Literature DB >> 28194411

Antibiotic Resistance of Campylobacter Recovered from Faeces and Carcasses of Healthy Livestock.

Akosua B Karikari1, Kwasi Obiri-Danso2, Enoch H Frimpong3, Karen A Krogfelt4.   

Abstract

Campylobacter is of major significance in food safety and human and veterinary medicine. This study highlighted resistance situation in the area of veterinary public health in Ghana. Using selective mCCDA agar, isolates were confirmed phenotypically on API CAMPY and genotypically by multiplex PCR of IpxA gene. The susceptibility profile of species to common and relevant antibiotics was determined by the Kirby-Bauer disk diffusion method. Cattle, sheep, goat, and pig faecal samples analysed, respectively, yielded 13.2% (16/121), 18.6% (22/102), 18.5% (25/135), and 28.7% (29/101) Campylobacter species while 34.5% (38/110), 35.9% (42/117), 23.9% (32/134), and 36.3% (37/102) were, respectively, recovered from the carcasses. Species identified in faeces were C. jejuni 35.8% (33/92), C. jejuni subsp. doylei 4.3% (4/92), C. coli 47.8% (44/92), and C. lari 12.0% (11/92). Species discovered in carcasses were C. jejuni 83.9% (125/149), C. jejuni subsp. doylei 2.0% (3/149), C. coli 6.0% (9/149), and C. lari 8.1% (12/149). Resistance ranged from 92 to 97% to the β-lactams, 7 to 69% to the quinolones, 0 to 44% to the aminoglycosides, 97 to 100% to erythromycin, 48 to 94% to tetracycline, 45 to 88% to chloramphenicol, and 42 to 86% to trimethoprim/sulfamethoxazole as 0% resistance was observed against imipenem.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28194411      PMCID: PMC5286542          DOI: 10.1155/2017/4091856

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Campylobacter is a key zoonotic pathogen which causes foodborne enteritis with C. jejuni and C. coli being the most isolated species [1]. Campylobacter infections in humans are mainly associated with consumption of undercooked chicken as exposure to farm animals, consumption of pork, improperly cooked beef, raw milk, and untreated water are other transmission routes. The significant contribution of ruminants as important reservoirs of Campylobacter has been established through molecular epidemiological research [2]. Due to growing demand for meat and products of livestock, the possibility of disease transmission from these food animals' sources cannot be dismissed. Increasing antibiotic resistance in Campylobacter from animal sources is well reported globally [3-6]. Resistance has developed to nearly all antibiotics used in veterinary medicine [7]. Livestock production in Ghana currently is changing from free range to commercial productions with increased use of antimicrobials as growth promoters and therapeutic agents. Such practice could increase levels of resistant bacteria in the gut-intestinal flora of animals, such as Campylobacter, and subsequently increase resistance in foods due to faecal contamination during slaughter. In Ghana, regional reports of heightening drug resistance among several pathogens from human sources have been documented [8]; however research on resistance of bacteria from animal sources is very sketchy. The purpose of this study was to highlight resistance trends in the area of veterinary public health. Therefore isolation rate and level of antimicrobial resistance among Campylobacter species from faeces and carcasses of livestock were reported.

2. Materials and Method

2.1. Study Site

The study was conducted at the Kumasi Abattoir. Kumasi is the capital of Ashanti region and the second most populous Metropolis in Ghana. The abattoir supplies Ghanaian markets with slaughtered, processed, and packaged goats, cattle, pigs, and sheep. The daily slaughtering capacity is about 200 cattle, 100 pigs, and 250 sheep and goats. Animals intended for slaughter at the abattoir are transported from different regions within Ghana especially from Yeji in Brong Ahafo and the Northern regions and also from neighbouring countries like Burkina Faso, Mali, and Niger.

2.2. Sample Collection

Fresh faecal samples were collected from individual animals (cattle, pigs, goats, and sheep) from unrelated herds at the Kumasi Abattoir slaughterhouse complex. A single animal was selected at random and about 5 g of faeces was aseptically removed from the bowel after evisceration at the slaughtering line. Samples were collected into sterile ziplock bags, kept on ice and returned to the laboratory for processing. Carcasses of cows, sheep, goats, and pigs being packaged at the abattoir for the markets were randomly swabbed using sterile swab sticks and inoculated into sterile Amies Transport Medium (Copan ESwab sticks, Italy) and transferred to the laboratory on ice. Sampling took place from March 2013 to February 2014.

2.3. Processing, Isolation, and Identification

About 0.2 g of faecal material was plated directly onto mCCDA agar plates (Oxoid CM0698) using sterile swab stick and incubated at 42°C for 48 hrs. Carcass swabs together with the transport media were aseptically transferred into sterile bijou bottles and preenriched with 5 mL of blood-free Campylobacter broth (Oxoid CM0963) supplemented with CCDA selective supplement (Oxoid, SRO 155E) and incubated overnight at 37°C. The overnight enrichment culture was cultured onto mCCDA agar plate and incubated at 42°C for 48 hrs. CampyGen (Oxoid CN0025A) was introduced to provide microaerophilic condition. Colonies showing typical morphology of Campylobacter spp. were subcultured onto Nutrient agar, followed by biochemical tests including Gram stain, oxidase, and catalase. Isolates which were small, curved, catalase, and oxidase positive; Gram negative bacilli were presumed to be Campylobacter spp. The presumed isolates were further subjected to standard phenotypic tests using API CAMPY system (bioMérieux, Marcy l'Etoile, France) to identify to species level.

