Literature DB >> 28157257

Compound heterozygous POMT1 mutations in a Chinese family with autosomal recessive muscular dystrophy-dystroglycanopathy C1.

Pengzhi Hu1, Song Wu2, Lamei Yuan1, Qiongfen Lin3, Wen Zheng1, Hong Xia1, Hongbo Xu1, Liping Guan3, Hao Deng1.   

Abstract

Muscular dystrophy-dystroglycanopathy (MDDG) is a genetically and clinically heterogeneous group of muscular disorders, characterized by congenital muscular dystrophy or later-onset limb-girdle muscular dystrophy accompanied by brain and ocular abnormalities, resulting from aberrant alpha-dystroglycan glycosylation. Exome sequencing and Sanger sequencing were performed on a six-generation consanguineous Han Chinese family, members of which had autosomal recessive MDDG. Compound heterozygous mutations, c.1338+1G>A (p.H415Kfs*3) and c.1457G>C (p.W486S, rs746849558), in the protein O-mannosyltransferase 1 gene (POMT1), were identified as the genetic cause. Patients that exhibited milder MDDG manifested as later-onset progressive proximal pelvic, shoulder girdle and limb muscle weakness, joint contractures, mental retardation and elevated creatine kinase, without structural brain or ocular abnormalities, were further genetically diagnosed as MDDGC1. The POMT1 gene splice-site mutation (c.1338+1G>A) which leads to exon 13 skipping and results in a truncated protein may contribute to a severe phenotype, while the allelic missense mutation (p.W486S) may reduce MDDG severity. These findings may expand phenotype and mutation spectrum of the POMT1 gene. Clinical diagnosis supplemented with molecular screening may result in more accurate diagnoses of, prognoses for, and improved genetic counselling for this disease.
© 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Entities:  

Keywords:  POMT1 gene; exome sequencing; genetic counselling; muscular dystrophy-dystroglycanopathy; mutation

Mesh:

Substances:

Year:  2017        PMID: 28157257      PMCID: PMC5487925          DOI: 10.1111/jcmm.13068

Source DB:  PubMed          Journal:  J Cell Mol Med        ISSN: 1582-1838            Impact factor:   5.310


Introduction

Muscular dystrophydystroglycanopathy (MDDG), a common group of muscular dystrophies, is clinically characterized by congenital muscular dystrophy (CMD) or later‐onset limb‐girdle muscular dystrophy (LGMD). It may occur with or without brain and ocular abnormalities 1, 2. Clinical signs include progressive muscle weakness with variable onset ages and phenotypic severity, hypotonia and markedly elevated serum creatine kinase (CK) levels. It can be accompanied by structural brain anomalies including agyria, hydrocephalus and cerebellar hypoplasia, or ocular defects such as cataracts, microphthalmia and buphthalmos. Mental retardation (MR) may be present 1, 3, 4, 5. Classical pathological features are dystrophic findings on muscle biopsy, and hypoglycosylated alpha‐dystroglycan (α‐DG) in skeletal muscle with glycosylated epitopes specific antibodies on the α‐DG 1, 2, 3, 6. The incidence and prevalence of CMD are unknown with a prevalence of 0.563/100,000 reported in Italy, and the estimated prevalence of rare LGMD is 0.07‐0.43/100,000, varying in different ethnicities 3, 4, 7. In 2010, three MDDG phenotypic groups, listed in alphabetical order, were proposed by Online Mendelian Inheritance in Man (OMIM), nominated as MDDG type A (Walker–Warburg syndrome and Walker–Warburg syndrome‐like, muscle–eye–brain disease and Fukuyama CMD‐like), MDDG type B (CMD with cerebellar involvement, CMD with MR and CMD with no MR) and MDDG type C (LGMD with MR and LGMD with no MR) 1, 2, 8. Genetic defects causing aberrant post‐translational modification of α‐DG may be involved in the pathogenic mechanism 5, 8. This tripartite subdivision of MDDG is further indicated numerically according to disease‐associated genes 2, 8. To date, at least 12 genes, implicated in proper α‐DG glycosylation, and five genes, indirectly relating to dystroglycanopathy, are reported to be associated with MDDG 4, 9. Mutations in the protein O‐mannosyltransferase 1 gene (POMT1, OMIM 607423) are related to autosomal recessive muscular dystrophies, which include three subtypes, designated as MDDGA1 (OMIM 236670), MDDGB1 (OMIM 613155) and MDDGC1 (also known as LGMD2K, OMIM 609308) 2, 5. This study was aimed to identify the genetic defects responsible for MDDG in a Han Chinese family. Compound heterozygous mutations in the POMT1 gene, including a previously described splice‐site mutation (c.1338+1G>A) involving in splicing of precursor mRNA, and a missense mutation (c.1457G>C, p.W486S) in a highly conserved region, were detected to be the possible genetic aetiology of MDDGC1 in this family.

