Literature DB >> 28123992

Sodium dithionite-enhanced quality of radix scutellariae through modification of secondary metabolism.

Guo Huimin1, Fu Xiaoying1, Du Hongwei1, Cong Wei1, Meng Xiangcai1.   

Abstract

INTRODUCTION: The quality of radix scutellariae is particularly associated with environmental stresses, but detailed mechanisms remained unclear. Plant under unfavorable situation generates redundant reactive oxygen species (ROS), and ROS can modify the secondary metabolism. The varied quality of radix scutellariae could be explained by ROS.
MATERIALS AND METHODS: .004, 0.4, and 40 μmol/L of sodium dithionite (Na2S2O4), a material producing ROS, were applied to Scutellaria baicalensis to mimic unfavorable situation. The relationship between ROS, antioxidant enzymes activity, and secondary metabolite was investigated.
RESULTS: ROS level fails to rise due to both the antioxidase and the secondary metabolites. The activities of both superoxide dismutase and catalase in the roots of S. baicalensis showed a moderately improvement, meanwhile the phenylalanine ammonia lyase was strongly expressed, and the biosynthesis of flavonoids was heavily elevated. Although the glycosides such as baicalin and wogonoside changed little, the aglycones with the highest effective, such as baicalein and wogonin, were increased by approximately 50%-100%.
CONCLUSION: This is very valuable in insight into the stress physiology and provides a strong tool to enhance the quality of radix scutellariae.

Entities:  

Keywords:  Antioxidase; Scutellaria baicalensis; flavonoids; reactive oxygen species; secondary metabolite

Year:  2016        PMID: 28123992      PMCID: PMC5204254          DOI: 10.4103/2230-973X.195932

Source DB:  PubMed          Journal:  Int J Pharm Investig        ISSN: 2230-9713


INTRODUCTION

The root of Scutellaria baicalensis Georgi is a widely popular herbal medicine in Asia; its main active constituents are flavonoids include baicalin, wogonoside, baicalein, and wogonin.[1] The flavonoids have been shown to be correlated to circumstance, its content changes between various conditions, even has a very fine daily periodicity oscillation.[2] The use of herbal medicine has a history of several thousand years. About 1200 years ago, it was realized that the qualities varied according to producing regions with specific environmental stress as Tridax procumbens does.[3] The Chinese Government promulgated “Good Agriculture Practice for Chinese Crude Drugs” to control various factors affecting the production quality of medicinal plant materials and further to ensure that traditional Chinese medicine herbs are authentic, safe, effective, and consistent in quality.[4] Besides China, many countries have taken a series of standardized measures concerning quality control of the production of raw materials for natural medicines, but all these pay attention to production procedure, not to specific active ingredient relevant to the effect.[5] Research has so far proved that intense light and drought are responsible for the quality of radix scutellariae, but detailed mechanisms remained unclear.[26] The plant cannot search for suitable circumstance by moving and therefore often face various adversities such as intense light, drought which do great harm to the plant. The nature of damage derives from the production of reactive oxygen species (ROS).[7] To avoid or alleviate the damage, an exceptional metabolic mechanism, secondary metabolism, was created and hence the environmental stress, ROS, and secondary metabolism are intimately connected together. There are many types of ROS, the ROS first generated is O2− in plant, then it is dismutated to H2O2 by superoxide dismutase (SOD).[7] Sodium dithionite (Na2S2O4) is a substance which can generates O2−, it has the potential to mimic natural biological process and lead to the increased the production of secondary metabolites. The secondary metabolites of plant possess various pharmacological activities, usually are basic to treating various disease.[8] Thus, it is probable that Na2S2O4 be applied to enhance the quality of radix scutellariae.

MATERIALS AND METHODS

Plant material

S. baicalensis was used as target, identified by Prof. Meng Xiangcai, cultivated for 2 years, at the medicinal garden of the Heilong University of Chinese Medicine. It was divided equally into three parts on September 20, 2015, each parts were saturated with Na2S2O4 of 0.004, 0.4, and 40 μmol/L at the 0 and 1st day separately. The fresh roots of 10 individual plants were collected separately at the 0~4 day, discarded xylem. 1.0 g sample comprising approximately 0.1 g of every plant was refrigerated at −80 for determination of H2O2. Similarly, 1.0 g ×3 samples were used for SOD, catalase (CAT), and polyphenol oxidase (PPO), 0.1 g for phenylalanine ammonia lyase (PAL) gene expression. The rest of fresh roots was dried at 55, then pulverized for determination of baicalin, wogonoside, baicalein, and wogonin. The above-specified samples were three replications.

Determination of H2O2

H2O2 were determinated with Plant H2O2 ELISA Kit (Purchased from Shanghai Yu Ping Biotechnology Limited Company, Made in the USA).

