Bruker micrOTOF II MS, using electro-spray ionisation in positive mode. UV/Vis absorption spectra were monitored by DAD-UV detection (Agilent Technologies).
The assay for testing the reductase activity of CfbC/D was performed under anaerobic conditions at 37°C in anaerobic test buffer (50 mM Tris-HCl, pH 8, 150 mM NaCl, 10 mM MgCl2, 10 % (v/v) glycerol). The assay contained 10 µM nickel-sirohydrochlorin a,c-diamide (formed in situ by the action of CfbE), 10 µM CfbC, 10 µM CfbD, 3.2 mM ATP, 3.2 mM sodium dithionite and residual amounts of the enzymes HemB, HemC, HemD, CobA, SirC, CfbA and CfbE which were used for the formation of nickel-sirohydrochlorin a,c-diamide. The reaction was followed by UV/Vis absorption spectroscopy and by analysing the tetrapyrrole content of the assay mixtures after 0, 1.5, 14 and 22 h of incubation by HPLC. For HPLC analysis, the tetrapyrroles were extracted by denaturation of the proteins using guanidinium chloride. For this, 160 mg of guanidinium chloride were dissolved in 300 µL of the sample, and the mixture was incubated for 2 min at room temperature. Subsequently, the free tetrapyrroles were separated from the denatured proteins by ultrafiltration using an Amicon™ Ultra 10 k filter unit (Merck Millipore). The tetrapyrrole-containing filtrate (40 µL injection volume) was analysed by HPLC using a ReproSil-Pur C18 AQ column (Dr. Maisch HPLC GmbH, Ammerbuch-Entringen, Germany) and a JASCO HPLC 2000 series system (Jasco). The separation was carried out at a flow rate of 0.2 mL min-1. Solvent A was 0.01 % formic acid in H2O and solvent B was acetonitrile. Tetrapyrroles eluted with a linear gradient system within 25 min: start conditions 95 % A / 5 %B and end conditions 65 % A / 35 % B. The tetrapyrroles were detected by photometric diode array analysis in the range of 220-670 nm. The masses of the eluting tetrapyrroles were confirmed by ESI-MS analysis on an Esquire 3000+ ESI ion trap mass spectrometer coupled to an Agilent 1100er series HPLC system using the same column, eluent, and gradient. Scan was carried out in alternating mode between m/z 500-2000, the target mass set to m/z 1000, nebulizer pressure to 70 psi, dry gas flow to 11 L min-1 and dry gas temperature to 360°C.
Ring F ligase activity assay (CfbB)
The CfbB assay was conducted under anaerobic conditions at 37°C in anaerobic test buffer (50 mM Tris-HCl, pH 8, 150 mM NaCl, 10 mM MgCl2, 10 % (v/v) glycerol). The assay contained 7.5 µM of either Ni2+-hexahydrosirohydrochlorin a,c-diamide or seco-F430 (formed as described for the CfbC/D assay), 0.75 µM or 7.5 µM CfbB and 3.2 mM ATP. After 1 or 2 h of incubation, the tetrapyrroles were extracted and analysed by HPLC and HPLC-MS as described for the CfbC/D assay.
NMR of seco-F430
For structural determination an isotopically enriched sample (4 mM) of the seco-F430 intermediate was prepared using 15N-glutamine as the amide donor and the incorporation of two 15N atoms in the product was confirmed by HPLC-MS. Analysis of the data following assignment established the presence of the lactam attached to ring B. This was determined from the combination of the following pieces of information. Protons attached to C3-C4 -C5 are present in a single scalar coupled network and C5 (36.37 ppm) appears sp3 hybridised with two germinal protons (1.56 and 1.84 ppm). The chemical shift of C6, assigned from the 1H-13C HMBC spectrum, is 96.39 ppm. Lastly, the 15N HSQC clearly shows 3 signals from which the germinal pair of protons was assigned to the NH2 of the a-sidechain (N23) and the single N-H resonance observed at lower field to the lactam formed from the c-sidechain of ring B (N73) (Extended Data Figure 6).
Data availability statement
All data generated or analysed during this study are included in this published article (and its supplementary information files).
Nickel chelatase activity of CfbA.
(A) and (B) In vitro activity assay of CfbA. Purified CfbA was incubated with sirohydrochlorin and NiSO4 at 37°C (A). The insertion of nickel was monitored by UV/Vis absorption spectroscopy every 15 min. When CfbA was omitted from the assay mixture (B), no nickel insertion was observed. (C)
In vivo activity of CfbA. Cell pellets of E. coli cells transformed with either pETcoco-2-cobA-sirC-cfbA or pETcoco-2-cobA-sirC-cfbA-nixA grown in the presence of nickel.
Amidotransferase activity of CfbE.
(A)
In vivo activity of CfbE. E. coli cells transformed with pETcoco-2-cobA-sirC-cfbA-nixA and pET14b-cfbE and grown in the presence of nickel produce a dark violet pigment that co-purifies with CfbE during IMAC. (B) and (C)
15N labelling of nickel-sirohydrochlorin a,c-diamide. (B) Reverse-phase HPLC chromatogram of (i) nickel-sirohydrochlorin substrate, m/z = 919; (ii) unlabelled nickel-sirohydrochlorin a,c-diamide, m/z = 917; (iii) 15N labelled nickel-sirohydrochlorin a,c-diamide, m/z = 919. (C)
15N 1H HSQC of an ATP limited titration with nickel-sirohydrochlorin, CfbE and 15NH3. The a and c amide groups increase proportionally in intensity as the level of ATP increases.