Materials and methods

Participants and clinical description

Members of a six‐generation consanguineous Han Chinese family with putative muscular dystrophy were enrolled for genetic analysis at the Third Xiangya Hospital, Central South University, Changsha, China. General physical examinations and thorough neurological examinations of all the available family members were performed. Other conditions, including progressive proximal pelvic, shoulder girdle and limb muscle weakness after having acquired ambulation, joint contractures, and moderate or mild MR, revealed a more refined diagnosis 2, 4, 5. Clinical data, including age, gender, onset age, muscular dystrophy symptoms, and intellectual evaluation, and auxiliary examinations including CK levels, ophthalmologic examination, electromyography, brain imaging and muscle imaging were also collected (Table 1). Systemic metabolic and other acquired conditions were excluded. However, muscular biopsy in the patients was unavailable as they refused. One hundred unrelated ethnically matched healthy volunteers who did not have either similar symptoms of or a positive history for this condition took part in this study. After written informed consents were signed, peripheral blood used for genetic testing was sampled from all the available family members and the controls. The Institutional Review Board of the Third Xiangya Hospital approved the study, which was conducted in compliance with the Declaration of Helsinki principles. A standard phenolchloroform extracting procedure was used to isolate genomic DNA (gDNA) from peripheral blood 10.
Table 1

Clinical characteristics and auxiliary examinations of family members with the POMT1 gene mutation

SubjectIV:4V:2V:5V:6VI:2VI:3
GenderFemaleFemaleFemaleMaleFemaleFemale
Age (years)814643441713
GenotypeHeterozygote: c.1457G>CHeterozygote: c.1338+1G>AHeterozygote: c.1338+1G>AHeterozygote: c.1457G>CCompound heterozygotes: c.1338+1G>A and c.1457G>CCompound heterozygotes: c.1338+1G>A and c.1457G>C
Onset age (years)NoNoNoNo23
Symptoms at onsetNoNoNoNoDifficulty in running and walking, and frequent fallings after having acquired ambulationDifficulty in running and walking, and frequent fallings after having acquired ambulation
Muscle atrophies (MRI)NANoNoNoLower and upper limbsNo
Muscle hypertrophyNoNoNoNoLeft lower limbNo
Muscle weaknessNoNoNoNoYesYes
Joint contracturesNoNoNoNoYes (elbow and ankle joints)Yes (ankle joints)
Mental retardationNoNoNoNoYes (moderate)Yes (mild)
Serum creatine kinase levelNormalNormalNormalNormalElevatedElevated
ElectromyographyNANANANAMyopathyMyopathy
Ocular examinationNormalNormalNormalNormalNormalNormal
Brain structure (MRI)NANormalNormalNormalFifth and sixth cerebral ventriclesNormal

POMT1: the protein O‐mannosyltransferase 1 gene; NA: not available; MRI: magnetic resonance imaging.

Clinical characteristics and auxiliary examinations of family members with the POMT1 gene mutation POMT1: the protein O‐mannosyltransferase 1 gene; NA: not available; MRI: magnetic resonance imaging.