Determination of antioxidase activities

SOD activity (U), assayed based on the reduction of Nitroblue tetrazolium (NBT), was defined as the activity of enzyme that caused 50% of inhibition of NBT reduction.[9] CAT activity, monitoring the decrease of H2O2 at 240 nm for 1 min at 25°C, was calculated as the activity of enzyme that caused a reduction in absorbance at 240 nm of 0.01/min.[10]

Determination of phenylalanine ammonia lyase gene expression

Targeted RNAs were extracted with the plant polyphenols polysaccharide kit (ABigen Corporation, Beijing, China). Reverse transcription was performed using the HiFi-MMLV cDNA first-strand synthesis kit. Real-time polymerase chain reaction (PCR) was carried out to detect gene expression. The target PAL fragment of S. baicalensis was 139 bp in length. The forward and reverse primers were 5’- TGACCTCGTGCCCCTGTCCTAC-3’ and 5’- CAGCTCGAAGAACCCTCCACTA ACT-3’, respectively. The reaction system contained 10 μl ×2 Ultra SYBR mixture, 0.4 μl (10 μM forward primer, 0.4 μl (10 μM) reverse primer, 2 μl template, and 6.8 μl dH2 O. The program of real-time PCR was as follows: 95°C for 10 min, followed by 45 cycles of 95°C for 15 s, and 60°C for 60 s. ABI 7500 Applied Biosystems (American) was used for real-time PCR, and the 2−∆∆CT method was used for data analysis.

Determination of baicalin, baicalein, wogonoside, and wogonin

0.25 g of the root power (d <0.1 mm) was put in a 25 ml volumetric flask, then 70% methanol was added to extract the total compounds under ultrasonic condition for 30 min; finally, the supernatant was filtered with a 0.22 μM microporous filter for ultra performance liquid chromatography analysis. The experimental samples were analyzed by water ACQUITY high-performance liquid chromatography. The trial samples are based on a BEH C18 column (2.1 mm × 50 mm, 1.7 μm). The mobile phases were composed of (A) acetonitrile with 0.1% formic acid (B) H2 O with 0.1% formic acid. The gradient program as initial 25% A for 5~15 min, and 25% A → 54% A between 15 and 22 min, then kept 54% A from 22 to 23 min, 54% A → 25% A for 23~25 min, and 25% A. The flow rate was set at 1 ml/min, and the column temperature was set at 30°C. The detection wavelengths of baicalin, wogonoside, baicalein, and wogonin were 277, 279, 274, and 275 nm, respectively.

Statistical analysis

All the experimental data are expressed as mean values ± standard deviation.

RESULTS

S. baicalensis were treated with 0.004, 0.4, and 40 μmol/L of Na2S2O4, H2O2 contents in roots reduced by approximately 50% at the 1st day, from 21 to 11 μmol/ng, then gradually increased. The various dosage of Na2S2O4 exhibited similar effect [Figure 1].
Figure 1

H2O2 contents in the roots of Scutellaria baicalensis. H2O2 contents reduced by approximately 50% at the 1st day after treated, then gradually increased, indicating that redundant reactive oxygen species may be swiftly eliminated by either antioxidases or flavonoids

H2O2 contents in the roots of Scutellaria baicalensis. H2O2 contents reduced by approximately 50% at the 1st day after treated, then gradually increased, indicating that redundant reactive oxygen species may be swiftly eliminated by either antioxidases or flavonoids SOD activities changed little for the 0.004–0.4 μmol/L of Na2S2O4, slightly increased for the 40 μmol/L. All CAT activities were raised at the 1st day, then gradually decreased, which exhibited a tendency to be running counter to the H2O2 [Figure 2].
Figure 2

Activities of antioxidases in the roots of Scutellaria baicalensis. Superoxide dismutase activities changed little for the 0.004–0.4 μmol/L, slightly for the 40 μmol/L. Catalase activities were raised at the 1st day, then gradually decreased. The antioxidases maybe play a role for eliminating reactive oxygen species.

Activities of antioxidases in the roots of Scutellaria baicalensis. Superoxide dismutase activities changed little for the 0.004–0.4 μmol/L, slightly for the 40 μmol/L. Catalase activities were raised at the 1st day, then gradually decreased. The antioxidases maybe play a role for eliminating reactive oxygen species. The application of Na2S2O4 increased PAL gene expression slightly for the 0.004 μmol/L, remarkably for the 0.4 and the 40 μmol/L, furthermore last a long time [Figure 3].
Figure 3

The expression of phenylalanine ammonia lyase in the roots of Scutellaria baicalensis. The application of sodium dithionite increased phenylalanine ammonia lyase gene expression slightly for the 0.004 μmol/L, remarkably for the 0.4 and the 40 μmol/L, and led to enhanced biosynthesis of flavonoids

The expression of phenylalanine ammonia lyase in the roots of Scutellaria baicalensis. The application of sodium dithionite increased phenylalanine ammonia lyase gene expression slightly for the 0.004 μmol/L, remarkably for the 0.4 and the 40 μmol/L, and led to enhanced biosynthesis of flavonoids The effects of Na2S2O4 on flavonoids may be classified into two sets: flavone glycosides and aglucones. The glycosides changed little at different stages, but the aglucones were remarkably elevated at the 1st day, then decreased. The baicalein increased from 0.1% to 0.28%, the wogonin from 0.045% to 0.09% [Figure 4]. Initially, PPO activities were raised, then, gradually decreased [Figure 5]. It accords with that of aglucon.
Figure 4

