Literature DB >> 28193157

Whole-genome association analysis of pork meat pH revealed three significant regions and several potential genes in Finnish Yorkshire pigs.

Lucas L Verardo1, Marja-Liisa Sevón-Aimonen2, Timo Serenius3, Ville Hietakangas4,5, Pekka Uimari6.   

Abstract

BACKGROUND: One of the most commonly used quality measurements of pork is pH measured 24 h after slaughter. The most probable mode of inheritance for this trait is oligogenic with several known major genes, such as PRKAG3. In this study, we used whole-genome SNP genotypes of over 700 AI boars; after a quality check, 42,385 SNPs remained for association analysis. All the boars were purebred Finnish Yorkshire. To account for relatedness of the animals, a pedigree-based relationship matrix was used in a mixed linear model to test the effect of SNPs on pH measured from loin. A bioinformatics analysis was performed to identify the most promising genes in the significant regions related to meat quality.
RESULTS: Genome-wide association study (GWAS) revealed three significant chromosomal regions: one on chromosome 3 (39.9 Mb-40.1 Mb) and two on chromosome 15 (58.5 Mb-60.5 Mb and 132 Mb-135 Mb including PRKAG3). A conditional analysis with a significant SNP in the PRKAG3 region, MARC0083357, as a covariate in the model retained the significant SNPs on chromosome 3. Even though linkage disequilibrium was relatively high over a long distance between MARC0083357 and other significant SNPs on chromosome 15, some SNPs retained their significance in the conditional analysis, even in the vicinity of PRKAG3. The significant regions harbored several genes, including two genes involved in cyclic AMP (cAMP) signaling: ADCY9 and CREBBP. Based on functional and transcription factor-gene networks, the most promising candidate genes for meat pH are ADCY9, CREBBP, TRAP1, NRG1, PRKAG3, VIL1, TNS1, and IGFBP5, and the key transcription factors related to these genes are HNF4A, PPARG, and Nkx2-5.
CONCLUSIONS: Based on SNP association, pathway, and transcription factor analysis, we were able to identify several genes with potential to control muscle cell homeostasis and meat quality. The associated SNPs can be used in selection for better pork. We also showed that post-GWAS analysis reveals important information about the genes' potential role on meat quality. The gained information can be used in later functional studies.

Entities:  

Keywords:  Association analysis; Meat quality; Pig; Post-GWAS analysis

Mesh:

Year:  2017        PMID: 28193157      PMCID: PMC5307873          DOI: 10.1186/s12863-017-0482-x

Source DB:  PubMed          Journal:  BMC Genet        ISSN: 1471-2156            Impact factor:   2.797


Background

The most common quality measurements of pork are pH and color. Both depend on post-mortem biochemical processes where lactate is produced from glycogen through glycogenolysis and anaerobic glycolysis, consequently lowering the pH and affecting the color of meat. The degree of glycolysis depends on the glycolytic potential, i.e. the amount of lactate that can be produced from glycogen in muscle at the time of slaughter [1]. Differences in glycolytic potential are known to be partly genetic. A well-known gene affecting meat quality is PRKAG3 (protein kinase, AMP-activated, gamma 3 non-catalytic subunit) [2], formerly known as the RN gene [3, 4]. An R200Q substitution in this gene is related to the upregulation of certain key enzymes (e.g. UDP-glucose pyrophosphorylase) that increase glycogen production in the muscle cells of 200Q animals [5]. Additionally, several other genes are associated with post-mortem pH and color of pork loin and ham, including RYR1 [6], CAST [7], and PHKG1 [8] among others. Genome-wide association study (GWAS), based on abundant SNP markers, is an effective tool to find chromosomal regions that explain at least a moderate proportion of the genetic variance of the studied trait in a certain population. Since the launch of the commercial SNP chip for pigs (Illumina PorcineSNP60 Genotyping Beadchip), several GWAS for pork meat quality traits have been published [9-15]. These studies have detected significant associations between SNPs and pH on the following chromosomes: chromosome 14 [9]; 2, 3, 4, 13, and X [10]; 1, 2, 3, 7, 9, and 13 [11]; 2 and 15 [12]; 1 and 8 [13]; and 15 [14, 15]. The effective population size (Ne) of commercial pork breeds is relatively small; e.g. in Finnish Yorkshire, the pedigree- and marker-based estimate of Ne is only 60 animals [16]. This leads to strong linkage disequilibrium (LD) over long distances, and ultimately to a large number of genes surrounding the most significant SNP depending, of course, on how rich in genes the region is. Post-GWAS analysis, such as pathway and gene-transcription factor (TF) network analysis facilitate the identification and in silico validation of the most probable group of candidate genes in these regions and increases our understanding of the molecular mechanisms of the studied trait [17, 18]. In this article, we present the results from GWAS of loin pH measured 24 h post mortem using the estimated breeding values of Finnish Yorkshire boars. We also conducted a post-GWAS bioinformatics analysis of the significant genomic regions and genes.

Methods

Animals and phenotypes

The animals used in this study were AI boars of Finnish Yorkshire origin. The studied trait, pH of loin, was measured at the slaughterhouse 24 h post mortem using a Knick 752 pH meter and an Ingold 460 electrode (see Sevón-Aimonen et al. [19] for more information). The slaughtered pigs were grown in a test station. The animals arrived at the test station at 30 kg live weight and were sent for slaughter after 13 weeks of testing, at approximately 100 kg live weight. Prior to 2006, all pigs had restricted feeding based on their body weight; after 2006, feeding was close to ad libitum. The average pH for Finnish Yorkshire was 5.53 (SD = 0.15), based on 45,639 loin pH observations. Estimated breeding values (EBVs) for the AI boars were calculated by Figen Oy (Seinäjoki, Finland) using a single-trait animal model and the Mix99 program package (MiX99, http://www.luke.fi/mix99. EBVs were mainly based on phenotypic measurements of half-sibs, full-sibs, and progeny. No phenotypic measurements of loin pH of the AI boars themselves were available. The statistical model included gender, slaughter batch, and time from slaughter to pH measurement as fixed effects, and litter and animal as random effects. Approximate reliabilities were calculated using ApaX, which is part of the MiX99 program package. All animals were related including, e.g., sire-son and half-sib pairs. Prior to association analysis, raw EBVs were deregressed and their weights calculated based on the method presented by Garrick et al. [20]. Deregressed EBVs (dEBVs) with weight less than 1.0 were removed from the data. The average reliability of the original EBVs was 0.56. The average dEBV was 0.09 and the SD 0.07, and the mean weight of the dEBVs was 3.6.

