Literature DB >> 28218276

Natural and laboratory mutations in kuzbanian are associated with zinc stress phenotypes in Drosophila melanogaster.

Hung Le Manh1,2, Lain Guio1, Miriam Merenciano1, Quirze Rovira1, Maite G Barrón1, Josefa González1.   

Abstract

Organisms must cope with altered environmental conditions such as high concentrations of heavy metals. Stress response to heavy metals is mediated by the metal-responsive transcription factor 1 (MTF-1), which is conserved from Drosophila to humans. MTF-1 binds to metal response elements (MREs) and changes the expression of target genes. kuzbanian (kuz), a metalloendopeptidase that activates the evolutionary conserved Notch signaling pathway, has been identified as an MTF-1 target gene. We have previously identified a putatively adaptive transposable element in the Drosophila melanogaster genome, named FBti0019170, inserted in a kuz intron. In this work, we investigated whether a laboratory mutant stock overexpressing kuz is associated with zinc stress phenotypes. We found that both embryos and adult flies overexpressing kuz are more tolerant to zinc compared with wild-type flies. On the other hand, we found that the effect of FBti0019170 on zinc stress tolerance depends on developmental stage and genetic background. Moreover, in the majority of the genetic backgrounds analyzed, FBti0019170 has a deleterious effect in unpolluted environments in pre-adult stages. These results highlight the complexity of natural mutations and suggest that besides laboratory mutations, natural mutations should be studied in order to accurately characterize gene function and evolution.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28218276      PMCID: PMC5316978          DOI: 10.1038/srep42663

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Heavy metals are non-degradable substances that are natural constituents of the Earth crust1. Some heavy metals, such as iron, copper, and zinc, are required at structural and catalytic sites in proteins and are thus vital for many biological processes such as transcription, respiration, and growth123. Indeed, heavy metal deficiencies are related to animal and human diseases such as neurodegenerative and cardiovascular disorders2456. Although essential heavy metals are necessary for protein activity, when they are present at high concentrations they may bind to inappropriate sites in proteins interfering with their functions. Thus, under limiting conditions essential heavy metals have to be enriched while under excess conditions they have to be removed7. Response to heavy metal stress is mediated by the metal-responsive transcription factor-1 (MTF-1) that recognizes different metals and activates different sets of genes in a metal-specific manner78. MTF-1 is conserved from insects to vertebrates and besides heavy metal stress it also mediates the response to oxidative stress and hypoxia910111213. MTF-1 binds to short DNA sequence motifs known as metal response elements (MREs) activating or repressing expression of target genes14. Functional MREs have been located in the promoter regions, downstream of the transcription start site, and in the introns of metal-responsive genes7141516. In Drosophila, metallothioneins are the best characterized MTF-1 target genes. Metallothioneins have an extremely high affinity for heavy metal ions and play a role in both metal homeostasis and in defense against toxicity of heavy metals151718. Although metallothioneins play an important role in heavy metal stress, a knockout of four of the five members of this gene family, revealed that besides these proteins, other MTF-1 target genes must play a role in response to heavy metals and more specifically in zinc defense19. As expected according to these results, a genome-wide screen for MTF-1 target genes identified several candidate genes that respond to the presence of heavy metals in the environment16. One of these candidate genes, kuzbanian (kuz), is a metalloendopeptidase that controls many biological processes during development and differentiation20. kuz belongs to the ADAM family of metalloendopeptidases that are zinc-dependent enzymes mediating stress response in mammals21. In a previous work, we identified a putatively adaptive natural transposable element (TE), FBti0019170, inserted in an intron of kuz in Drosophila melanogaster natural populations22 (Fig. 1a). FBti0019170 is a 4.7 kb non-LTR retrotransposon that belongs to the F-element family. FBti0019170 is a strong candidate to play a role in out-of-Africa adaptation: while most TEs are deleterious and thus present at low frequencies in populations, FBti0019170 is present at high frequencies in North American populations and at low frequencies in African populations22. Additionally, the regions flanking this insertion showed signatures of a partial selective sweep. This suggests that FBti0019170 has increased in frequency due to positive selection22. FBti0019170 is located in the center of the sweep, and we could not identify any other linked mutation further suggesting that the TE is the causal mutation. We have also already shown using allele-specific expression experiments that a kuz allele carrying FBti0019170 insertion is overexpressed compared to a kuz allele without this insertion22.
Figure 1

FBti0019170 is a full-length F-element, 4,696 bp, inserted in the third intron of kuzbanian.

(a) kuzbanian (kuz) gene region. White boxes represent UTRs, black boxes represent CDS exons, black lines represent introns and intergenic regions, and the red box represents the FBti0019170 insertion. (b) The region amplified represents FBti0019170 insertion (2 L: 13,560,515–13,565,210) and its flanking regions. Black arrows show the approximate localization of the three primers designed to check for the presence/absence of FBti0019170. (c) Predicted Metal Response Elements are represented in purple: one is located inside FBti0019170 insertion and the other three in kuz’s third intron (see Supplementary Table S2).