2.4. Genotyping of Campylobacter Species by Multiplex PCR

2.4.1. DNA Extraction

Genomic DNA was isolated from cultures grown on 5% sheep blood agar (Accumix, AM5014, India) for 24 to 48 h at 37°C under microaerophilic conditions. Cell lysates were prepared by suspending a 10 μL loopful of growth in 100 μL of sterile distilled water in a microcentrifuge tube. The tubes were heated at 100°C for 10 min and subsequently cooled to 4°C. The tubes were centrifuged at 13,000 rpm (Sigma, Germany) for 5 min, and the supernatant was stored at −20°C for further analysis.

2.4.2. Genus-Specific PCR Amplification

The primers of the lpxA gene (DNA Technology, Denmark) were used in this study [9]. Forward primers complementary to the lpxA nucleotide sequence of C. coli (lpxA C. coli), C. jejuni (lpxA C. jejuni), C. lari (lpxA C. lari), and C. upsaliensis (lpxA C. upsaliensis) were used in combination with the reverse primer lpxARKK2m for confirmation of Campylobacter species by multiplex PCR with expected amplicon (fragment) sizes (Table 1). The reaction mixture consisted of 2 μL Taq buffer 10x, 0.7 μL Taq polymerase (Fermentas, UK), forward primer 50 pmol (0.5 μL), 50 pmol (0.5 μL) reverse primer, dNTPs 5 Mm, 0.4 μL, and nuclease free water 12.9 μL, 0.5 μL of each primer, and 1.5 μL of the genomic DNA template. The reaction tubes (20 μL) were placed in the thermal cycler (Thermo PCR, Sprint, USA). The cycle involved initial denaturing at 94°C for 5 min. The denatured DNA was maintained at 94°C for 1 min followed by annealing of primers to the DNA template at 50°C for 1 min; the annealed primers were extended at 72°C for 2 min. This cycle was repeated 30x and a final filling-in at 72°C was carried out for 10 min [9]. The PCR products were run on 1% agarose gel (Sigma, Germany) at 100 V for 45 minutes; the separated PCR products (bands) were visualized with UV imager (Syngene, USA). A 1 kb ladder was used as a molecular size standard. Campylobacter strains obtained from Statens Serum Institute (Denmark) were used as positive control and a negative control was included and examined.
Table 1

PCR primers of IpxA gene of Campylobacter species used in this study.

PrimersSequence (5′-3′)Size (bp)
IpxA C. coli (F)AGACAAATAAGAGAGAATCAG391
IpxA C. jejuni (F)ACAACTTGGTGACGATGTTGTA331
IpxA C. lari (F)TRCCAAATGTTAAAATAGGCGA233
IpxA C. upsaliensis (F)AAGTCGTATATTTTCYTACGCTTGTGTG206
IpxARKK2m (R)CAATCATGDGCDATATGASAATAHGCCAT

F = forward; R = reverse.

2.5. Antibiotic Susceptibility Test

Susceptibility tests were performed by the Kirby-Bauer disk diffusion method on Mueller-Hinton agar (Liofilchem, Italy) supplemented with 5% sheep blood following CLSI guidelines. Antibiotics tested and their corresponding concentrations were ampicillin (10 μg/disc), chloramphenicol (30 μg/disc), ciprofloxacin (5 μg/disc), kanamycin (30 μg/disc), erythromycin (15 μg/disc), gentamicin (10 μg/disc), nalidixic acid (30 μg/disc), tetracycline (30 μg/disc), cephalexin (30 μg/disc), trimethoprim/sulfamethoxazole (25 μg/disc), norfloxacin (10 μg/disc), cefotaxime (30 μg/disc), and imipenem (10 μg/disc). Mueller-Hinton agar plates were inoculated with 0.5 McFarland suspension and incubated under microaerophilic condition at 48°C for 24 hours. The inhibition zones were recorded and interpreted following EUCAST and CLSI breakpoints for Campylobacter. Breakpoints established by EUCAST and CLSI 2013 for Enterobacteriaceae were used to interpret the results of norfloxacin, trimethoprim/sulfamethoxazole, cefotaxime, and kanamycin as CLSI Campylobacter breakpoints for these antibiotics have not yet been established. Quality control was achieved by Escherichia coli (ATCC 25922) and Staphylococcus aureus (ATCC 25923) strains.

2.6. Statistical Analysis

Data were transferred to a Microsoft Excel spreadsheet for analysis. Descriptive analysis was carried out using percentages. Associations were determined using the Chi-square test at a significance level of < 0.05. All statistical tests were two-tailed. Stata 14.0 software was used for statistical analysis.