Exome library construction, reads alignments and variant analysis

Exome sequencing was conducted in the proband of this family (VI:2, Fig. 1A) on the Illumina HiSeq 2000 platform at BGI‐Shenzhen (Shenzhen, China), as previously described 11, 12. Single nucleotide polymorphisms (SNPs) and small insertions–deletions (indels) in coding sequences or splice sites were identified 10, 11, 12. Sorting Intolerant from Tolerant (http://sift.jcvi.org/) algorithm was used to test possible pathogenic function of non‐synonymous SNPs 13. Common and other non‐pathogenic candidate variants were sifted out using several public databases: database of SNPs (dbSNP version 137, http://www.ncbi.nlm.nih.gov/projects/SNP/snp_summary.cgi), 1000 genomes project (1000 genomes release phase 3, http://www.1000genomes.org/), HapMap project (2010‐08_phase II + III, http://hapmap.ncbi.nlm.nih.gov/), Exome Variant Server (EVS, http://evs.gs.washington.edu/EVS/) and in‐house exome BGI database. Only variants, which include non‐synonymous SNPs in exonic regions, coding indels or canonical splice‐site changes, can be regarded as pathogenic candidates 14.
Figure 1

Pedigree and compound heterozygous mutations of a family with MDDGC1. (A) Pedigree of the MDDGC1 family. N1, N2: normal; M1: c.1338+1G>A mutation; M2: c.1457G>C mutation. The arrow indicates the proband. (B) and (C) Chromatograms (genomic DNA) of heterozygous c.1338+1G>A and c.1457G>C mutations in the affected proband (VI:2). MDDGC1: muscular dystrophy‐dystroglycanopathy C1; : the protein O‐mannosyltransferase 1 gene.

Pedigree and compound heterozygous mutations of a family with MDDGC1. (A) Pedigree of the MDDGC1 family. N1, N2: normal; M1: c.1338+1G>A mutation; M2: c.1457G>C mutation. The arrow indicates the proband. (B) and (C) Chromatograms (genomic DNA) of heterozygous c.1338+1G>A and c.1457G>C mutations in the affected proband (VI:2). MDDGC1: muscular dystrophydystroglycanopathy C1; : the protein O‐mannosyltransferase 1 gene. Locus‐specific polymerase chain reaction (PCR) amplification primers were designed for potential pathogenic variants, and Sanger sequencing was performed on the ABI3500 genetic analyzer (Applied Biosystems, Foster City, CA, USA) 15. Pathogenicity prediction of non‐synonymous substitutions was evaluated by other two programs: Polymorphism Phenotyping version 2 (http://genetics.bwh.harvard.edu/pph2/) and MutationTaster (http://www.mutationtaster.org/) 16, 17. The function of a potential splice‐site variant on splicing was predicted (http://www.fruitfly.org/seq_tools/splice.html) 18. Two pairs of primer sequences (NCBI reference sequence: NM_007171.3) are as follows: 5′‐GCAACCTTTTCCTGCCTGAA‐3′ and 5′‐GTGTTCTGTTAGGAAGTGCTCT‐3′, 5′‐GTTCCCCTTCCAACCCAAGT‐3′ and 5′‐TCAGTTCCCTTCCCACCAAA‐3′. Total RNA was isolated from the lymphocytes of family members carrying variants to further determine whether the variants affect messenger RNA (mRNA). Complementary DNA (cDNA) was synthesized via reverse transcription PCR. PCR amplification was conducted using paired primers as follows: 5′‐CACGGGGACATGGTGCAG‐3′ and 5′‐AAGACAGCGGAAGTGTTCAC‐3′, 5′‐CTCTCAGAGGTCCGCTTTGT‐3′ and 5′‐TCGCCATGAAGCTGAGGTT‐3′ 15, 19.