In this work, we investigated whether kuz is involved in zinc stress response, as has been previously suggested16, and whether FBti0019170 has fitness consequences for flies that carry this natural insertion. We performed zinc stress tolerance assays using zinc chloride. High concentrations of zinc chloride are relevant for D. melanogaster natural populations because of its use in fertilizers23. We performed experiments with laboratory mutant flies and with flies collected in natural populations. Furthermore, because tolerance to environmental stress might differ between developmental stages, as has been already shown for lead, alcohol, and heat stress2425262728, we tested zinc stress tolerance in adult and pre-adult stages.

Results

kuz-overexpressing flies are associated with increased zinc stress tolerance

To check whether kuz is involved in zinc stress response, we first determined the concentration of zinc that is required to kill 50% of wild-type flies (LD50). We tested 5 mM, 10 mM, and 20 mM and determined that 20 mM was the adequate dose for both male and female flies (Supplementary Fig. S1A) (see Methods). We then compared the survival rate of transgenic flies overexpressing kuz, kuz-overexpressing flies, with wild-type flies with a similar genetic background: kuz-wildtype flies (Supplementary Table S1, see Methods). In nonstress conditions, that is, flies kept in standard fly food, we found no differences in the survival of kuz-overexpressing and kuz-wildtype flies (Fig. 2a). However, under zinc stress conditions, that is, flies kept in fly food supplemented with zinc, we found that kuz-overexpressing flies had higher survival than kuz-wildtype flies for both males and females (Fig. 2a and Table 1). To confirm these results, we performed a replicate of the experiment using flies from the same two strains a few generations later. We obtained the same results: both kuz-overexpressing male and female flies had higher survival than kuz-wildtype flies under zinc stress conditions (Fig. 2b and Table 1).
Figure 2

kuz-overexpressing flies are associated with zinc stress tolerance.

Survival curves under nonstress (discontinuous lines) and under zinc stress (continuous lines) conditions are represented in purple for kuz-overexpressing flies, and in green for kuz-wildtype flies. The first replica (a) and the second replica (b) showed that kuz-overexpressing flies are more tolerant to zinc stress both in males and in female flies. Each data point in the survival curves represent the average survival for 15 tubes containing 20 flies each for zinc stress conditions and 10 tubes containing 20 flies each for nonstress conditions. In each data point, error bars represent the standard error of the mean (SEM).

Table 1

Log-rank analysis results and odds-ratio of heavy metal stress experiments performed with adult flies.

Compared StrainsSexReplica 1
Replica 2
P-valueOdds ratioP-valueOdds ratio
kuz-overexpressing vs. kuz-wildtype (Fig. 2)Male≪0.0012.37 (1.7–3.32)≪0.0013.18 (2.25–4.50)
Female≪0.0012.19 (1.57–3.057)≪0.0013 (2.12–4.24)
Outbred FBti0019170(+) vs. Outbred FBti0019170(−) (Fig. 4)Male≪0.0012.32 (1.65–3.2395)≪0.0012 (1.44–2.78)
Female≪0.0011.97 (1.42–2.74)≪0.0012.45 (1.75–3.43)
IV22 FBti0019170(+) vs. B47 FBti0019170(−) (Fig. 6a,b)Male≪0.0015.38 (3.6633–7.91)≪0.0012.85 (2.02–4.012)
Female≪0.0014 (2.78–5.75)≪0.0013.23 (2.27–4.58)
IV145 FBti0019170(+) vs B47 FBti0019170(−) (Fig. 6c)Male≪0.00133.22 (13.11–84.22)
Female≪ 0.0012.45 (1.64–3.67)
B45 FBti0019170(+) vs B47 FBti0019170(−) (Fig. 6d)Male0.0051.76 (1.18–2.61)
Female0.0332.11 (1.42–3.15)
Overall, we found that while there were no differences in survival between kuz-overexpressing and kuz-wildtype flies in nonstress conditions, kuz-overexpressing flies had higher survival than kuz-wildtype flies under zinc stress conditions (Fig. 2 and Table 1). These results suggest that kuz could play a role in response to zinc stress.