3. Results

3.1. Prevalence of Campylobacter in Food Animals

Of the cattle, sheep, goat, and pig faecal samples, 16 (13.2%), 22 (18.6%), 25 (18.5%), and 29 (28.7%) were, respectively, characterized as Campylobacter species. From the carcasses of the cattle, sheep, goats, and pigs, 34.5% (38/110), 35.9% (42/117), 23.9% (32/134), and 36.3% (37/102) isolates were positive for Campylobacter (Table 2). There was statistically significant difference in the isolation rate of Campylobacter from faecal and carcass samples of cattle (p < 0.001) and sheep (p = 0.003) but no significant difference in the isolation frequency between that of goats (p = 0.268) and pigs (p = 0.250) (Table 3).
Table 2

Isolation rate of Campylobacter from faeces and carcasses of animals.

Animal Total number of samplesNumber of Campylobacter spp.identified N (%)
Faeces
Cattle12116 (13.2)
Sheep11822 (18.6)
Goat13525 (18.5)
Pig10129 (28.7)

Carcass
Cattle11038 (34.5)
Sheep11742 (35.9)
Goat13432 (23.9)
Pig10237 (36.3)
Table 3

Association between isolation rate of faecal and carcass samples of animals.

Source Campylobacter occurrence p value
FaecesCarcass
n (%) n (%)
Cattle16 (13.2)38 (34.5)<0.001
Sheep22 (18.6)42 (35.9)0.003
Goat25 (18.5)32 (23.9)0.268
Pig29 (28.7)37 (36.3) 0.250

3.2. Distribution of Campylobacter Species in the Various Animals

Faecal content isolates of cattle, sheep, goat, and pigs were 25.0%, 27.2%, 36.0%, and 48.2% C. jejuni, 43.7%, 40.9%, 56.0%, and 48.2% C. coli, and 12.5%, 27.2%, 8.0%, and 3.4% C. lari, respectively. Campylobacter subsp. doylei were recovered from cattle (18.7%) and sheep (4.5%) and none in goats and pigs. The carcasses of cattle, sheep, goats, and pigs were 84.2%, 92.8%, 81.3%, and 75.6% C. jejuni and 2.6%, 2.3%, 18.7%, and 10.8% C. lari. Campylobacter coli were found in cattle (13.1%) and pigs (10.8%) but none in sheep and goats, while C. subsp. doylei were obtained from sheep (4.7%) and pigs (2.7%) but not in goat and cattle samples (Table 4).
Table 4

Distribution of Campylobacter species in the carcasses and faecal contents of animals.

SourceNumber of samples C. jejuni C. doylei C. coli C. lari
n (%) n (%) n (%) n (%)
Cattle faeces164 (25.0)3 (18.7)7 (43.7)2 (12.5)
Cattle carcass3832 (84.2)0 (0)5 (13.1)1 (2.6)
Sheep faeces226 (27.2)1 (4.5)9 (40.9)6 (27.2)
Sheep carcass4239 (92.8)2 (4.7)0 (0.0)1 (2.3)
Goat faeces259 (36.0)0 (0)14 (56.0)2 (8.0)
Goat carcass3226 (81.3)0 (0)0 (0)6 (18.7)
Pig faeces2914 (48.2)0 (0)14 (48.2)1 (3.4)
Pig carcass3728 (28.4)1 (2.7)4 (10.8)4 (10.8)

C. doylei = C. jejuni subsp. doylei.

3.3. Molecular Identification and Confirmation of Isolates

The PCR of the (lpxA) gene of Campylobacter confirmed 92 out of 96 faecal and carcass isolates from the various food animals. Multiplex PCR identified 52/92 (56.5%%) as Campylobacter jejuni, 33/92 (35.8%) as Campylobacter coli, and 7/92 (7.6%) as C. lari (Figures 1 and 2). Culture method and API reactions were 95.8% in agreement with the PCR results.
Figure 1

Multiplex PCR detection of Campylobacter lpxA gene on agarose gel electrophoresis. M = Molecular Marker 1 kb; Lane 2 = C. lari (233 bp); Lane 3 = C. jejuni (331 bp); Lane 4 = C. coli (391 bp); Lanes 1 and 5 = negative control.

Figure 2

Multiplex PCR detection of Campylobacter lpxA gene of isolates on agarose gel electrophoresis. M = Molecular Marker 1 kb; Lanes 1, 2, 3 5, 6, 15, 16, 17, and 18 = C. jejuni; Lanes 4, 10, 11, and 14 = C. coli; Lane 7 = C. lari.