Results

Exome sequencing in the proband produced about 69.42 million reads with a read length of 90 bp. There were 56.23 million reads aligned to the human genome; 2914.76 Mb were mapped to the target region with a mean coverage of 66.02×. There were 93,994 SNPs, including 11,153 non‐synonymous SNPs in the coding sequence and 2490 in the splice sites, detected. There were 7154 indels, including 412 in the coding sequence and 420 in the splice sites, identified. A prioritized filtration strategy of the variants was carried out following a scheme performed in previous studies 11, 12. Given the disorder's rarity, common variants identified in dbSNP137, 1000 genomes project, HapMap or EVS with a minor allele frequency higher than 0.50% were excluded. The remaining variants were further sifted out using in‐house BGI exome database with 2375 Chinese descent controls lacking similar symptoms. No homozygous variant was found, and only compound heterozygous variants (c.1338+1G>A and c.1457G>C) in the POMT1 gene were identified in the proband, which were confirmed in both affected siblings (VI:2 and VI:3). Either no mutation or a heterozygous mutation (c.1338+1G>A or c.1457G>C) was observed in the unaffected family members (IV:4, V:1, V:2, V:5, V:6 and VI:1) and the 100 normal controls after further validation of Sanger sequencing (Fig. 1). The reverse transcription PCR and Sanger sequencing assay confirmed the online splice‐site prediction analysis that the splice‐site mutation, a G>A transition at position +1 of the 5′ splice donor site of intron 13, would lead to the loss of 5′ splice site. This mutation impairs POMT1 precursor mRNA from correctly splicing and results in exon 13 being deleted (Fig. 2). A shift in the reading frame and a premature translation termination (p.H415Kfs*3) then result. In silico analysis predicted that the c.1457G>C (p.W486S) missense variant would be deleterious. Multiple sequence alignment revealed high conservation of tryptophan at position 486 (p.W486) in the homologous human protein POMT2 and in the POMT1 orthologs (http://blast.ncbi.nlm.nih.gov/Blast.cgi) 20. These findings support the possible pathogenicity of variants in this family.
Figure 2

Sequence analysis of normal (A) and abnormal (B) splicing in the gene (complementary DNA) identified in the proband (VI:2). : the protein O‐mannosyltransferase 1 gene.

Sequence analysis of normal (A) and abnormal (B) splicing in the gene (complementary DNA) identified in the proband (VI:2). : the protein O‐mannosyltransferase 1 gene.