Egg to adult viability is higher in kuz-overexpressing flies in zinc stress conditions

As mentioned above, tolerance to environmental stress might differ between developmental stages. Thus, we also tested egg to adult viability under zinc stress conditions in kuz-overexpressing and kuz-wildtype flies. We first performed an LD50 and found that 10 mM zinc is the dose at which ~50% of the wild-type embryos do not emerge (Supplementary Fig. S1B) (see Methods). We compared the egg to adult viability of kuz-overexpressing flies with kuz-wildtype flies in nonstress and in zinc stress conditions (Fig. 3). ANOVA analysis showed that the experimental condition (nonstress vs zinc stress) and the interaction between experimental condition and genotype (kuz-overexpressing vs kuz-wildtype) were significant (Fig. 3 and Table 2): kuz-overexpressing flies had higher egg to adult viability than kuz-wildtype flies in zinc stress conditions. This suggested that kuz could play a role in zinc stress response also in pre-adult developmental stages.
Figure 3

kuz-overexpressing embryos have a higher egg to adult viability under zinc stress.

kuz-overexpressing flies are represented in purple and kuz-wildtype flies are represented in green. Each column represents the average of egg to adult viability for 10 vials containing 50 kuz-wildtype embryos each and for 20 vials containing 50 kuz-overexpressing embryos each, both in zinc stress and nonstress conditions. In each data point, error bars represent the standard error of the mean (SEM).

Table 2

Two-way ANOVA analyses of egg to adult viability experiments.

Strains analyzedTwo-way ANOVA
Experimental condition (nonstress vs zinc stress)Insertion genotype (Presence vs absence of FBti0019170)Interaction between experimental condition & insertion genotype
P-valueEffect sizeP-valueEffect sizeP-valueEffect size
kuz-overexpressing vs kuz-wildtype (Fig. 3)≪0.0010.6490.0770.0030.147
Outbred FBti0019170 (+) vs outbred FBti0019170 (−) (Fig. 5)≪0.0010.688≪0.0010.2990.489
B38 FBti0019170 (−) vs B38 FBti0019170 (+) (Fig. 7a)≪0.0010.7500.426≪0.0010.146
IV52 FBti0019170 (−) vs IV52 FBti0019170 (+) (Fig. 7b)≪0.0010.7560.3950.399

FBti0019170 is associated with increased zinc tolerance in flies from outbred populations

As mentioned above, FBti0019170, inserted in the third intron of kuz, shows signatures of a selective sweep suggesting that this natural insertion has increased in frequency due to positive selection. We thus investigate whether flies with FBti0019170 were associated with increased tolerance to zinc stress. We analyzed both adult fly survival and egg to adult viability in nonstress and zinc stress conditions in natural strains with different genetic backgrounds: outbred strains and isofemale strains. Analyzing different genetic backgrounds is needed because the effect of mutations is often background dependent29. We first constructed two outbred laboratory strains: one outbred strain homozygous for the presence of FBti0019170 and one outbred strain homozygous for the absence of this insertion (see Methods). We subjected these two outbred strains to zinc stress and we found that both male and female flies with FBti0019170 had higher survival than flies without FBti0019170 (Fig. 4a and Table 1). The same results were obtained with the same outbred strains analyzed a few generations later (Fig. 4b and Table 1). In both replicas, no differences in survival between flies with and without FBti0019170 were found in nonstress conditions (Fig. 4). Overall, we found that FBti0019170 insertion is associated with increased zinc tolerance in adult flies from outbred populations.
Figure 4

Outbred flies with FBti0019170 insertion are associated with zinc stress tolerance.

Survival curves under non-stress conditions (discontinuous lines), and under zinc stress (continuous lines) are represented in red for outbred flies with FBti0019170 insertion, and in black for outbred flies without the insertion. The first (a) and the second replica (b) showed the same results for both males and females. Each data point in the survival curves represent the average survival for 15 tubes containing 20 flies each for zinc stress conditions, and 10 tubes containing 20 flies each for nonstress conditions. In each data point, error bars represent the standard error of the mean (SEM).

FBti0019170 is associated with decreased egg to adult viability both in nonstress and in zinc stress conditions in outbred populations

We also tested whether embryos from the outbred strain with FBti0019170 insertion were more tolerant to zinc stress compared with embryos from the outbred strain without the insertion. We performed two replicas of the experiment (Fig. 5). ANOVA analysis showed that the experimental condition (nonstress vs zinc stress) and the insertion genotype (presence vs absence of FBti0019170) were significant (Table 2). Both in nonstress and zinc stress conditions, flies with FBti0019170 had a lower survival rate compared to flies without the insertion (Fig. 5).
Figure 5

Egg to adult viability in outbred flies with FBti0019170 is lower than in outbred flies without FBti0019170 in nonstress and in zinc stress conditions.

Each column represents the average of egg to adult viability of 15 vials for zinc stress conditions and 10 vials for nonstress conditions. Outbred flies without the insertion are represented in black and outbred flies with the insertion are represented in red.

Thus, while FBti0019170 is associated with higher adult survival in zinc stress conditions, it is also associated with lower egg to adult viability both in nonstress and in zinc stress conditions in outbred populations.