Genotypes

DNA was extracted from the boars either from hair follicles (boars born before 2008) or semen (boars born after 2008). Whole-genome SNP genotyping was done at FIMM (Institute for Molecular Medicine Finland, Helsinki) or at GeneSeek (Lincoln, NE, USA) using the Illumina PorcineSNP60 BeadChip (Illumina Inc., San Diego, CA, USA). Only animals with call rate (CR) >0.9 were included into the statistical analysis, 703 animals in total. Additionally, SNPs with CR <0.9, minor allele frequency (MAF) <0.1, and P-value of Hardy-Weinberg test statistics <0.00001 were removed from the data prior to the statistical analysis. The final data included 42,385 SNPs. The map positions of the SNPs were based on the genome build Sscrofa10.2.

Association analysis

Associations between loin pH and SNPs were tested for each SNP separately. Because the animals were related, the following linear model was applied to the data: where y is the deregressed EBV of an AI-boar i; μ is an intercept; b is the regression coefficient; and x is the corresponding allele dose of the tested SNP with values of 0 (homozygous for the major allele), 1 (heterozygote), and 2 (homozygous for the minor allele); a is the polygenic effect with a ~ N(0, Aσ2 a); and e is the residual effect with e ~ N(0, Iσ2 e/w ). Matrix A is the pedigree-based additive relationship matrix and I is the identity matrix with diagonal elements of σ2 e/w , where weights (w ) were calculated based on the reliabilities of the EBVs of the animal i itself and its parents. The SNP effect (b) and additive genetic (σ2 a) and residual (σ2 e) variances were estimated for each SNP separately using the Restricted Maximum Likelihood (REML) method of the DMU program package [21]. The statistical significance of the SNPs was based on a two-sided t-test with H0: b = 0, HA: b ≠ 0, and Bonferroni-corrected P-values. Because of the strong LD between the SNPs in Finnish Yorkshire [16], the number of independent tests is less than the number of SNPs in the data. Thus, in this research we used the previously defined P-value of 2.0E-06 based on the assumption of 25,000 independent tests, as a limit value for statistically significant association [22]. Haplotypes of the animals were estimated with FastPHASE [23] using default parameters, and Manhattan plots were produced with the Haploview program [24].

Post-GWAS analysis

For post-GWAS analysis, three lists of genes were formed based on genes within the significant regions: on chromosome 3 (39.4 Mb–40.1 Mb) and on chromosome 15 (58.5 Mb–60.5 Mb and 133.3 Mb–134.2 Mb). Additionally, we formed a separate list of genes relating to the significant SNPs on chromosome 15 outside the above regions, using 22.2 kb of the 5′ and 3′ flanking sequences (i.e. half the average distance between two SNPs on the chip). The annotations were based on the genome build Sscrofa10.2 at the NCBI website (https://www.ncbi.nlm.nih.gov/gene/). The two-sided hypergeometric test of the ClueGO plug-in of Cytoscape [25] was used to construct a gene network highlighting the pathways and relations across the four sets of genes. The TFM-Explorer program (http://bioinfo.lifl.fr/TFM/TFME/) was used to identify the TF related to significant SNPs and regions. The TFM-Explorer takes a set of gene sequences and searches for locally overrepresented TF-binding sites (TFBS). The search protocol of the TFM-Explorer utilizes weight matrices from the JASPAR vertebrate database [26]. Our input into the program included 3,000 bp upstream and 300 bp downstream sequences of the gene transcription start sites in the FASTA format. Non-coding RNA genes were excluded from the analysis. The significance (P-value ≤ 0.01) of the clusters (regions of the input sequences associated with a factor) was based on a score function, as described by Touzet and Varré [27] and Defrance and Touzet [28]. The obtained list of TFs was analyzed for overrepresented gene ontology (GO) terms using the BiNGO (Biological Networks Gene Ontology tool, [29] plug-in of Cytoscape [30]). In the analysis, we applied the default statistical tests and corrections for multiple testing to retain an overall P-value of 0.05. A list of the most promising key TFs related to meat pH was formed based on the biological processes involved (e.g. muscle cell homeostasis) and a literature review. The most likely candidate genes were then identified using the NetworkAnalyzer tool within Cytoscape. Based on TFBS (and consequently, the number of connections in each gene and TF), the most connected genes were determined within each list of genes to form a gene-TF network.

Results

Significant SNPs

The Manhattan plots of GWAS are presented in Fig. 1. Three regions were statistically significant: one on chromosome 3 and two on chromosome 15. The allele effects with the standard errors and P-values of the significant SNPs are shown in Table 1 and the P-values (-log10) against the chromosomal positions with the validated genes from the Reference Sequence database (RefSeq, http://www.ncbi.nlm.nih.gov/refseq/) in Fig. 2.
Fig. 1

Manhattan plots of P-values (-log10) from association analysis (a) and from conditional association analysis (b) of pH measured from loin