Discussion

Defective α‐DG glycosylation is the main factor responsible for CMD and LGMD, collectively termed MDDG, which is a genetically heterogeneous group of muscular dystrophies with a wide range of clinical severity 1, 2, 5. The variable phenotypic severity may be related to the type and location of the mutations, while there is no clear genotype–phenotype correlation 9, 21, 22. MDDGC1 is a mild subtype of autosomal recessive condition caused by the POMT1 gene mutations 1, 2. It is characterized by proximal muscular weakness after having acquired ambulation, first involving the voluntary muscles of the hip, shoulder and limbs, with variable MR or mild brain anomalies 2, 7, 23. In this research, compound heterozygous mutations, including a splice‐site mutation c.1338+1G>A (p.H415Kfs*3) and a missense mutation c.1457G>C (p.W486S) in the POMT1 gene, were detected in members of an intermarriage Han Chinese family with MDDGC1 and cosegregated with the disease status. Generally, genetic disorders in consanguineous families are attributed to homozygous mutations. The compound heterozygous mutations identified in this family indicated that the causative factor was not associated with consanguineous marriage 10, 24. The mutations were absent in the 2475 ethnically matched unrelated controls who did not have similar symptoms, including 2375 controls obtained from the BGI exome sequencing and 100 normal controls in this study. In silico analysis disclosed the damaging function of the p.W486S missense mutation and the high evolutionary conservation of p.W486. These two factors taken together with the confirmed impaired splicing of the c.1338+1G>A mutation demonstrate the possible pathogenic effect of these compound heterozygous POMT1 mutations in the MDDGC1 of this family. The POMT1 gene, mapped to chromosome 9q34.13, spans over 20 kb, contains 20 exons and encodes the protein O‐mannosyltransferase 1 (POMT1) with 747 amino acids. The protein and its homologue POMT2 possess protein O‐mannosyltransferase activity and are putatively involved in O‐mannosyl glycan synthesis, important for muscle, brain and eye development 23, 24, 25. The highly conserved domains of POMT1, protein mannosyltransferase and mannosyl‐IP3R‐RyR (MIR) are involved in the recognition and/or binding of protein substrates, and/or catalysis 26. It is ubiquitously expressed in human embryonic and adult tissues with high expression in foetal brain, pituitary, testis, skeletal muscle and heart 27, 28. To date, at least 72 mutations in the POMT1 gene have been described in the literature at the Human Gene Mutation Database (http://www.hgmd.cf.ac.uk/). The disruptive effect of POMT1 gene mutations can be mediated through the reduced or absent O‐mannosylation of target proteins in a loss‐of‐function mechanism 24. At least 11 POMT1 gene mutations are identified in MDDGC1 cases, varying from missense and nonsense mutations, through small indel, to gross deletion 1, 23. The splice‐site mutation c.1338+1G>A in the POMT1 gene, which is adjacent to the conserved MIR domain, leads to exon 13 being skipped and a reading frame shift and results in a truncated protein. The mutation was previously reported to be responsible for severe type II lissencephaly, classified to MDDGA1, together with a nonsense mutation c.1858C>T (p.R620X) 29. The allelic missense mutation c.1457G>C (p.W486S) in exon 15 coding for the conserved MIR domain, recorded in the dbSNP (rs746849558) with a low frequency, may reduce disease severity, similar to a previous report 9. This is the first known report of POMT1 c.1338+1G>A (p.H415Kfs*3) and c.1457G>C (p.W486S) mutations in compound heterozygotes, responsible for the autosomal recessive MDDGC1 in this pedigree. The exon 13‐skipping effect of a splice‐site mutation was first confirmed by RNA analysis. These findings may enlarge phenotype and mutation spectrum of the POMT1 gene, allowing for greater diagnostic accuracy in exome sequencing and genetic counselling for undiagnosed or ambiguous disorders 30. Phenotypic categorization, accompanied by molecular screening, should facilitate accurate diagnosis, prognosis and genetic counselling.

Conflict of interest

The authors confirm that there are no conflicts of interest.
  30 in total

1.  MutationTaster2: mutation prediction for the deep-sequencing age.

Authors:  Jana Marie Schwarz; David N Cooper; Markus Schuelke; Dominik Seelow
Journal:  Nat Methods       Date:  2014-04       Impact factor: 28.547

2.  Identification of a Novel Mutation in the Titin Gene in a Chinese Family with Limb-Girdle Muscular Dystrophy 2J.

Authors:  Wen Zheng; Han Chen; Xiong Deng; Lamei Yuan; Yan Yang; Zhi Song; Zhijian Yang; Yuan Wu; Hao Deng
Journal:  Mol Neurobiol       Date:  2015-09-21       Impact factor: 5.590

3.  Physical and functional association of human protein O-mannosyltransferases 1 and 2.

Authors:  Keiko Akasaka-Manya; Hiroshi Manya; Ai Nakajima; Masao Kawakita; Tamao Endo
Journal:  J Biol Chem       Date:  2006-05-12       Impact factor: 5.157

4.  Congenital muscular dystrophies with defective glycosylation of dystroglycan: a population study.

Authors:  E Mercuri; S Messina; C Bruno; M Mora; E Pegoraro; G P Comi; A D'Amico; C Aiello; R Biancheri; A Berardinelli; P Boffi; D Cassandrini; A Laverda; M Moggio; L Morandi; I Moroni; M Pane; R Pezzani; A Pichiecchio; A Pini; C Minetti; T Mongini; E Mottarelli; E Ricci; A Ruggieri; S Saredi; C Scuderi; A Tessa; A Toscano; G Tortorella; C P Trevisan; C Uggetti; G Vasco; F M Santorelli; E Bertini
Journal:  Neurology       Date:  2009-03-18       Impact factor: 9.910