FBti0019170 is not a dominant determinant of zinc stress tolerance

We also performed adult survival experiments in nonstress and zinc stress conditions with different isofemale strains. Adult survival of IV22, IV145, and B45 isofemale strains containing FBti0019170 insertion was compared with adult survival of B47 isofemale strain without this insertion (see Methods). No differences in survival between flies with and without FBti0019170 insertion were observed in nonstress conditions. However, we found that IV22 flies with FBti0019170 had lower survival than B47 flies without FBti0019170 (Fig. 6a and Table 1). We confirmed these results by performing a second replica a few generations later (Fig. 6b and Table 1). Similarly, IV145 flies with FBti0019170 also had lower survival than B47 flies without FBti0019170 (Fig. 6c and Table 1). On the other hand, male flies of B45 strain had higher survival than male flies of B47 strain (Fig. 6d and Table 1) while B45 female flies had higher survival than B47 female flies at early time points while they had lower survival at later time points (Fig. 6d and Table 1).
Figure 6

FBti0019170 is not a dominant determinant of zinc stress.

Survival curves under non-stress conditions (discontinuous lines) and under zinc stress (continuous lines) are represented in red for flies with FBti0019170 insertion, and in black for flies without the insertion. (a) Survival curves for IV22 vs B47 (first replicate), (b) Survival curves for IV22 vs B47 (second replicate), (c) survival curves for IV145 vs B47, and (d) survival curves for B45 vs B47. Each data point in the survival curves represent the average survival for 15 tubes containing 20 flies each for zinc stress conditions, and 10 tubes containing 20 flies each for nonstress conditions. Error bars represent the standard error of the mean (SEM) for each datapoint.

Therefore, in isofemale strains, we found that FBti0019170 is not a dominant determinant of zinc stress tolerance.

FBti0019170 effect in egg to adult viability in isofemale strains depends on the genetic background

To minimize the effect of polymorphisms other than the presence/absence of FBti0019170 on the zinc stress experiments results, we created homozygous strains for the presence and homozygous strains for the absence of FBti0019170 starting from two different FBti0019170 heterozygous strains (see Methods). For the B38 flies with and without FBti0019170 insertion, we found that the experimental condition, and the interaction between experimental condition and insertion genotype (presence/absence of FBti0019170) were significant (Fig. 7a and Table 2): in nonstress conditions flies with FBti0019170 had lower viability while in zinc stress conditions flies with FBti0019170 had higher viability than flies without this insertion. Finally, for IV52 strains with and without FBti0019170, only the experimental condition was significant (Fig. 7b and Table 2).
Figure 7

Egg to adult viability in isofemale strains with and without FBti0019170 depends on the genetic background.

Each column represents the average of egg to adult viability of 15 vials for zinc stress conditions and 10 vials for nonstress conditions. Strains without the insertion are represented in black and strains with the insertion are represented in red. (a) Egg to adult viability in B38 flies with and without FBti0019170 (b) and in IV52 flies with and without FBti0019170.

Overall, we found no consistent effects of FBti0019170 on zinc stress phenotypes suggesting that the effect of this insertion on egg to adult viability depends on the genetic background analyzed (Fig. 7).

FBti0019170 could add a metal-responsive element to the intron of kuzbanian

As mentioned above, kuz was found to be a MTF-1 target gene, and we have shown that kuz-overexpressing flies are more zinc tolerant compared to kuz-wildtype flies (Figs 2 and 3). We have also found that flies with FBti0019170 were associated with increased zinc tolerance in some genetic backgrounds (Fig. 4). To shed light on the mechanisms underlying zinc stress response in laboratory kuz mutant flies and natural kuz mutant flies, we investigated whether kuz has metal responsive elements (MREs) in its promoter region and whether FBti0019170 is introducing any additional MRE. We could not detect any MRE in the kuz promoter. On the other hand, we found a high score MRE nearby the 3′ end of FBti0019170 (Fig. 1c and Supplementary Table S2). This prompted us to investigate whether there were other MREs in the kuz intron where FBti0019170 is inserted, and we identified three additional MREs (Fig. 1c). Interestingly, two of these MREs are located only 462 bp downstream of the MRE introduced by FBti0019170 while the third intronic MRE is located nearby the 3′ end of the intron (Fig. 1c and Supplementary Table S2). Overall, we found four MREs present in the kuz intron where FBti0019170 is inserted. FBti0019170 adds one of these four MREs. Because there is a correlation between the number of transcription factor binding sites and the increase in the level of expression of nearby genes30, these results suggest that FBti0019170 could affect the expression of kuz and thus could play a role in zinc stress response.

Flies homozygous for the presence and for the absence of FBti0019170 insertion do not show differences in the level of kuz expression

We checked whether outbred flies homozygous for the presence of FBti0019170 showed different levels of kuz expression compared to outbred flies without this insertion. We performed qRT-PCR experiments both in nonstress and in zinc stress conditions for both male and female flies. No differences in the level of expression of kuz between flies with and without FBti0019170 were found in nonstress or zinc stress conditions for males or for females (Fig. 8).
Figure 8

Flies homozygous for the presence and for the absence of FBti0019170 showed no differences in kuz expression.