3.4. Resistance Profile of Faecal Isolates of Animals

Cattle isolates' resistance to erythromycin, chloramphenicol, and trimethoprim/sulfamethoxazole was, respectively, 100%, 88%, 56%, and 81% each to ampicillin and tetracycline. Against the cephalosporins resistance was 75% to cefotaxime and 81% to cephalexin. Resistance to the quinolones was 50% to nalidixic acid, 44% to ciprofloxacin, and 19% to norfloxacin. Resistance to the aminoglycosides was 6% to kanamycin and 0% to gentamicin. Sheep isolates' resistance was 100% to erythromycin, 86% to trimethoprim/sulfamethoxazole, 91% each to ampicillin and tetracycline, and 55% to chloramphenicol. Against the cephalosporins resistance was 86% to cefotaxime and 91% to cephalexin. Resistance to the quinolones was 50% to ciprofloxacin and 36% each to nalidixic acid and norfloxacin. Against the aminoglycosides, resistance was 18% to kanamycin and 14% to gentamicin. Goat strains expressed resistance of 100% 88%, 76%, 64%, and 60%, respectively, to erythromycin, ampicillin, tetracycline, chloramphenicol, and trimethoprim/sulfamethoxazole. Against the cephalosporins resistance was 72% to cephalexin and 68% to cefotaxime. Resistance to the quinolones was 28% to ciprofloxacin, 12% to norfloxacin, and 8% to nalidixic acid. Against the aminoglycosides, resistance was 8% to kanamycin and 0% to gentamicin. Pig isolates showed resistance of 100%, 86%, 83%, 48, and 45%, respectively, to erythromycin, tetracycline, ampicillin, trimethoprim/sulfamethoxazole, and chloramphenicol. Against the cephalosporins resistance was 86% to cephalexin and 62% to cefotaxime. Resistance to the quinolones was 24% to ciprofloxacin, 17% to norfloxacin, and 10% to nalidixic acid. Resistance to the aminoglycosides was 10% each to kanamycin and gentamicin (Table 5). No resistance (0%) was recorded against imipenem; however intermediate susceptibility was observed among strains from all the animals.
Table 5

Susceptibility patterns of faecal isolates of animals.

AntibioticAnimal
Cattle (N = 16) Sheep (N = 22) Goat (N = 25) Pig (N = 29)
SIRSIRSIRSIR
Nalidixic acid50NA5064NA3692NA890NA10
Tetracycline1368190911212767786
Erythromycin0NA1000NA1000NA1000NA100
Ciprofloxacin371944143650482428413524
Chloramphenicol668844155122464144145
Ampicillin019814591848831483
Cefotaxime25075958628468142462
Kanamycin5044627551868248385210
Gentamicin623806818148020086410
Norfloxacin5031195953676121276717
Trimethoprim/sulfamethoxazole44056140864006052048
Cephalexin19NA819NA9128NA7214NA86
Imipenem6931068320928072280

S = sensitive; I = intermediate; R = resistant; NA = intermediate not available, values presented in percentages.

3.5. Resistance Profile of Carcass Isolates of Animals

Cattle isolates showed resistance of 97% each against erythromycin and ampicillin, 87%, 58%, and 42%, respectively, to chloramphenicol, tetracycline, and trimethoprim/sulfamethoxazole. Against the cephalosporins resistance was 97% to cephalexin and 92% to cefotaxime. Resistance to the quinolones was 42% to ciprofloxacin, 21% to norfloxacin, and 13% to nalidixic acid. Against aminoglycosides, resistance was 19% to kanamycin and 18% to gentamicin. Sheep isolates showed resistance of 100%, 93%, 83%, 52%, and 48%, respectively, to erythromycin, ampicillin, chloramphenicol, trimethoprim/sulfamethoxazole, and tetracycline. Against the cephalosporins resistance was 100% to cefotaxime and 98% to cephalexin. Resistance to the quinolones was 42% to ciprofloxacin, 21% to norfloxacin, and 17% to nalidixic acid. Against the aminoglycosides, resistance was 14% to kanamycin and 12% to gentamicin. Goat isolates showed resistance of 100%, 97%, 94%, 84%, and 75%, respectively, to erythromycin ampicillin, tetracycline, chloramphenicol, and trimethoprim/sulfamethoxazole. Against the cephalosporins, resistance was 100% to cephalexin and 91% to cefotaxime. Resistance to the quinolones was 69% to nalidixic acid, 62% to ciprofloxacin, and 47% to norfloxacin. Resistance to the aminoglycosides was 44% to kanamycin and 34% to gentamicin. Pig isolates showed 100%, 97%, 86%, 60%, and 54% resistance, respectively, to erythromycin, ampicillin, chloramphenicol, tetracycline, and trimethoprim/sulfamethoxazole. Against the cephalosporins resistance was 100% to cephalexin and 97% to cefotaxime. Resistance to the quinolones was 51% to nalidixic acid, 35% to ciprofloxacin, and 22% to norfloxacin. Resistance to the aminoglycosides was 0% to kanamycin and 30% to gentamicin. No resistance (0%) was recorded against imipenem; however intermediate susceptibility was observed among strains from all the animals (Table 6).
Table 6

Susceptibility pattern of carcass isolates of animals.

AntibioticAnimal
Cattle (N = 38) Sheep (N = 42) Goat (N = 32) Pig (N = 37)
SIRSIRSIRSIR
Nalidixic acid87NA1383NA1731NA6949NA51
Tetracycline2418584012486094241660
Erythromycin30970NA1000NA1000NA100
Ciprofloxacin342442383824191962491635
Chloramphenicol5887314836108431186
Ampicillin0397529303973097
Cefotaxime80920010090910397
Kanamycin68131957291419374457430
Gentamicin79318880126063462830
Norfloxacin68112183107371647651322
Trimethoprim/sulfamethoxazole53542480522507546054
Cephalexin3NA972NA980NA1000NA100
Imipenem76240811908416076240

S = sensitive; I = intermediate; R = resistant; NA = intermediate not available, values presented in percentages.