5.  Genetic analysis of the fused in sarcoma gene in Chinese Han patients with essential tremor.

Authors:  Wen Zheng; Xiong Deng; Hui Liang; Zhi Song; Kai Gao; Yan Yang; Hao Deng
Journal:  Neurobiol Aging       Date:  2013-04-09       Impact factor: 4.673

6.  Whole-exome sequencing diagnosis of two autosomal recessive disorders in one family.

Authors:  T Takeichi; A Nanda; S Aristodemou; J R McMillan; J Lee; M Akiyama; H Al-Ajmi; M A Simpson; J A McGrath
Journal:  Br J Dermatol       Date:  2015-03-07       Impact factor: 9.302

7.  Prevalence of congenital muscular dystrophy in Italy: a population study.

Authors:  Alessandra Graziano; Flaviana Bianco; Adele D'Amico; Isabella Moroni; Sonia Messina; Claudio Bruno; Elena Pegoraro; Marina Mora; Guja Astrea; Francesca Magri; Giacomo P Comi; Angela Berardinelli; Maurizio Moggio; Lucia Morandi; Antonella Pini; Roberta Petillo; Giorgio Tasca; Mauro Monforte; Carlo Minetti; Tiziana Mongini; Enzo Ricci; Ksenija Gorni; Roberta Battini; Marcello Villanova; Luisa Politano; Francesca Gualandi; Alessandra Ferlini; Francesco Muntoni; Filippo Maria Santorelli; Enrico Bertini; Marika Pane; Eugenio Mercuri
Journal:  Neurology       Date:  2015-02-04       Impact factor: 9.910

8.  A comparative study of alpha-dystroglycan glycosylation in dystroglycanopathies suggests that the hypoglycosylation of alpha-dystroglycan does not consistently correlate with clinical severity.

Authors:  Cecilia Jimenez-Mallebrera; Silvia Torelli; Lucy Feng; Jihee Kim; Caroline Godfrey; Emma Clement; Rachael Mein; Stephen Abbs; Susan C Brown; Kevin P Campbell; Stephan Kröger; Beril Talim; Haluk Topaloglu; Ros Quinlivan; Helen Roper; Anne M Childs; Maria Kinali; Caroline A Sewry; Francesco Muntoni
Journal:  Brain Pathol       Date:  2008-08-07       Impact factor: 6.508

Review 9.  Muscular dystrophies.

Authors:  Eugenio Mercuri; Francesco Muntoni
Journal:  Lancet       Date:  2013-03-09       Impact factor: 79.321

10.  Identification of a Novel Mutation in the COL2A1 Gene in a Chinese Family with Spondyloepiphyseal Dysplasia Congenita.

Authors:  Xiangjun Huang; Xiong Deng; Hongbo Xu; Song Wu; Lamei Yuan; Zhijian Yang; Yan Yang; Hao Deng
Journal:  PLoS One       Date:  2015-06-01       Impact factor: 3.240

View more
  11 in total

1.  Novel and Recurring Disease-Causing NF1 Variants in Two Chinese Families with Neurofibromatosis Type 1.

Authors:  Heng Xiao; Lamei Yuan; Hongbo Xu; Zhijian Yang; Feizhou Huang; Zhi Song; Yan Yang; Cheng Zeng; Hao Deng
Journal:  J Mol Neurosci       Date:  2018-07-25       Impact factor: 3.444

2.  Identification of a GNE homozygous mutation in a Han-Chinese family with GNE myopathy.

Authors:  Yuan Wu; Lamei Yuan; Yi Guo; Anjie Lu; Wen Zheng; Hongbo Xu; Yan Yang; Pengzhi Hu; Shaojuan Gu; Bingqi Wang; Hao Deng
Journal:  J Cell Mol Med       Date:  2018-08-29       Impact factor: 5.310