Normalized expression level relative to Act5C of kuz in nonstress and zinc stress conditions in male and female flies. Flies without FBti0019170 insertion are represented in grey and flies with FBti0019170 are represented in red. Error bars represent the SEM of three biological replicas.

Discussion

In this work, we showed that a laboratory mutant overexpressing kuz is associated with tolerance to zinc stress both in adult (Fig. 2) and embryo stages (Fig. 3). These results are consistent with a role of kuz in heavy metal stress response, as it has been previously suggested by experiments performed with MTF-1 mutant flies that identified kuz as a candidate heavy metal-responsive gene16. kuz, a metalloprotease that belongs to the ADAM family, is a component of the Notch signaling pathway that plays a role in axon guidance in the developing central nervous system2031323334. ADAM metalloproteases in mammals, and more specifically kuz ortholog ADAM10, ADAM17, and to a lesser extend ADAM9, also regulate epidermal growth factor receptor (EGFR) activation in response to a variety of stress agents21. Stress-induced EGFR activation leads to the activation of mitogen-activated protein kinase (MAPKs) signaling that trigger transcriptional regulation of a variety of stress-response genes1. Thus, both kuz and its ortholog gene ADAM10 could be involved in response to stress. Indeed, the organomercurial compound p-aminophenylmercuric acetate (APMA) has been reported to upregulate both kuz and ADAM10 protease activity3536 and methylmercury has been suggested to activate ADAM proteases in Drosophila37. Our previous results showing that FBti0019170 inserted in kuz third intron has most probably increased in frequency due to positive selection, prompted us to investigate whether flies with this insertion have increased zinc tolerance. To test this hypothesis, we generated an outbred population and analyzed six isofemale strains established from two different natural populations. We found that the effect of FBti0019170 on egg to adult viability and on adult survival under zinc stress conditions depended on the genetic background and the developmental stage analyzed (Figs 4, 5 and 7). These results are consistent with previous experimental data showing that the mutational effects in one genetic background are often enhanced or suppressed in other backgrounds3839. Background-dependent effects of mutations are most likely explained by epistatic interactions29. In the case of zinc-related phenotypes, it has been reported that an unmapped recessive X-linked mutation causes a threefold reduction of total body zinc accumulation in D. melanogaster40. This observation should not affect the results obtained with kuz-overexpresing and kuz-wildtype flies because both fly stocks have very similar X chromosomes. However, it could affect the results obtained with outbred and isofemales if these fly stocks differed in the recessive X-linked unmapped mutation4041. Our results are also consistent with previous findings showing that tolerance to environmental stress differs between developmental stages2425262728. We also showed that FBti0019170 was associated with lower egg to adult viability in nonstress conditions in two of the three backgrounds analyzed (Figs 5 and 7c). Between-environments trade-offs have been reported for cadmium resistance in D. melanogaster42 as well as for other environmental stress conditions such as oxidative stress43. Two mechanisms have been proposed to explain the fitness costs of heavy-metal tolerance in unpolluted environments: the activation of detoxification enzymes might use resources that are then unavailable for other fitness traits, and/or resistant flies might be less efficient at metal uptake or utilization, which would lead to micronutrient deficiencies42. In the case of FBti0019170, the deleterious effect of the mutation was found in egg to adult viability while no cost of selection was found in adult stages. As mentioned above, kuz plays a role in development and differentiation2031323334. Thus, it could be that the cost of selection of FBti0019170 is related to the role of kuz during development. Consistent with the activation of kuz by zinc, we found in silico evidence for three MREs located in the kuz intron where the candidate adaptive TE FBti0019170 is inserted (Fig. 1c). Indeed, FBti0019170 insertion adds another MRE 462 bp upstream of the three intronic MREs (Fig. 1c). We thus check the expression of kuz in flies homozygous for the presence and for the absence of FBti0019170 using qRT-PCR. We did not find differences in kuz expression in nonstress or in zinc stress conditions (Fig. 8). However, we have previously shown, using allele-specific expression, that an allele carrying FBti0019170 insertion is overexpressed compared to an allele that does not carry this insertion22. Because allele-specific expression is performed in F1 hybrids in which the two alleles share the same cellular environment, the expression differences between the two alleles must be due to cis-regulatory differences44. FBti0019170 is thus a strong candidate to be responsible for the observed differences in kuz expression level22. The lack of differential expression in homozygous flies could be partly explained by the higher sensitivity of allele-specific expression experiments compared to qRT-PCR45. Besides, it could be that FBti0019170 effect on kuz expression is overdominant as has been described for a few genes involved in temperature stress response46. Further experiments are needed in order to understand the molecular mechanism underpinning FBti0019170 insertion effects. As with other quantitative traits, including starvation stress and olfactory behavior, we have found that mutations in a gene with well-characterized roles in development affect tolerance to zinc stress38. Our results showed that while kuz laboratory mutants are consistently associated with increased tolerance to heavy metal stress in embryo and adult stages, flies containing natural kuz mutations have more complex fitness effects that depend on the developmental stage and the genetic background. Furthermore, while no cost of selection was associated with the laboratory mutant, we found that FBti0019170 is associated with decreased egg to adult viability in unpolluted environments. Different fitness effects of laboratory and natural mutations have previously been described suggesting that the analysis of natural mutations is needed in order to accurately characterize gene function and evolution4748.