3.6. Species-Specific Resistance Profile of Animals

Resistance of C. jejuni strains to the quinolones was 23% to nalidixic acid, 25.5% to norfloxacin, and 40.2% to ciprofloxacin. Against the cephalosporins, resistance was 92.6% and 99.5% to cefotaxime and cephalexin, respectively. Resistance to aminoglycosides was 17.1% to kanamycin and 21.1% to gentamicin. Resistance to erythromycin, ampicillin, chloramphenicol, tetracycline, and trimethoprim/sulfamethoxazole, respectively, was 99.5%, 96.5%, 87.7%, 69.8%, and 58.8%. Resistance among C. coli strains to the quinolones was 2.9% each to nalidixic acid and norfloxacin and 37.7% to ciprofloxacin. Resistance to the cephalosporins was 66.7% to cefotaxime and 72.5% to cephalexin. Against the aminoglycosides, resistance was 1.4% to gentamicin and 8.7% to kanamycin. Resistance to erythromycin, tetracycline, ampicillin, trimethoprim/sulfamethoxazole, and chloramphenicol, respectively, was 100%, 89.8%, 84%, 71%, and 43.5%. Resistance of C. lari to the quinolones was 100% to nalidixic acid, 93.3% to ciprofloxacin, and 83.3% to norfloxacin. Against the cephalosporins, resistance was 93.3% to the cefotaxime and 100% to the cephalexin. Resistance to aminoglycosides was 26.7% to gentamicin and 36.7% to kanamycin. Resistance to erythromycin was 100%, to ampicillin and tetracycline 96.7% each, to trimethoprim/sulfamethoxazole 90%, and to chloramphenicol 66.7% (Table 7).
Table 7

Species-specific resistance profile of strains from food animals.

C. jejuni = 204 C. coli = 69 C. lari = 30
Antibiotic% resistance% resistance% resistance
Nalidixic acid232.9100
Cefotaxime92.666.793.3
Erythromycin99.5100100
Tetracycline69.889.896.7
Kanamycin17.18.736.7
Gentamicin21.11.426.7
Ampicillin96.58496.7
Imipenem000
Cephalexin99.572.5100
Ciprofloxacin40.237.793.3
Chloramphenicol87.743.566.7
Norfloxacin25.52.983.3
SXT58.87190

3.7. Multidrug Resistance (MDR) in Campylobacter Species from Animals

Resistance to three (3) or more antibiotics was defined as multidrug resistance (MDR) in this study. Strains of C. jejuni, C. coli, and C. lari, respectively, showed multidrug resistance of 66.6% (156/234), 20.5% (48/234), and 12.8% (30/234). Multidrug resistance in C. jejuni strains from the animal carcasses was consistently higher than faecal strains across studied animals. Contrastingly, higher MDR was observed in C. coli strains obtained from faecal sources of the animals. With the exception of sheep, the differences in MDR of faecal and carcass strains from pigs (p = 0.000), goats (p = 0.003), and cattle (p = 0.012) were statistically significant.