Table 1

Significant (in bold) and close to significant SNPs on chromosomes 3 and 15

SNPChrPosition, bpMAFCRAlleleba SEn P-value
ALGA01050743394337030.500.967G1.75E-023.68E-036922.43E-06
H3GA00093093398584590.500.999G1.75E-023.66E-037022.13E-06
ALGA0018568 3398816830.501.000A-1.80E-023.63E-037039.14E-07
M1GA0004302 3399926140.480.952A1.81E-023.70E-036741.28E-06
MARC0023922 3400035360.501.000A-1.80E-023.63E-037039.14E-07
ALGA00185633400470770.500.978A-1.74E-023.66E-036932.44E-06
ASGA0014287 3401289020.500.995A-1.80E-023.63E-037018.87E-07
ALGA0112278 15585158740.061.000G-3.61E-027.48E-037031.70E-06
ASGA0106157 15585321590.061.000A-3.61E-027.48E-037031.70E-06
MARC009856015585653000.060.994A-3.51E-027.52E-036943.65E-06
ASGA006964115596746620.131.000C-2.62E-025.58E-037033.30E-06
H3GA0044376 15597256490.101.000G-3.08E-026.07E-037034.91E-07
ALGA0085452 15597997120.101.000G-3.08E-026.07E-037034.91E-07
ASGA0069650 15604175830.111.000G-3.12E-025.83E-037031.16E-07
ASGA0069653 15604737650.060.988A-3.72E-027.54E-036941.04E-06
ALGA0106581 151186619140.121.000G-2.97E-025.43E-037036.07E-08
MARC0105925 151294300600.321.000G2.22E-024.27E-037032.71E-07
MARC0012403 151302281580.351.000A1.90E-023.97E-037031.93E-06
H3GA0044925 151316370110.180.999A2.39E-024.79E-037037.56E-07
ALGA0087027 151316655820.181.000G-2.39E-024.79E-037037.56E-07
ALGA0087009 151316978050.191.000G-2.28E-024.72E-037031.61E-06
ALGA0087013 151317131640.181.000A2.39E-024.79E-037037.56E-07
ASGA0070510 151317229290.181.000A2.39E-024.79E-037037.56E-07
ASGA0070514 151317452710.170.957G-2.36E-024.84E-036791.27E-06
ALGA0087030 151317958390.161.000G-2.88E-025.78E-034888.87E-07
INRA0050208 151319668130.180.999G-2.39E-024.79E-037037.56E-07
ASGA0070535 151321160330.181.000A2.39E-024.79E-037037.56E-07
ASGA0070533 151321719760.181.000G-2.39E-024.79E-037037.56E-07
INRA0050231 151322409300.181.000A2.39E-024.79E-037037.56E-07
ASGA0070538 151322714330.181.000G2.39E-024.79E-037037.56E-07
H3GA0044934 151322936050.181.000C-2.39E-024.79E-037037.56E-07
INRA0050226 151323520560.181.000G-2.39E-024.79E-037037.56E-07
ALGA0123666 151324115190.181.000A2.39E-024.79E-037037.56E-07
ASGA0101786 151324186510.181.000G-2.39E-024.79E-037037.56E-07
ASGA0070540 151325200740.181.000A2.39E-024.79E-037037.56E-07
ASGA0070545 151325907890.170.999A2.54E-024.79E-037021.60E-07
ASGA0070549 151327036530.170.996A2.54E-024.81E-037001.70E-07
ALGA0087060 151327303760.180.989A2.55E-024.85E-036951.92E-07
ALGA0087067 151327820650.181.000A2.54E-024.79E-037031.59E-07
ASGA0070571 151330528150.121.000G-4.11E-025.25E-037031.89E-14
ASGA0070560 151330720970.131.000A-3.95E-024.98E-037038.24E-15
H3GA0044951 151331183810.140.999G-3.72E-024.89E-037029.11E-14
ASGA0070582 151331382770.131.000G-3.95E-024.98E-037038.24E-15
ASGA0070586 151331609770.400.995G-2.05E-023.87E-037011.65E-07
ALGA0087116 151333423610.140.999A-4.10E-024.95E-037026.00E-16
ALGA0087118 151333553270.120.994G-4.12E-025.26E-037001.80E-14
ASGA0070623 151334937090.380.999G1.88E-023.82E-037021.10E-06
DRGA0015508 151335348070.110.970A-4.14E-025.41E-036807.34E-14
ASGA0070634 151336405990.130.999A4.22E-025.13E-037028.78E-16
ASGA0070625 151336773850.131.000A-4.17E-025.11E-037031.52E-15
MARC0083357 151337383420.131.000C-4.17E-025.11E-037031.52E-15
DBUN0002708 151338364710.130.957A4.12E-025.16E-036895.70E-15
MARC0039273 151339644550.131.000A-4.17E-025.11E-037031.52E-15
ASGA0070646 151339701660.120.988A-4.14E-025.18E-036945.59E-15
DIAS0002965 151340068450.131.000G-4.17E-025.11E-037031.52E-15
ASGA0070665 151341568790.120.998A-4.31E-025.26E-037011.29E-15
ASGA0070668 151341894420.121.000G-4.32E-025.25E-037038.21E-16
MARC0009333 151343977120.280.999A-2.02E-024.13E-037021.33E-06

aEffect of the minor allele, given in the column “Allele”

Chromosome (Chr), Minor allele frequency (MAF), Call rate (CR)

Fig. 2

P-values (-log10-based) of the significant regions. a: chromosome 3, b and c: chromosome 15 against the positions of the validated genes

Manhattan plots of P-values (-log10) from association analysis (a) and from conditional association analysis (b) of pH measured from loin Significant (in bold) and close to significant SNPs on chromosomes 3 and 15 aEffect of the minor allele, given in the column “Allele” Chromosome (Chr), Minor allele frequency (MAF), Call rate (CR) P-values (-log10-based) of the significant regions. a: chromosome 3, b and c: chromosome 15 against the positions of the validated genes The statistically significant region on chromosome 3 was located at around 39.9 Mb–40.1 Mb and had four significant SNPs with an average allele effect of 0.018 pH units (SE = 0.004), corresponding to 0.4 SD of the total additive genetic effect and approximately 8% of the additive genetic variance (σa = 0.045 used in national breeding value evaluation for loin pH). In this region, the frequencies of unfavorable and favorable alleles were equal (MAF = 0.5). This region harbors three validated genes: TNF receptor-associated protein 1 (TRAP1), deoxyribonuclease I (DNASE1), and clusterin-associated protein 1 (CLUAP1). The first region on chromosome 15 (58.5 Mb–60.5 Mb) had six statistically significant SNPs. The allele frequency of the minor allele of the best SNP (ASGA0069650) was 0.11 and the SNP effect was -0.031 pH units (SE = 0.006), corresponding to 0.7 SD of the total additive genetic effect and approximately 9% of the additive genetic variance. Only one gene, MAK16 homolog (MAK16), has been validated in this region (Fig. 2). The second region on chromosome 15 (approximately 130 Mb–134 Mb) included PRKAG3, the gene reported earlier using partly the same data as here [12, 31]. The region with highly significant P-values contains several other genes besides PRKAG3. The allele effect of the most significant SNP (ALGA0087116) was 0.041 pH units (SE = 0.005), corresponding to 0.9 SD of the total additive genetic effect and approximately 20% of the additive genetic variance. Also, a single significant SNP (ALGA0106581) was observed 10 Mb from this region. Because the SNPs at the PRKAG3 region had far stronger association with pH than the other SNPs on chromosome 15 or on other chromosomes, MARC0083357 was included as a covariate in the model, and GWAS was repeated. MARC0083357 was chosen because it was in complete LD with the most significant SNP ALGA87116, is located very close to PRKAG3 (62 kb from PRKAG3), and had a call rate of 1.0. The conditional GWAS revealed the same significant SNPs on chromosome 3 as the original GWAS. However, the significance of the SNPs in the first region on chromosome 15 (58.5 Mb–60.5 Mb) in the conditional analysis differed from the original GWAS depending on the LD between the SNPs and MARC0083357; e.g., the P-value for H3GA0044376 in the conditional GWAS was only 0.017 whereas the original P-value was 4.910E-07 (r 2 with MARC0083357 was 0.16). This reflects the long-distance LD found between MARC0083357 and several SNPs in the region 50 Mb–100 Mb (Fig. 3). However, some of the SNPs, e.g. ASGA0069650 (r 2 = 0.03), were segregating independently from MARC0083357, and the association with meat pH in the conditional GWAS for these SNPs was still relatively significant (Table 2). Additionally, several SNPs in the vicinity of PRKAG3 gave relatively small P-values, despite the fact that one of the most significant SNPs in that region was included in the model simultaneously (Table 2).
Fig. 3