Methods

Genotyping flies for presence/absence of FBti0019170

To check the insertion genotype, that is, whether different fly stocks were homozygous for the presence, homozygous for the absence, or heterozygous for FBti0019170 insertion, we performed PCR with two pairs of primers22. Primer pair Left (L) and Right (R) were designed to check for the presence of FBti0019170 (Fig. 1b). The Left primer (TTCGGAGTGAAAACATCCAAAGA) binds to FBti0019170 while the Right primer (TTGAATATTGTGTCGATTGCGTG) binds to the downstream sequence flanking the insertion (Fig. 1b). This primer pair only gives a PCR band when FBti0019170 is present. On the other hand, primer pair Flanking and Right was designed to check for the absence of FBti0019170. The Flanking (FL) primer (GACGAATTCATAAATTGGCGGTT) binds to the upstream sequence flanking the insertion (Fig. 1b). This primer pair only gives a PCR band when FBti0019170 is absent. If only the Left-Right primer pair gives a PCR band, the strain is homozygous for the presence of FBti0019170. If only the Flanking-Right primer pair gives a PCR band, the strain is homozygous for the absence of FBti0019170. Finally, if both primers give PCR bands, the strain is heterozygous for FBti0019170 insertion49. 48 different isofemale strains collected in Stockholm (Sweden, “B” strains) and 15 isofemale strains collected in Bari (Italy, “IV” strains), available in our laboratory, have been tested by PCR to check for the presence/absence of FBti0019170 natural insertion (Supplementary Table S1).

Fly strains

Laboratory mutant strains

We used transgenic flies that carry a full copy of kuz coding region under the control of a UAS promoter50 (Bloomington stock # 5816) (Supplementary Table S1). To activate the expression of kuz, we crossed the flies with transgenic flies that carry the GAL4 gene under the control of Act5C promoter (Bloomington stock # 4414) (Supplementary Table S1) and we kept the crosses at 25 °C. A total of 200 virgin female of kuz mutant flies were crossed with 200 male of Act5C-GAL4 flies. F1 flies carrying UAS-kuz and Act5C-GAL4, and thus overexpressing kuz, have wild-type wings (kuz-overexpressing flies) while F1 flies that do not have the Act5C-GAL4 chromosome and thus do not over-express kuz have Curly wings. A stock with a w[*] genetic background, as the kuz transgenic flies background, was used as the baseline for the experiment (kuz-wildtype flies; Bloomington stock # 7087) (Supplementary Table S1).

Outbred populations

To create an outbred population with FBti0019170 insertion and an outbred population without the insertion, a total of 10 isofemale strains were selected: five strains homozygous for the presence of the element (B7, B45, IV33, IV49, IV50) and five strains homozygous for the absence (B2, B4, B8, B15, B18) (Supplementary Table S1). We collected 10 virgin females and 10 males from each one of these strains. We did two crosses by mixing males and females with the TE to create an outbred FBti0019170 (+) strain, and males and females without the TE to create an outbred FBti0019170 (−) strain. We kept the two populations for at least seven generations before performing any phenotypic experiments.

Isofemale Strains

We selected three strains in which FBti0019170 was present (IV22, IV145 and B45) and one strain in which FBti0019170 was absent (B47) to perform phenotypic experiments (Supplementary Table S1). Isofemale flies heterozygous for FBti0019170 insertion were also selected to create homozygous flies for the presence and homozygous flies for the absence of FBti0019170 (see below).

Heterozygous strains

We first identified two isofemale strains (B38 and IV52) that were heterozygous for FBti0019170 insertion. We then collected 10 to 25 virgin females from each strain and crossed them individually with males from the same strain. F1 progeny of all the crosses were checked for the presence/absence of the FBti0019170 insertion by PCR. Brother-sister crosses were performed until we obtained flies that were homozygous for the presence of FBti0019170 and flies that were homozygous for the absence of FBti0019170. Those flies were amplified for several generations in order to obtain enough quantity of flies to perform the experiments.

Zinc stress experiments

We used zinc chloride (ZnCl2) as a heavy metal stress agent (Sigma-Aldrich catalog # Z0152). We have performed zinc stress experiments in two different life stages: adult flies and embryos.