4. Discussion

The fastidious nature of Campylobacter coupled with its susceptibility to environmental stresses such as heat, drying, and exposure to air often results in damaged cells which hamper their recovery to a greater extent than most bacteria. Again, a viable but nonculturable (VBNC) state exhibited by Campylobacter can result in underestimation or nondetection of the organism by culture-based techniques, yet cells in this state can still infect susceptible hosts [10]. Notwithstanding, Campylobacter have been isolated from animals in different countries at varying rates. Documented range of 5–49% has been reported in sheep and goats [11, 12], 0–80% in cattle, and 50–100% in pigs [13, 14]. In our study, Campylobacter prevalence ranged from 13.2 to 28.7% in faecal samples and from 23.9 to 36.3% in the carcasses and again Campylobacter recoveries from carcasses were more than from faeces. This could be due to contamination of carcasses with intestinal contents during manual skinning, evisceration, carcass washing, and processing at the abattoir. Similarly, A Mpalang et al. [15] recorded 50% Campylobacter prevalence in carcasses compared to 20% in faecal samples. The 13.2% recovery rate from cattle faeces in this study compares to the 12.7% in Ethiopia but is lower than studies in USA (26.7%–29.1%), Finland (31.1%), and Canada (76–95%) [16-19]. Campylobacter contamination in cattle carcasses are generally low; however, Noormohamed and Fakhr [20] reported 78% from beef livers which is higher than the 35.2% obtained in this study. Lower isolation rates have also been reported in different countries [18, 21]. The 18.6% Campylobacter prevalence in sheep faeces is lower than the 23% and 38.0% rates reported in studies in Ghana and Ethiopia, respectively [17, 22], but higher than the 4.5% reported in USA [23]. In sheep carcasses, rates of 11.0% have been reported in Ethiopia which is lower than the 35.9% obtained in this study although a higher rate of 72.2% has been described in Greece [24, 25]. The 18.5% Campylobacter recovery in goat faeces from this study was lower than the 33% and 20% reported by Abrahams et al. [22] and Salihu et al. [11] in studies in Ghana and Nigeria, but higher than the 3.2% reported in USA [15, 23]. Goat meat is not known to be a major source of campylobacteriosis; however, the high utilization of mutton in local Ghanaian dishes may contribute to the increased transmission source. In goat carcasses, Campylobacter contamination rates of 50% and 63.5% have been reported from Congo and Greece, with 9.4% in Ethiopia compared to the 23.9% in our study [15, 24, 25]. Campylobacter prevalence of 28.7% recovered from pig faeces was lower compared to 42.4%, 50%, and 71.4% in studies in Japan, Ethiopia, and Mexico [17, 26, 27]. Geographical distribution of Campylobacter contamination in pig carcasses is fairly low (2.0–25.3%) [20, 27] which is still lower than the 36.3% in this study. Campylobacter contamination in pig carcasses has been documented in various studies [28]. It must be noted that there were no significant differences in contamination rates of the various food animal carcasses which may be as a result of the levels of colonization of slaughter animals, abattoir hygiene, slaughter, and dressing methods [29]. Campylobacter jejuni and C. coli were the most commonly identified species although C. coli were more in faecal samples and C. jejuni were more in carcasses. Similar findings were made by A Mpalang et al. [15] who also recovered more C. coli (26.1%) than C. jejuni (10.1%) from faecal isolates of goats in Ethiopia; 25.9% C. coli and 3.4% C. jejuni in nondiarrhoeic goat faeces have been documented in South Africa [30]. These findings suggest that C. coli are more common in Africa [31]. Campylobacter jejuni dominance in carcasses (83.9%) is comparable to work by Wieczorek et al. [4] and Noormohamed and Fakhr [20]. However, a number of studies have rather shown higher C. jejuni in faecal samples of animals [17, 23, 26]. Although C. coli is the most commonly identified species in pigs [32, 33]; an interesting pattern was discovered in our study where C. jejuni and C. coli isolations were similar (48.2% each) in pig faeces and a rather higher C. jejuni (75.6%) than C. coli (10.8%) in the carcasses. Matthew-Belmar et al. [34] and Kramer et al. [35] recorded more C. jejuni (53.5%) than C. coli (46.5%) from pigs in Grenada and UK, respectively. However, higher C. coli than C. jejuni have been recorded in Nigeria [36], in Ethiopia [17], and in Poland [21]. Other studies do show that C. jejuni may coexist with C. coli in pigs but usually the C. jejuni are always present in 10–100-fold lower numbers than C. coli [37]. In Ghana, most of the farms rear multiple animals and it could be that the pigs may have acquired the C. jejuni from poultry on the same farm [23, 38]. Conventional culture methods and API biochemical reactions of isolates from food animals were 95.8% in agreement with the results of PCR for identification and differentiation of Campylobacter species which is comparable with data from other studies [9, 39]. The bacteriological methods (culture and API) are as reliable as the molecular PCR (IpxA gene) method in detecting Campylobacters from animals. The limitation in detecting antibiotic resistance in this study was as it is in all studies dependent on culture that the resistance rates were determined according to the bacteria species that were culturable at the time of analysis. Direct PCR on the specimens might be more sensitive but not detecting the actual species where the antibiotic resistance genes are present in. High levels of resistance were expressed against most of the antibiotics. Faecal and carcass strains showed resistance range of 97–100% to erythromycin which is consistent with work in Nigeria and Spain, where resistance of 81–82.6% to erythromycin has been described [3, 5], but lower rates have been reported in Ethiopia (60.3%) and USA (55%) [6, 20]. Similarly, Ampicillin resistance ranged from 93% to 100% which agrees with studies in India [40] and in Ethiopia, Spain, and USA [3, 6, 20]. Resistance to the cephalosporins ranged from 62 to 97% to cefotaxime and 72 to 100% to cephalexin which is consistent with reports from Ghana (95.8%) and other countries where rates of 95.8–100% have been established [6, 20, 22, 40]. Resistance range of 6–69% was observed in our study against the quinolones which is lower than rates described in USA (100%), Ethiopia (80.5%), Poland (86.8%–88.1%), and Thailand (91–100%) [4, 6, 20, 41] and for the aminoglycosides a range of 0–44% was recorded which is comparable to rates from Poland, Grenada, and Spain [3, 4, 34] but lower than established rates in Nigeria and Ethiopia [5, 6]. Resistance to tetracycline was between 58 and 94% which is consistent with documented rates in Poland, USA, Ethiopia, and Thailand [4, 6, 20, 41] as resistance to chloramphenicol was in the range of 45–88% higher than rates of 61.5% and 67.4% reported against chloramphenicol in Ethiopia and Nigeria, respectively [5, 6]. No resistance was observed against imipenem although intermediate susceptibility was found in both faecal and carcass isolates. Generally, resistant strains were commonly found in cattle and sheep compared to goats and pigs and resistance was also higher in the carcasses than in the faecal isolates. The extensive application of antibiotics in animal husbandry for therapy, prophylaxis, and growth promotion has often been associated with the spread of resistance. Another factor contributing to the increase and spread of resistance is intensive rearing which promotes clinical infections in animals leading to widespread prophylactic usage of drugs which may be unwarranted. Currently in Ghana livestock production is changing from free range to commercial productions and may have added to the high level resistance currently documented. Antibiotic use in animal feed as growth promotants also plays a significant role in the spread of resistance. Worldwide, antibiotics are widely used in livestock and poultry for growth promotion to enhance feed utilization and production [14]. In Ghana, 98% of livestock farmers use antibiotics on their farms as growth promoters and in the management of diseases. The antibiotics used are mainly tetracyclines (oxytetracycline, doxycycline, remacycline, and chlortetracycline), sulphadimidine, dihydrostreptomycin, piperazine, albendazole, tylosin, ivermectin, and benzylpenicillin which can lead to possible cross- and co-resistance [42, 43]. In a study in Kumasi, the knowledge of livestock farmers on antibiotics, withdrawal periods, and dosages was very low and farmers usually depended more on fellow farmers than veterinarians for antibiotic knowledge. Poor dosing practices especially when an antibiotic failed to resolve an infection were a common practice. In such cases, different antibiotics were tried and abused until the disease was treated [43]. Also the challenge of distinguishing different antibiotic brands of the same active ingredient resulted in the application of different antibiotic brands of the same active ingredient which saw no improvement in the disease condition [43]. In the Northern Region of Ghana, Addah et al. [44] reported of nonadherence to dosing and withdrawal periods among several livestock farmers. These practices ultimately increase antibiotic residues in faecal content and carcasses of these animals which is evident in the high level resistance established in this study.