P-values (-log10-based) from the original and from the conditional association analysis and linkage disequilibrium with MARC0083357 measured as squared correlation (r2) for SNPs on chromosome 15

Table 2

SNPs on chromosome 15 having a P-value less than 1.0E-04 from the conditional GWAS where MARC0083357 was included as a covariate in the model

Original GWASConditional GWAS
SNPPositionMAFCRAb1 P-value1 b2 P-value2 b1 P-value1
ALGA0112278585158740.061.00G-3.61E-021.70E-06-3.86E-021.54E-13-2.73E-021.81E-04
ASGA0106157585321590.061.00A-3.61E-021.70E-06-3.86E-021.54E-13-2.73E-021.81E-04
MARC0098560585653000.060.99A-3.51E-023.65E-06-3.82E-022.79E-13-2.63E-023.43E-04
ASGA0069653604737650.060.99A-3.72E-021.04E-06-3.87E-023.96E-13-2.85E-021.10E-04
ASGA00703951238081490.341.00A7.93E-034.49E-02-4.49E-021.97E-171.35E-023.76E-04
DRGA00154551267390600.420.98C-4.74E-032.31E-01-4.66E-023.96E-17-1.29E-028.94E-04
ASGA00704331279823020.341.00A-7.91E-034.79E-02-4.47E-022.86E-17-1.32E-025.80E-04
ALGA00869081293976990.491.00G3.71E-033.36E-01-4.79E-023.29E-181.42E-022.29E-04
MARC00992881294296100.490.99G4.04E-032.95E-01-4.76E-026.73E-181.44E-021.85E-04
MARC01059251294300600.321.00G2.22E-022.71E-07-3.77E-028.58E-131.56E-022.01E-04
ALGA00869571307655460.420.99C3.04E-034.12E-01-4.67E-021.74E-171.26E-026.32E-04

1Effect and P-value of the minor allele given in the column A

2Effect and P-value of the minor allele of MARC0083357

P-values (-log10-based) from the original and from the conditional association analysis and linkage disequilibrium with MARC0083357 measured as squared correlation (r2) for SNPs on chromosome 15 SNPs on chromosome 15 having a P-value less than 1.0E-04 from the conditional GWAS where MARC0083357 was included as a covariate in the model 1Effect and P-value of the minor allele given in the column A 2Effect and P-value of the minor allele of MARC0083357

Haplotype analysis

Full LD was obtained for all significant SNPs and very strong LD (r 2 > 0.97) between all other SNPs in the region on chromosome 3, forming four haplotypes (Table 3). The association between the haplotypes (coded as 0: animal does not carry the haplotype, 1: animal carries one copy of the haplotype, and 2: animal carries two copies of the haplotype) and pH confirmed the positive effect of haplotype 1 on loin pH (Table 3). Compared to the rest of the haplotypes, the effect of haplotype 1 on loin pH was 0.018 (SE = 0.004), the same as in the single-SNP analysis.
Table 3

Haplotypes in the 39.4 Mb–40.1 Mb region on chromosome 3 and their association with pH

HaplotypeNucleotides1 Frequencyb2 SE P-value
1AGAACAAA0.501.76E-023.60E-031.26E-06
2GGGGAGGG0.45-1.53E-023.73E-034.58E-05
3GAGGAGGG0.05-1.39E-028.23E-03NS3
4AGAGAGGG<0.01-1.88E-022.01E-02NS

1The SNPs are: ALGA0105074, ALGA0114510, H3GA0009309, ALGA0018568, M1GA0004302, MARC0023922, ALGA0018563, ASGA0014287. 2Effect of the haplotype. 3NS = not significant

Haplotypes in the 39.4 Mb–40.1 Mb region on chromosome 3 and their association with pH 1The SNPs are: ALGA0105074, ALGA0114510, H3GA0009309, ALGA0018568, M1GA0004302, MARC0023922, ALGA0018563, ASGA0014287. 2Effect of the haplotype. 3NS = not significant The linkage disequilibrium structure (D’) of the first region on chromosome 15 (58.5 Mb–60.5 Mb) is presented in Fig. 4. The significant region from the original GWAS is approximately 2 Mb long and includes over 30 SNPs that passed the quality check. Even though the LD structure presented as D’ values (Fig. 4) is quite strong throughout the region, there are still 16 different haplotypes present. Haplotype 6, with very low frequency (0.05), showed strong association with loin pH: a haplotype effect of -0.036 pH units with SE = 0.008 and P-value = 6.6E-06 (Table 4). Also haplotype 7 showed a similar haplotype effect (-0.021, SE = 0.009) but with a higher P-value of 0.017. All other haplotypes gave a P-value > 0.05. Haplotypes 6 and 7 only have 30% of the alleles in common, but share three significant SNPs: H3GA0044376, ALGA0085452, and ASGA0069650 (see Table 2). Considering these two haplotypes together against all other haplotypes gave a P-value of 4.95E-07.
Fig. 4

Linkage disequilibrium plots of the region 58.5 Mb–60.5 Mb on chromosome 15. SNPs presented in Table 2 are marked with bold lines

Table 4

Haplotypes in the 58.5 Mb–60.5 Mb region on chromosome 15 and their association (b) with pH