Adult flies

To determine the Lethal Dose50 (LD50) for the adult flies experiments, we tested three different zinc concentrations: 5 mM, 10 mM and 20 mM. The experiments allowed us to identify the ZnCl2 concentration at which about 50% of the adult flies die. ZnCl2 was dissolved in water and added to the fly food to the desired final concentration. Standard fly food was used for the nonstress conditions. We used the outbred population without FBti0019170 to establish the LD50. We analyzed 10 vials for each concentration and sex with 20 five to seven day-old flies each. For the zinc stress tolerance experiments with adult flies from natural populations, a total of 100 vials with 20 flies each were used including 40 vials for nonstress conditions (10 vials per sex and per strain) and 60 vials for zinc stress condition (15 vials per sex and per strain). We used five to seven day-old flies. For the zinc stress experiments performed with kuz-overexpressing flies, we used 40 vials for the nonstress condition and 60 vials for the zinc stress condition. 10 vials per condition were used to perform the experiments for the kuz-wildtype flies. We used five to seven day-old flies in all experiments. We confirmed that UAS-Gal4 kuz-overexpressing flies showed a higher level of expression of kuz compared with kuz wildtype flies (Supplementary Fig. S2).

Embryos

We determined the LD50 using embryos from an isofemale strain without FBti0019170 insertion (B47). These experiments allowed us to identify the ZnCl2 concentration at which about 50% of the embryos do not emerge. We first tested three different ZnCl2 concentrations: 1.25 mM, 2.5 mM and 5 mM. The same strain and protocol but different concentrations of ZnCl2 were tested in a second LD50 experiment: 5 mM, 10 mM, 20 mM. In both cases, standard fly food was used for the nonstress conditions. Five day-old isofemale flies without FBti0019170 insertion were kept in chambers with agar and apple juice plates to lay eggs during 4 hours. 10 vials with 50 embryos each were analyzed for each of the three ZnCl2 concentrations and for the nonstress condition. Once the LD50 was determined, we performed zinc stress experiments using 50 embryos per vial. For the kuz-wildtype strain, we analyzed 10 vials for nonstress and 10 vials for zinc stress conditions. For the Kuz-overexpressing strains, we analyzed 20 vials for nonstress and 20 vials for zinc stress conditions. For natural strains, we used 15 vials for the zinc stress condition and 10 vials for the nonstress condition.

In silico prediction of MTF-1 binding sites

We use TFBSTools software51 to predict binding sites of MTF-1 in the kuz promoter region and in the kuz intron where FBti0019170 is inserted. Position weight matrices for MTF-1 transcription factor were obtained from JASPAR database52. The PB0044.1 and PB00148.1 matrices were used. Although the default score threshold in TFBSTools is 0.75, we were conservative and we only considered significant those hits with a score threshold ≥ 0.95. We used the release 6.02 of the D. melanogaster genome available at http://flybase.org.

qRT-PCR Expression analysis

We checked whether Act5C and rpl32, two reference genes that are commonly used for qRT-PCR expression level normalization, showed stable expression in zinc stress conditions. Both genes showed expression level stability under zinc stress conditions (Supplementary Fig. S3). We quantified the expression of kuz in nonstress and stress conditions induced by zinc. Five day-old outbred flies (30 females and 50 males) were separated by sex and transferred to standard fly food as well as food containing 20 mM zinc for 48 hours before freezing them in liquid nitrogen. We did three biological replicas with flies from three different generations for each sex and condition. We purified total RNA using Trizol reagent and we synthesized cDNA using 1 μg of RNA after treatment with DNase. We then used the cDNA for quantitative PCR analysis using Act5C as a housekeeping gene. The primers used were as follows: kuz_left primer: CACCGAGCATCGCAACATAC, kuz_right primer: GAATTGCGACAGGCCGAATC, Act5C_left primer: ATGTCACGGACGATTTCACG, and Act5C_right primer: GCGCCCTTACTCTTTCACCA. Results were analyzed using the dCT method and following the recommendations of the MIQE guideline53.

Statistical analysis

Log-rank test

The number of surviving flies for both nonstress and stress conditions were counted every 24 hours for five consecutive days. We used Kaplan-Meier to estimate the survival functions and performed a log-rank test to compare the functions between flies with and without the insertion using the SPSS software. The odds-ratio (O.R.) was calculated as: (number of tolerant flies alive/number of tolerant flies dead)/ (number of sensitive flies alive/number of sensitive flies dead). The upper and lower 95% O.R. confidence interval was calculated as: e ^ [ln OR ± 1.96 √ (1/ number of tolerant flies alive +1/ number of tolerant flies dead +1/ number of sensitive flies alive +1/ number of sensitive flies dead)]. We used the 95% confidence interval as a proxy for the presence of statistical significance when it does not overlap the null value, that is, O.R. = 1.