5. Conclusion

The study has revealed multidrug resistant Campylobacter species in the faecal content and carcasses of healthy livestock animals in Ghana indicating possible risks of infection to people through consumption of contaminated animal products or by direct contact with animals. Moreover high levels of resistance observed among the Campylobacter species to the common and cheap antibiotics raise uncertainties about their effectiveness in the treatment of animal and human diseases in the study region. It is urgent that extensive education and training are given to livestock farmers on judicious application of antibiotics and a national antibiotic resistance management team setup to monitor and control antibiotic use in both human and veterinary medicine.
  31 in total

1.  Antibiotic resistance in Campylobacter strains isolated from animals, foods, and humans in Spain in 1997-1998.

Authors:  Y Sáenz; M Zarazaga; M Lantero; M J Gastanares; F Baquero; C Torres
Journal:  Antimicrob Agents Chemother       Date:  2000-02       Impact factor: 5.191

Review 2.  Overview of issues pertaining to the manufacture, distribution, and use of antimicrobials in animals and other information relevant to animal antimicrobial use data collection in the United States.

Authors:  Christina Viola; Stephen J DeVincent
Journal:  Prev Vet Med       Date:  2005-11-17       Impact factor: 2.670

3.  Prevalence and antibiogram of Campylobacter jejuni in domestic animals in rural Ghana.

Authors:  C A Abrahams; D Agbodaze; T Nakano; E A Afari; H E Longmatey
Journal:  Arch Environ Health       Date:  1990 Jan-Feb

4.  Epidemiological aspects of non-human antibiotic usage and resistance: implications for the control of antibiotic resistance in Ghana.

Authors:  Eric S Donkor; Mercy J Newman; Dorothy Yeboah-Manu
Journal:  Trop Med Int Health       Date:  2012-03-13       Impact factor: 2.622

5.  A real-time multiplexed PCR assay for rapid detection and differentiation of Campylobacter jejuni and Campylobacter coli.

Authors:  Michael J LaGier; Lavin A Joseph; Teresa V Passaretti; Kimberlee A Musser; Nick M Cirino
Journal:  Mol Cell Probes       Date:  2004-08       Impact factor: 2.365

Review 6.  Human and animal Campylobacteriosis in Tanzania: A review.

Authors:  Erick V G Komba; Robinson H Mdegela; Peter L M Msoffe; Hanne Ingmer
Journal:  Tanzan J Health Res       Date:  2013-01

7.  Experimental infection of specific pathogen-free pigs with Campylobacter: excretion in faeces and transmission to non-inoculated pigs.

Authors:  Mily Leblanc Maridor; Martine Denis; Françoise Lalande; Bernard Beaurepaire; Roland Cariolet; Philippe Fravalo; Michel Federighi; Henri Seegers; Catherine Belloc
Journal:  Vet Microbiol       Date:  2008-06-09       Impact factor: 3.293

8.  Prevalence of Campylobacter among goats and retail goat meat in Congo.

Authors:  Rosette Kabwang a Mpalang; Raphaël Boreux; Pierrette Melin; Khang'Mate Akir Ni Bitiang; Georges Daube; Patrick De Mol
Journal:  J Infect Dev Ctries       Date:  2014-02-13       Impact factor: 0.968

9.  Genomics-based molecular epidemiology of Campylobacter jejuni isolates from feedlot cattle and from people in Alberta, Canada.