HaplotypeNucleotides1 Frequency2 bSE P-value
1GAGGGAAAGGGGAAGAACAAAGGAGAGGGAGAAAG0.258.59E-034.59E-03NS3
2GAGGGAAGAAGGAAAGACAAAAGAGAAAGAGAAAG0.224.30E-034.36E-03NS
3GAGGAGGGAGGGAAGGACAAGAAAGAAGGAGAAAG0.161.07E-035.38E-03NS
4GAGGAGGGAGGGGAAGACAAGAAGAGGAGAGAAAG0.135.58E-035.42E-03NS
5GAGGGAAAGGGGGAAGACAAGAAGAGGAGAGAAAG0.08-5.27E-036.26E-03NS
6GGAAGAAAGGGGAAGACGGGAGGAGAAAGGAAGAA0.05-3.63E-028.00E-036.69E-06
7AAGGGGGGAGAAGGGGCCGGGGGAAGGGAAGAGAG0.05-2.15E-028.98E-030.02
8GAGGAGGGAAGGAAGGCGAAGAGAGAAAGAGAAAG0.03-2.25E-031.43E-02NS
9GAGGGAAAGGGGGAAGACAAGAGGGAAGGGAGACG0.032.15E-021.12E-02NS

1The SNPs are: INRA0049382, ALGA0112278, ASGA0106157, MARC0098560, DRGA0015140, DRGA0015141, ALGA0085422, MARC0044358, ALGA0085430, ALGA0085436, ALGA0085439, INRA0049399, ALGA0085441, ALGA0085442, MARC0043488, DRGA0015145, ASGA0069641, ALGA0085445, H3GA0044376, ALGA0085452, MARC0000855, ASGA0069644, ALGA0085462, H3GA0044381, INRA0049414, H3GA0044383, MARC0071088, ALGA0085464, ALGA0085465, MARC0073466, INRA0049417, DRGA0015149, ASGA0069650, ALGA0085471, ASGA0069653. 2Only haplotypes with a frequency greater than 1% are presented. 3NS = not significant

Linkage disequilibrium plots of the region 58.5 Mb–60.5 Mb on chromosome 15. SNPs presented in Table 2 are marked with bold lines Haplotypes in the 58.5 Mb–60.5 Mb region on chromosome 15 and their association (b) with pH 1The SNPs are: INRA0049382, ALGA0112278, ASGA0106157, MARC0098560, DRGA0015140, DRGA0015141, ALGA0085422, MARC0044358, ALGA0085430, ALGA0085436, ALGA0085439, INRA0049399, ALGA0085441, ALGA0085442, MARC0043488, DRGA0015145, ASGA0069641, ALGA0085445, H3GA0044376, ALGA0085452, MARC0000855, ASGA0069644, ALGA0085462, H3GA0044381, INRA0049414, H3GA0044383, MARC0071088, ALGA0085464, ALGA0085465, MARC0073466, INRA0049417, DRGA0015149, ASGA0069650, ALGA0085471, ASGA0069653. 2Only haplotypes with a frequency greater than 1% are presented. 3NS = not significant We also attempted a haplotype analysis for the second region of chromosome 15, but no further information was attained beyond the results presented for single SNPs. The reason for this is the length of the significant region, which created a very large number of possible haplotypes depending on the way haplotype blocks were defined. Based on the database annotation, a total of 56 genes were located next to the significant SNPs or regions identified in GWAS (Table 5). These genes were found to form main functional networks (Fig. 5). The genes on chromosome 3 (e.g. CREBBP and ADCY9) and on chromosome 15 (e.g. PRKAG3, IHH, WNT10A, STK36, and PLCD4 at 133.3 Mb–134.2 Mb) share statistically the most significant pathway, the Hedgehog signaling pathway. Other highlighted network pathways include Endocytosis, ErbB signaling, Faconiani anemia, RNA degradation, Non-homologous end-joining, Lysosome, and Primary bile acid biosynthesis.
Table 5

List of genes that locate inside significant regions or are in the proximity of the significant SNPs not included in any of the three regions

SNP1 Chr2 PositionRegionGenesDistance (kb)3
ALGA0105074 339433703Region 1 NLRC3, TRAP1, SLX4, LOC100738967/CREBBP, LOC100738923/CREBBP, LOC100738884/ADCY9, DNASE1, CREBBP, CLUAP1 and C3H16orf90 Inside
H3GA0009309 339858459
ALGA0018568339881683
M1GA0004302339992614
MARC0023922340003536
ALGA0018563 340047077
ASGA0014287340128902
ALGA01122781558515874Region 2 TTI2, RNF122, MAK16, LOC102164955/NRG1, LOC102164569/NRG1, LOC100739280/NRG1, LOC100739161/MPHOSPH6, LOC100620584/NRG3 and DUSP26 Inside
ASGA01061571558532159
MARC0098560 1558565300
ASGA0069641 1559674662
H3GA00443761559725649
ALGA00854521559799712
ASGA00696501560417583
ASGA00696531560473765
ALGA010658115118661914---
MARC010592515129430060---
MARC001240315130228158---
H3GA004492515131637011- LOC100738836/IGFBP5 2.091
ALGA008702715131665582- IGFBP5 16.680
ALGA008700915131697805- IGFBP5 13.200
ALGA008701315131713164---
ASGA007051015131722929---
ASGA007051415131745271---
ALGA008703015131795839- TNP1 4.532
INRA005020815131966813---
ASGA007053515132116033---
ASGA007053315132171976---
INRA005023115132240930---
ASGA007053815132271433---
H3GA004493415132293605---
INRA005022615132352056---
ALGA012366615132411519---
ASGA010178615132418651---
ASGA007054015132520074---
ASGA007054515132590789---
ASGA007054915132703653---
ALGA008706015132730376---
ALGA008706715132782065---
ASGA007057115133052815- TNS1 Inside
LOC100514326/tensin-1-like Inside
ASGA007056015133072097- TNS1 Inside
LOC100514326/tensin-1-like Inside
H3GA004495115133118381- LOC102160493/tensin-1-like Inside
LOC100514326/tensin-1-like Inside
TNS1 7.489
ASGA007058215133138277- LOC102160493/tensin-1-like Inside
LOC100514326/tensin-1-like Inside
ASGA007058615133160977- LOC102160493/tensin-1-like 10.500
LOC100514326/tensin-1-like Inside
ALGA008711615133342361Region 3 ZNF142, USP37, TTLL4, STK36, SLC11A1, RQCD1, RNF25, PRKAG3, PLCD4, NHEJ1, LOC102163340/CCDC108, LOC102163099/CCDC108, LOC102162367/tubulin polyglutamylase TTLL4-like, LOC102162096/ZNF142, LOC102161979/mitochondrial chaperone BCS1, LOC102161492/VIL1, PNKD, LOC100739763/PRKAG3, AAMP, GPBAR1, TMBIM1, LOC100739428, WNT10A, VIL1, IHH, CYP27A1, CRYBA2, CDK5R2, CCDC108, C15H2orf62 and ARPC2 Inside
ALGA008711815133355327
ASGA007062315133493709
DRGA001550815133534807
ASGA007063415133640599
ASGA007062515133677385
MARC008335715133738342
DBUN000270815133836471
MARC003927315133964455
ASGA007064615133970166
DIAS000296515134006845
ASGA007066515134156879
ASGA007066815134189442
MARC000933315134397712---