NMR characterisation of Ni2+-sirohydrochlorin a,c-diamide.
1H-13C HSQC (A) and 1H-15N HSQC (B) of 4 mM Ni2+-sirohydrochlorin a,c-diamide in D2O.
Steady-state kinetics of the M. barkeri CfbE amidotransferase with glutamine or ATP as a variable.
(A) 1 mM glutamine with ATP varied between 0.05 – 1.5 mM ATP. (B) 0.5 mM ATP with glutamine varied between 0.05 – 10 mM. Fixed conditions: Buffer B, 20°C, 2.5 μM M. barkeri CfbE, 25 μM nickel-sirohydrochlorin, 5 mM MgCl2. The mean values and error bars were calculated from 3 technical repeats.
Characterization of the CfbC/D assay reaction products by mass spectrometry after HPLC separation.
(A) Mass spectrum with the isotopic pattern of the reaction product after 1.5 h of incubation measured in positive ion mode. (B) Mass spectrum with the isotopic pattern of the reaction product after 22 h of incubation measured in positive ion mode.
NMR characterization of seco-F430.
1H-13C HSQC (A) and 1H-15N HSQC (B) of 4 mM seco-F430 in D2O.
Characterization of the CfbB assay reaction products.
(A) UV/Vis absorption spectrum of an F430 standard in 0.01 % formic acid / acetonitrile. (B) CfbB assay with Ni2+-hexahydrosirohydrochlorin a,c-diamide as the substrate. Mass spectrum with the isotopic pattern of the reaction product after 2 h of incubation measured in positive ion mode after HPLC separation. (C) CfbB assay with seco-F430 as the substrate. Mass spectrum with the isotopic pattern of the reaction product after 22 h of incubation measured in positive ion mode after HPLC separation.
NMR characterisation of F430 synthesised by CfbB.
1H-13C HSQC and 1H-15N HSQC of F430 in TFE-d3.
Proposed mechanism for the reaction catalyzed by CfbB.
Initially, CfbB promotes the ATP-dependent phosphorylation of the propionic acid side chain on ring D of seco-F430. This activated side chain is then able to undergo cyclisation to form ring F and thereby generate coenzyme F430.
Supplementary Material
Supplementary Information is linked to the online version of the paper at www.nature.com/nature.
Authors: Ashna A Raghoebarsing; Arjan Pol; Katinka T van de Pas-Schoonen; Alfons J P Smolders; Katharina F Ettwig; W Irene C Rijpstra; Stefan Schouten; Jaap S Sinninghe Damsté; Huub J M Op den Camp; Mike S M Jetten; Marc Strous Journal: Nature Date: 2006-04-13 Impact factor: 49.962
Authors: Helen M McGoldrick; Charles A Roessner; Evelyne Raux; Andrew D Lawrence; Kirsty J McLean; Andrew W Munro; Stefano Santabarbara; Stephen E J Rigby; Peter Heathcote; A Ian Scott; Martin J Warren Journal: J Biol Chem Date: 2004-11-03 Impact factor: 5.157
Authors: Peter T Chivers; Erin L Benanti; Vanessa Heil-Chapdelaine; Jeffrey S Iwig; Jessica L Rowe Journal: Metallomics Date: 2012-08-10 Impact factor: 4.526
Authors: Simon J Moore; Andrew D Lawrence; Rebekka Biedendieck; Evelyne Deery; Stefanie Frank; Mark J Howard; Stephen E J Rigby; Martin J Warren Journal: Proc Natl Acad Sci U S A Date: 2013-08-06 Impact factor: 11.205
Authors: Evelyne Deery; Susanne Schroeder; Andrew D Lawrence; Samantha L Taylor; Arefeh Seyedarabi; Jitka Waterman; Keith S Wilson; David Brown; Michael A Geeves; Mark J Howard; Richard W Pickersgill; Martin J Warren Journal: Nat Chem Biol Date: 2012-10-07 Impact factor: 15.040
Authors: Simon J Moore; Sven T Sowa; Christopher Schuchardt; Evelyne Deery; Andrew D Lawrence; José Vazquez Ramos; Susan Billig; Claudia Birkemeyer; Peter T Chivers; Mark J Howard; Stephen E J Rigby; Gunhild Layer; Martin J Warren Journal: Nature Date: 2017-05-03 Impact factor: 49.962
Authors: Nilkamal Mahanta; Andi Liu; Shihui Dong; Satish K Nair; Douglas A Mitchell Journal: Proc Natl Acad Sci U S A Date: 2018-03-05 Impact factor: 11.205
Authors: Raphaël Méheust; Cindy J Castelle; Paula B Matheus Carnevali; Ibrahim F Farag; Christine He; Lin-Xing Chen; Yuki Amano; Laura A Hug; Jillian F Banfield Journal: ISME J Date: 2020-07-17 Impact factor: 11.217