Authors:  Sherry J Hannon; Eduardo N Taboada; Margaret L Russell; Brenda Allan; Cheryl Waldner; Heather L Wilson; Andrew Potter; Lorne Babiuk; Hugh G G Townsend
Journal:  J Clin Microbiol       Date:  2008-11-26       Impact factor: 5.948

10.  Foodborne illness acquired in the United States--major pathogens.

Authors:  Elaine Scallan; Robert M Hoekstra; Frederick J Angulo; Robert V Tauxe; Marc-Alain Widdowson; Sharon L Roy; Jeffery L Jones; Patricia M Griffin
Journal:  Emerg Infect Dis       Date:  2011-01       Impact factor: 6.883

View more
  14 in total

Review 1.  Campylobacter and Arcobacter species in food-producing animals: prevalence at primary production and during slaughter.

Authors:  Nompumelelo Shange; Pieter Gouws; Louwrens C Hoffman
Journal:  World J Microbiol Biotechnol       Date:  2019-09-06       Impact factor: 3.312

2.  The Host Antimicrobial Protein Calgranulin C Participates in the Control of Campylobacter jejuni Growth via Zinc Sequestration.

Authors:  Janette M Shank; Brittni R Kelley; Joseph W Jackson; Jessica L Tweedie; Dana Franklin; Steven M Damo; Jennifer A Gaddy; Caitlin N Murphy; Jeremiah G Johnson
Journal:  Infect Immun       Date:  2018-05-22       Impact factor: 3.441

3.  Prevalence and Antibiotic Resistance against Tetracycline in Campylobacter jejuni and C. coli in Cattle and Beef Meat from Selangor, Malaysia.

Authors:  Jayasekara M K J K Premarathne; Aimi S Anuar; Tze Young Thung; Dilan A Satharasinghe; Nuzul Noorahya Jambari; Noor-Azira Abdul-Mutalib; John Tang Yew Huat; Dayang F Basri; Yaya Rukayadi; Yoshitsugu Nakaguchi; Mitsuaki Nishibuchi; Son Radu
Journal:  Front Microbiol       Date:  2017-12-04       Impact factor: 5.640

4.  Trends in fluoroquinolone resistance in Campylobacter.

Authors:  Emma L Sproston; Helen M L Wimalarathna; Samuel K Sheppard
Journal:  Microb Genom       Date:  2018-07-19

5.  Virulence typing and antibiotic susceptibility profiling of thermophilic Campylobacters isolated from poultry, animal, and human species.

Authors:  Neelam Rawat; Deepak Kumar; A K Upadhyay
Journal:  Vet World       Date:  2018-12-19

Review 6.  A Systematic Review of In Vitro Activity of Medicinal Plants from Sub-Saharan Africa against Campylobacter spp.

Authors:  Delfina Fernandes Hlashwayo; Filomena Barbosa; Sílvia Langa; Betuel Sigaúque; Custódio Gabriel Bila
Journal:  Evid Based Complement Alternat Med       Date:  2020-05-15       Impact factor: 2.629

Review 7.  Prevalence, Risk Factors, and Antimicrobial Resistance Profiles of Thermophilic Campylobacter Species in Humans and Animals in Sub-Saharan Africa: A Systematic Review.

Authors:  Noel Gahamanyi; Leonard E G Mboera; Mecky I Matee; Dieudonné Mutangana; Erick V G Komba
Journal:  Int J Microbiol       Date:  2020-01-14

8.  Gut microbiota signature of pathogen-dependent dysbiosis in viral gastroenteritis.

Authors:  Taketoshi Mizutani; Samuel Yaw Aboagye; Aya Ishizaka; Theophillus Afum; Gloria Ivy Mensah; Adwoa Asante-Poku; Diana Asema Asandem; Prince Kofi Parbie; Christopher Zaab-Yen Abana; Dennis Kushitor; Evelyn Yayra Bonney; Motoi Adachi; Hiroki Hori; Koichi Ishikawa; Tetsuro Matano; Kiyosu Taniguchi; David Opare; Doris Arhin; Franklin Asiedu-Bekoe; William Kwabena Ampofo; Dorothy Yeboah-Manu; Kwadwo Ansah Koram; Abraham Kwabena Anang; Hiroshi Kiyono
Journal:  Sci Rep       Date:  2021-07-06       Impact factor: 4.379

Review 9.  Epidemiology and antimicrobial resistance of Campylobacter spp. in animals in Sub-Saharan Africa: A systematic review.

Authors:  Delfina Fernandes Hlashwayo; Betuel Sigaúque; Custódio Gabriel Bila
Journal:  Heliyon       Date:  2020-03-09

10.  Characterization of antibiotic resistance genes in the species of the rumen microbiota.

Authors:  Yasmin Neves Vieira Sabino; Mateus Ferreira Santana; Linda Boniface Oyama; Fernanda Godoy Santos; Ana Júlia Silva Moreira; Sharon Ann Huws; Hilário Cuquetto Mantovani
Journal:  Nat Commun       Date:  2019-11-20       Impact factor: 14.919

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.