1Non-significant SNPs that included in the three regions are marked in italics. 2CHR: chromosome. 3Distance from the closest significant SNP

Fig. 5

Main functional group networks with pathway terms and genes as nodes. Red nodes represent pathways associated with genes on chromosome 3 (39.4 Mb–40.1 Mb); green and blue nodes are pathways associated with genes on chromosome 15 (58.5 Mb–60.5 Mb and 133.3 Mb–134.2 Mb, respectively). Pink and gray nodes are pathways shared between the regions. The most enriched terms per group are shown in bold according to enrichment significance from the ClueGO Cytoscape plug-in. Node size corresponds to enrichment significance. Nodes named in black are the observed genes

List of genes that locate inside significant regions or are in the proximity of the significant SNPs not included in any of the three regions 1Non-significant SNPs that included in the three regions are marked in italics. 2CHR: chromosome. 3Distance from the closest significant SNP Main functional group networks with pathway terms and genes as nodes. Red nodes represent pathways associated with genes on chromosome 3 (39.4 Mb–40.1 Mb); green and blue nodes are pathways associated with genes on chromosome 15 (58.5 Mb–60.5 Mb and 133.3 Mb–134.2 Mb, respectively). Pink and gray nodes are pathways shared between the regions. The most enriched terms per group are shown in bold according to enrichment significance from the ClueGO Cytoscape plug-in. Node size corresponds to enrichment significance. Nodes named in black are the observed genes In addition, the four sets of genes in the significant chromosomal regions were used as input for the TFM-Explorer. Twenty-five TFs were identified through this analysis in each set. Based on the biological processes overrepresented in the BiNGO as well as on a literature review related to meat pH, we selected eight key TFs (Table 6) to construct a combined gene-TF network (Fig. 6). This network highlights the most connected genes within each set (e.g. TNS1, IGFBP5, VIL1, USP37, RQCD1, CRYBA2, PRKAG3, MAK16, NRG1, TRAP1, CLUAP1, and CREBBP) and provides an overview of shared TFs and genes across the single significant SNPs and regions on chromosomes 3 and 15.
Table 6

Main transcription factors (TF) associated with genes overlapping with significant SNPs or regions and their biological process and literature evidences related to meat pH

TFGroupBiological Process (GO)Literature evidence
PPARG Single SNPs and Region 11 Regulation of caspase activityLipid and glucose homeostasis [47]
SRF Region 2Muscle cell homeostasisActin cytoskeleton and contractile homeostasis [59]
Stat3 Single SNPs and Region 1Homeostatic processGlucose Homeostasis [60]
PPARG::RXRA Single SNPs and Regions 1 and 3Homeostatic processLipid and glucose homeostasis [47]
Arnt::Ahr Single SNPs and Region 3Regulation of homeostatic processCellular homeostasis [61]
STAT1 Region 1Regulation of caspase activityCellular homeostasis [62]
Nkx2-5 Region 2Regulation of calcium ion transport via voltage-gated calcium channel activityHomeostasis [49]
HNF4A Single SNPs and Region 3Homeostatic processLipid homeostasis [46]

1Region 1: chromosome 3 (39,9 Mb–40.1 Mb); Region 2: chromosome 15 (58.5 Mb–60.5 Mb); Region 3: chromosome 15 (133.3 Mb–134.2 Mb)

Fig. 6

Gene-transcription factor (TF) network. Transcription factors (pink nodes) and genes overlapping with relevant SNPs or regions for pH (yellow nodes are genes observed to be associated with single SNP group; red nodes are genes observed in chromosome 3 region (39.4 Mb–40.1 Mb); green nodes are genes observed in the first region on chromosome 15 (58.5 Mb–60.4 Mb); blue nodes are genes observed in the second region on chromosome 15 (133.3 Mb–134.2 Mb). The node size corresponds to the network analysis (Cytoscape) score, where bigger nodes represent higher edges density associated with the number of TF-binding sites. Purple square nodes are biological processes (GO terms) associated with muscle pH

Main transcription factors (TF) associated with genes overlapping with significant SNPs or regions and their biological process and literature evidences related to meat pH 1Region 1: chromosome 3 (39,9 Mb–40.1 Mb); Region 2: chromosome 15 (58.5 Mb–60.5 Mb); Region 3: chromosome 15 (133.3 Mb–134.2 Mb) Gene-transcription factor (TF) network. Transcription factors (pink nodes) and genes overlapping with relevant SNPs or regions for pH (yellow nodes are genes observed to be associated with single SNP group; red nodes are genes observed in chromosome 3 region (39.4 Mb–40.1 Mb); green nodes are genes observed in the first region on chromosome 15 (58.5 Mb–60.4 Mb); blue nodes are genes observed in the second region on chromosome 15 (133.3 Mb–134.2 Mb). The node size corresponds to the network analysis (Cytoscape) score, where bigger nodes represent higher edges density associated with the number of TF-binding sites. Purple square nodes are biological processes (GO terms) associated with muscle pH