3.  Childhood onset limb-girdle muscular dystrophies in the Aegean part of Turkey.

Authors:  Uluç Yiş; Gülden Diniz; Filiz Hazan; Hülya Sevcan Daimagüler; Bahar Toklu Baysal; Figen Baydan; Gülçin Akinci; Aycan Ünalp; Gül Aktan; Erhan Bayram; Semra Hiz; Cem Paketçi; Derya Okur; Erdener Özer; Ayça Ersen Danyeli; Muzaffer Polat; Gökhan Uyanik; Sebahattin Çirak
Journal:  Acta Myol       Date:  2018-09-01

4.  COL1A2 p.Gly1066Val variant identified in a Han Chinese family with osteogenesis imperfecta type I.

Authors:  Mingyuan Wang; Yi Guo; Pengfei Rong; Hongbo Xu; Lina Gong; Hao Deng; Lamei Yuan
Journal:  Mol Genet Genomic Med       Date:  2019-03-04       Impact factor: 2.183

5.  A Novel Nonsense Mutation in FERMT3 Causes LAD-III in a Pakistani Family.

Authors:  Saba Shahid; Samreen Zaidi; Shariq Ahmed; Saima Siddiqui; Aiysha Abid; Shabbir Malik; Tahir Shamsi
Journal:  Front Genet       Date:  2019-04-24       Impact factor: 4.599

6.  Clinical long-time course, novel mutations and genotype-phenotype correlation in a cohort of 27 families with POMT1-related disorders.

Authors:  Tobias Geis; Tanja Rödl; Haluk Topaloğlu; Burcu Balci-Hayta; Sophie Hinreiner; Wolfgang Müller-Felber; Benedikt Schoser; Yasmin Mehraein; Angela Hübner; Birgit Zirn; Markus Hoopmann; Heiko Reutter; David Mowat; Gerhard Schuierer; Ulrike Schara; Ute Hehr; Heike Kölbel
Journal:  Orphanet J Rare Dis       Date:  2019-07-16       Impact factor: 4.123

7.  Identification of a novel EVC variant in a Han-Chinese family with Ellis-van Creveld syndrome.

Authors:  Xiangjun Huang; Yi Guo; Hongbo Xu; Zhijian Yang; Xiong Deng; Hao Deng; Lamei Yuan
Journal:  Mol Genet Genomic Med       Date:  2019-07-23       Impact factor: 2.183

8.  Digenic Variants in the TTN and TRAPPC11 Genes Co-segregating With a Limb-Girdle Muscular Dystrophy in a Han Chinese Family.

Authors:  Qian Chen; Wen Zheng; Hongbo Xu; Yan Yang; Zhi Song; Lamei Yuan; Hao Deng
Journal:  Front Neurosci       Date:  2021-03-04       Impact factor: 4.677

9.  Identification of a novel RPGRIP1 mutation in an Iranian family with leber congenital amaurosis by exome sequencing.

Authors:  Saber Imani; Jingliang Cheng; Abdolkarim Mobasher-Jannat; Chunli Wei; Shangyi Fu; Lisha Yang; Khosrow Jadidi; Mohammad Hossein Khosravi; Saman Mohazzab-Torabi; Marzieh Dehghan Shasaltaneh; Yumei Li; Rui Chen; Junjiang Fu
Journal:  J Cell Mol Med       Date:  2017-11-29       Impact factor: 5.310

10.  A novel, homozygous nonsense variant of the CDHR1 gene in a Chinese family causes autosomal recessive retinal dystrophy by NGS-based genetic diagnosis.

Authors:  Jiewen Fu; Lu Ma; Jingliang Cheng; Lisha Yang; Chunli Wei; Shangyi Fu; Hongbin Lv; Rui Chen; Junjiang Fu
Journal:  J Cell Mol Med       Date:  2018-08-30       Impact factor: 5.310

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.