Two-way ANOVA analyses

The number of flies emerging from the experiments performed with embryos was transformed to a uniform distribution using the rank transformation. SPSS v21 was used to perform the ANOVA analyses. Two different variables were considered for the ANOVA analyses: the genotype (kuz-overexpressing/ kuz-wildtype or FBti0019170 present/ FBti0019170 absent), and the experimental condition (nonstress and zinc stress). The replicate effect was also considered. As a measure of the effect size, we estimated partial eta-squared values (0.01 small effect, 0.06 medium effect, and 0.14 large effect).

Additional Information

How to cite this article: Le Manh, H. et al. Natural and laboratory mutations in kuzbanian are associated with zinc stress phenotypes in Drosophila melanogaster. Sci. Rep. 7, 42663; doi: 10.1038/srep42663 (2017). Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
  48 in total

Review 1.  Metalloproteases: carving out a role in axon guidance.

Authors:  Sarah McFarlane
Journal:  Neuron       Date:  2003-02-20       Impact factor: 17.173

2.  Notch-induced proteolysis and nuclear localization of the Delta ligand.

Authors:  Christin E Bland; Priscilla Kimberly; Matthew D Rand
Journal:  J Biol Chem       Date:  2003-02-18       Impact factor: 5.157

3.  The Drosophila homolog of mammalian zinc finger factor MTF-1 activates transcription in response to heavy metals.

Authors:  B Zhang; D Egli; O Georgiev; W Schaffner
Journal:  Mol Cell Biol       Date:  2001-07       Impact factor: 4.272

Review 4.  Putting its fingers on stressful situations: the heavy metal-regulatory transcription factor MTF-1.

Authors:  P Lichtlen; W Schaffner
Journal:  Bioessays       Date:  2001-11       Impact factor: 4.345

5.  kuzbanian-mediated cleavage of Drosophila Notch.

Authors:  Toby Lieber; Simon Kidd; Michael W Young
Journal:  Genes Dev       Date:  2002-01-15       Impact factor: 11.361

6.  Characterization of the transcription factor MTF-1 from the Japanese pufferfish (Fugu rubripes) reveals evolutionary conservation of heavy metal stress response.

Authors:  A Auf der Maur; T Belser; G Elgar; O Georgiev; W Schaffner
Journal:  Biol Chem       Date:  1999-02       Impact factor: 3.915

7.  Metal-responsive transcription factor (MTF-1) and heavy metal stress response in Drosophila and mammalian cells: a functional comparison.

Authors:  Kuppusamy Balamurugan; Dieter Egli; Anand Selvaraj; Bo Zhang; Oleg Georgiev; Walter Schaffner
Journal:  Biol Chem       Date:  2004-07       Impact factor: 3.915

8.  Evolutionary changes in cis and trans gene regulation.

Authors:  Patricia J Wittkopp; Belinda K Haerum; Andrew G Clark
Journal:  Nature       Date:  2004-07-01       Impact factor: 49.962

9.  Knockout of 'metal-responsive transcription factor' MTF-1 in Drosophila by homologous recombination reveals its central role in heavy metal homeostasis.

Authors:  Dieter Egli; Anand Selvaraj; Hasmik Yepiskoposyan; Bo Zhang; Ernst Hafen; Oleg Georgiev; Walter Schaffner
Journal:  EMBO J       Date:  2003-01-02       Impact factor: 11.598

10.  Oxidative and osmotic stress signaling in tumor cells is mediated by ADAM proteases and heparin-binding epidermal growth factor.

Authors:  Oliver M Fischer; Stefan Hart; Andreas Gschwind; Norbert Prenzel; Axel Ullrich
Journal:  Mol Cell Biol       Date:  2004-06       Impact factor: 4.272

View more
  3 in total

Review 1.  Copper and Zinc Homeostasis: Lessons from Drosophila melanogaster.

Authors:  Juan A Navarro; Stephan Schneuwly
Journal:  Front Genet       Date:  2017-12-21       Impact factor: 4.599

2.  Stress response, behavior, and development are shaped by transposable element-induced mutations in Drosophila.

Authors:  Gabriel E Rech; María Bogaerts-Márquez; Maite G Barrón; Miriam Merenciano; José Luis Villanueva-Cañas; Vivien Horváth; Anna-Sophie Fiston-Lavier; Isabelle Luyten; Sandeep Venkataram; Hadi Quesneville; Dmitri A Petrov; Josefa González
Journal:  PLoS Genet       Date:  2019-02-12       Impact factor: 5.917

3.  Transposable elements contribute to the genomic response to insecticides in Drosophila melanogaster.

Authors:  Judit Salces-Ortiz; Carlos Vargas-Chavez; Lain Guio; Gabriel E Rech; Josefa González
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2020-02-10       Impact factor: 6.237

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.