Discussion

This article presents the results of GWAS and post-GWAS of pH measured from loin using the Finnish Yorkshire pig breed. A previous GWAS with 470 animals which were also included in the current study revealed two statistically significant (P-value < 2.0E-06) chromosomal regions: one on chromosome 2 and one on chromosome 15 (PRKAG3 region) [12]. As in the previous study, the region around PRKAG3 also gave the smallest P-value in this study. The SNPs on chromosome 2 found significant in the previous study [12] now reached a P-value of 5.77E-05 (ASGA0009838) that is still very close to significance and can be considered as “suggestive” finding. In the previous study, the best SNP on chromosome 3 (ASGA0014287) had a P-value of 5.89E-05. The best SNP on chromosome 15 at 58.5 Mb–60.5 Mb (ASGA0069650) also had an almost significant P-value (5.75E-06) in the previous study. Thus, increasing the number of observations from 470 to 703 changed the results somewhat. Results based on larger data are obviously more reliable than those based on smaller datasets. Long-distance LD was observed between the SNPs in the PRKAG3 region and the other SNPs on chromosome 15. Including MARC0083357 in the model reduced the effect and significance of all SNPs on chromosome 15. Thus the significance observed in the first region on chromosome 15 may be “reflection” of the PRKAG3 region due to LD. However, the question why LD between these regions is so strong remains unsolved. Altogether, the mechanism on chromosome 15 that reduces pH in muscle post mortem is currently not yet fully understood. Beyond the original 200Q allele of PRKAG3, the functional variations could be due to other genes or to interaction between genes and transcription factors. Several studies have given evidence that I199V is highly associated with loin pH [32-35]. Also Rubio et al. [14] considered PRKAG3 as the best candidate in the region 132 Mb–135 Mb of chromosome 15 (the same region as detected in our study). However, based on a previous study by Uimari and Sironen [31], I199V is not directly associated with loin pH in the Finnish Yorkshire population; instead, the haplotype g.-157C–g.-58A–24E–199I is. Also Ryan et al. [36] reported a positive association of g.-157C with PRKAG3 expression and meat quality, and Zhang et al. [15] proposed that other genes besides PRKAG3 could be responsible for the association found in this region.

Post-GWAS

All the detected significant regions contain several genes. To find the most promising candidate genes within these regions and to understand the possible relationship between the candidate genes, a post-GWAS analysis was performed. Hedgehog signaling was the most significantly enriched pathway in the main functional group network (Fig. 5) comprising seven genes (PRKAG3, ADCY9, CREBBP, PLCD4, IHH, WNT10A, and STK36). The hedgehog signaling pathway has been cited as a key factor in the regulation of human adult tissue homeostasis and repair. It acts via multiple different routes to regulate distinct cellular outcomes, including the maintenance of plasticity [37]. Among the genes present in this pathway, ADCY9 is a type 9 adenylyl cyclase, which is involved in the main pathways promoting muscle relaxation by a cAMP (cyclic AMP) messenger [38]. PLCD4 is connected in the network through the calcium signaling and thyroid hormone signaling pathways. The phospholipase C enzyme promotes smooth muscle relaxation [39] and generates a second messenger IP3 that controls many cellular processes by inducing intracellular calcium mobilization [40]. The significant region of chromosome 3 contains two genes (CREBBP and ADCY9) involved in cyclic cAMP signaling. cAMP signaling mediates the effects of metabolism-controlling hormones, such as glucagon and epinephrine, and regulates energy homeostasis in multiple tissues [41]. cAMP is generated from ATP by adenylate cyclase enzymes, one of which is encoded by ADCY9 (adenylate cyclase 9) [42]. ADCY9 displays high expression in skeletal muscle and responds to beta-adrenergic receptor activation [43], which modulates Ca2+ release from the sarcoplasmic reticulum. Ca2+ release is a major contributor to pork meat quality, as is the case in the mutation R615C found in the pale, soft, and exudative (PSE) meat-related ryanodine receptor gene RYR1 [6]. cAMP activates protein kinase A (PKA), which controls metabolism either directly or through gene expression by phosphorylating the transcription factor CREB (cAMP-response element-binding protein), and consequently leading to the recruitment of its cofactor CBP (CREB binding protein) encoded by CREBBP [44]. Together, CREB and CBP regulate a plethora of metabolic target genes involved in glucose metabolism [41], which can potentially impact meat acidification. In addition to transcriptional regulation, PKA-mediated phosphorylation activates phosphorylase kinase, which stimulates glycogen phosphorylase to active glycogen release (glycogenolysis), which, in turn, is directly reflected on lactate production [41]. Moreover, PKA phosphorylates RYR1 and consequently regulates calcium release in skeletal muscle [45], providing another putative mechanism for the impact of ADCY9 on meat quality. Each of the four sets of genes was also used to explore the promoter regions for enriched TFs, of which we selected the most relevant ones for meat pH to generate gene-TF networks. These networks were merged, enabling the visualization of the genes and the TFs that are common between genes in the different regions. The most connected TF (linked with a high number of genes) in this network is HNF4A, followed by PPARG and Nkx2-5. HNF4A encodes to hepatocyte nuclear factor 4α, which is essential to control the basal expression of genes involved in lipid metabolism and is indispensable for maintaining normal lipid homeostasis [46]. PPARG is the most studied isoform of the nuclear receptor superfamily, and performs an important role in regulating lipid and glucose homeostasis, in adipocytes differentiation, and in fatty acid storage [47]. Moreover, the polymorphism of this gene has been associated with meat quality traits in cattle [48]. The third most connected TF is Nkx2-5, which is a homeobox transcription factor known to be required for homeostasis of cardiac myocytes [49]. Briggs et al. [50] observed that Nkx2-5 knockout mice presented a reduced expression of ryanodine receptor 2 (RYR2), through which calcium is released from the sarcoplasmic reticulum. The corresponding skeletal muscle-related ryanodine receptor gene is RYR1. The most relevant biological processes of these TFs that affect meat pH are the homeostatic process (HNF4A and PPARG) and the regulation of calcium ion transport via voltage-gated calcium channel activity (Nkx2-5). In the gene-TF network, HNF4A and PPARG are mainly connected with the genes on chromosome 3 and in the second region on chromosome 15, while genes identified in the first region of chromosome 15 are mainly connected with Nkx2-5. In the significant region on chromosome 3, TRAP1 is the most connected gene in the gene-TF network. TRAP1 encodes a mitochondrial chaperone protein that interacts with a calcium-binding protein, sorcin, and is thus involved in intracellular calcium concentration [51] and might also affect muscle pH. Of the genes in the first significant region on chromosome 15, the most connected gene in the gene-TF network is LOC102164569/NRG1 (pro-neuregulin-1, membrane-bound isoform-like). This gene is a member of the neuregulin growth factor gene family that is involved in the differentiation of embryonic muscle cells [52]. It has also been cited to be related to alterations of intracellular calcium homeostasis in humans [53] and to the marbling trait in Korean Hanwoo cattle [54]. We observed other genes besides PRKAG3 in the second region on chromosome 15 that are highlighted in the gene-TF network, such as VIL1, USP37, RQCD1, and CRYBA2. Among them, VIL1 has also been associated with meat pH and color in crossbred commercial pigs [15]. The most connected gene a bit further apart (700 kb) from PRKAG3 is TNS1 (tensin 1), which belongs to a focal adhesion gene family and interacts with actin filaments [55]. Recently, TNS1 has been identified as a candidate gene in GWAS for meat pH in Chinese Laiwu pigs [56]. Another gene, IGFBP-5, 2 Mb from PRKAG3, is a member of the IGF gene families. It has been suggested to be associated with meat quality, especially with pH in pigs [57]. Moreover, the mRNA level of this gene in muscle samples was observed to be significantly lower in Duroc pigs compared to other commercial breeds [58]. TNS1 and IGFBP5 are the most connected genes in the whole gene-TF network, and might thus be considered very stronger candidate genes for meat pH.

Conclusions

Three regions, one on chromosome 3 (39.4 Mb–40.1 Mb) and two on chromosome 15 (58.5 Mb–60.5 Mb and 133.3 Mb–134.2 Mb), were found to be highly associated with meat pH in Finnish Yorkshire. Additionally, several other SNPs up to a distance of 3 Mb from the known meat quality gene PRKAG3 proved significant. The significant regions harbored several genes, including two genes involved in cAMP signaling: ADCY9 and CREBBP. Based on post-GWAS analysis using functional and TF-gene networks, the most promising candidate genes for meat pH are ADCY9, CREBBP, TRAP1, NRG1, PRKAG3, VIL1, TNS1, and IGFBP5. The key TFs related to these genes are HNF4A, PPARG, and Nkx2-5. To conclude, we succeeded in identifying several genes which, based on SNP association, pathway, and transcription factor analysis, have potential to control muscle cell homeostasis and meat quality. However, functional studies are still needed to warrant the role of each of these genes in pork meat quality.
  58 in total

1.  Neuregulin stimulates myogenic differentiation in an autocrine manner.

Authors:  D Kim; S Chi; K H Lee; S Rhee; Y K Kwon; C H Chung; H Kwon; M S Kang
Journal:  J Biol Chem       Date:  1999-05-28       Impact factor: 5.157

2.  JASPAR: an open-access database for eukaryotic transcription factor binding profiles.

Authors:  Albin Sandelin; Wynand Alkema; Pär Engström; Wyeth W Wasserman; Boris Lenhard
Journal:  Nucleic Acids Res       Date:  2004-01-01       Impact factor: 16.971

3.  Extent of linkage disequilibrium and effective population size in Finnish Landrace and Finnish Yorkshire pig breeds.

Authors:  P Uimari; M Tapio
Journal:  J Anim Sci       Date:  2010-10-29       Impact factor: 3.159

4.  Evidence for three highly significant QTL for meat quality traits in the Finnish Yorkshire pig breed.

Authors:  P Uimari; A Sironen; M-L Sevón-Aimonen
Journal:  J Anim Sci       Date:  2013-02-13       Impact factor: 3.159

Review 5.  Roles for Hedgehog signaling in adult organ homeostasis and repair.

Authors:  Ralitsa Petrova; Alexandra L Joyner
Journal:  Development       Date:  2014-09       Impact factor: 6.868

6.  After genome-wide association studies: Gene networks elucidating candidate genes divergences for number of teats across two pig populations.

Authors:  L L Verardo; M S Lopes; S Wijga; O Madsen; F F Silva; M A M Groenen; E F Knol; P S Lopes; S E F Guimarães
Journal:  J Anim Sci       Date:  2016-04       Impact factor: 3.159

7.  UDP-glucose pyrophosphorylase is upregulated in carriers of the porcine RN- mutation in the AMP-activated protein kinase.

Authors:  Jakob Hedegaard; Per Horn; René Lametsch; Hanne Søndergaard Møller; Peter Roepstorff; Christian Bendixen; Emøke Bendixen
Journal:  Proteomics       Date:  2004-08       Impact factor: 3.984

8.  The Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT/HIF-1β) is influenced by hypoxia and hypoxia-mimetics.

Authors:  Matthias Wolff; Wolfgang Jelkmann; Jürgen Dunst; Reinhard Depping
Journal:  Cell Physiol Biochem       Date:  2013-09-20

9.  Predicting transcription factor binding sites using local over-representation and comparative genomics.

Authors:  Matthieu Defrance; Hélène Touzet
Journal:  BMC Bioinformatics       Date:  2006-08-31       Impact factor: 3.169

10.  Genome-wide association studies (GWAS) identify a QTL close to PRKAG3 affecting meat pH and colour in crossbred commercial pigs.

Authors:  Chunyan Zhang; Zhiquan Wang; Heather Bruce; Robert Alan Kemp; Patrick Charagu; Younes Miar; Tianfu Yang; Graham Plastow
Journal:  BMC Genet       Date:  2015-04-07       Impact factor: 2.797

View more
  4 in total

Review 1.  Classical, Molecular, and Genomic Cytogenetics of the Pig, a Clinical Perspective.

Authors:  Brendan Donaldson; Daniel A F Villagomez; W Allan King
Journal:  Animals (Basel)       Date:  2021-04-27       Impact factor: 2.752

2.  Genome-Wide Association Study of Piglet Uniformity and Farrowing Interval.

Authors:  Yuan Wang; Xiangdong Ding; Zhen Tan; Chao Ning; Kai Xing; Ting Yang; Yongjie Pan; Dongxiao Sun; Chuduan Wang
Journal:  Front Genet       Date:  2017-11-28       Impact factor: 4.599

3.  Gut Microbiota Modulate Rabbit Meat Quality in Response to Dietary Fiber.

Authors:  Boshuai Liu; Yalei Cui; Qasim Ali; Xiaoyan Zhu; Defeng Li; Sen Ma; Zhichang Wang; Chengzhang Wang; Yinghua Shi
Journal:  Front Nutr       Date:  2022-03-22

4.  The Genetic Architecture of Meat Quality Traits in a Crossbred Commercial Pig Population.

Authors:  Zhanwei Zhuang; Jie Wu; Cineng Xu; Donglin Ruan; Yibin Qiu; Shenping Zhou; Rongrong Ding; Jianping Quan; Ming Yang; Enqin Zheng; Zhenfang Wu; Jie Yang
Journal:  Foods       Date:  2022-10-09
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.