Biosynthesis of flavonoids in the roots of Scutellaria baicalensis. The glycosides with less activitie changed little at different stages, but the aglucones with more activities were remarkably elevated at the 1st day, then decreased to prevent reactive oxygen species reducing too much

Figure 5

Activities of polyphenol oxidase in the roots of Scutellaria baicalensis. Initially, polyphenol oxidase activities were raised, then gradually decreased. It accords with that of aglucon

Biosynthesis of flavonoids in the roots of Scutellaria baicalensis. The glycosides with less activitie changed little at different stages, but the aglucones with more activities were remarkably elevated at the 1st day, then decreased to prevent reactive oxygen species reducing too much Activities of polyphenol oxidase in the roots of Scutellaria baicalensis. Initially, polyphenol oxidase activities were raised, then gradually decreased. It accords with that of aglucon Except for the PAL, above all physiological parameters have a tendency to recover its original state.

DISCUSSION

H2O2 contents in roots of Scutellaria baicalensis plants treated with sodium dithionite

The ROS first generated in plant is O2−. It is easily dismutated to relatively stable and membrane-permeable H2O2 either nonenzymatically or by SOD catalyzed the reaction, then H2O2 is converted to innoxious H2 O by CAT, guaiacol peroxidase (POD), or ascorbate peroxidase (APX), and by this way, much of severe damage can be relieved.[7] As a logical consequence, Na2S2O4 must lead to excess production of H2O2. However, contrary to the anticipation, the H2O2 contents decreased by approximately 50% at the 1st day after 0.004–40 μmol/L Na2S2O4 treated, then a gradual increase started [Figure 1]. Maybe it is because that a quick efficient elimination exists for H2O2.

Activities of superoxide dismutase and catalase in roots of Scutellaria baicalensis plants-treated sodium dithionite

The antioxidant enzymes are widely found in living creature, either plant or animal. The enzymic components of the antioxidative defense system include SOD, CAT, and APX and so on. SOD is a major antioxidant enzyme, increased activity of SOD is often correlated with increased tolerance of the plant against environmental stresses.[7] There are many antioxidant constituents, such as CAT, POD, AsA - GSH cycle, and APX, responsible for quenching H2O2. Among them, CATs are unique as they do not require cellular reducing equivalent, have a very fast turnover rate and thus are critical for maintaining the redox balance during the oxidative stress.[11] Therefore, cell damage is subject to inhibition by both SOD and CAT.[7] At the 1st day after the S. baicalensis plants were treated with Na2S2O4, the activities of both SOD and CAT in roots had grown somewhat [Figure 2], which presented the same effects as many stress conditions did. Increased activities of both SOD and CAT contributed to abating cell damage, which indicated that antioxidases maybe play a role for eliminating ROS. Because increase of both SOD and CAT, especially the SOD, change a little, it seems impossible to result in major changes in H2O2 content. Here, we must mention that the least increased SOD activities of 0.4–40 μmol/L Na2S2O4 may be due to the heavy use of Na2S2O4.

Biosynthesis of flavonoids in roots of Scutellaria baicalensis plants treated with sodium dithionite

ROS have double effects. At high concentration ROS causes damage to biomolecules, whereas at moderate concentration function as the second messenger in intracellular signaling cascades that mediate several responses in plant cells.[7] O2− /H2O2 generated in chloroplast have been proved to be responsible for triggering signaling pathways that ultimately induce changes in gene expression.[12] In this study, the expression of PAL, a rate-limited enzyme responsible for the synthesis of flavonoids, was markedly upregulated [Figure 3], led to increased production of baicalin, wogonoside, baicalein, and wogonin [Figure 4]. Flavonoids play a crucial role in protecting cells from oxidative damage, they not only directly involve in quenching ROS, but also chelate transition metal ion Fe2+ to reduce Fenton reaction.[1314] Fenton reaction convert O2− and H2O2 to the most reactive •OH and cause great damage to biomolecules, even death. The previous research proved that under the stress, the flavonoids contribute more significantly than the antioxidases.[15] In our study, the PALs were highly expressed, the antioxidases slightly increased, flavonoids must be do excellent service in eliminating ROS. The ROS generated by Na2S2O4 have a capacity for the modification of secondary metabolism. The baicalin and wogonoside change slightly, but the baicalein and wogonin had great changes, roughly doubled. The fact that the differences exist seems to be due to three reasons. First, the bioavailability is a crucial factor for better effect.[16] Both baicalein and wogonin are aglucon, with the greatest fat-solubility. The fat-soluble analog usually was the greatest effective, it may be related to fact that the fat-solubility can diffuse through aquaporins in the membranes and over larger distances within the cell.[17] Second, the baicalein and wogonin possess two hydroxy groups, with more effective than its counterparts. It has proved that the absorptivity of baicalein is more than 7 times that of the baicalin, the antibacterial activity is 2~5 times as that of the other flavonoids, the activity inhibiting interleukin-1β converting enzyme is 1~3 times as the other related substances.[18] The baicalein, not the other flavone, has been shown to be high level in famous region drug (mean high-quality medicinal materials), even as one of the useful indicators to adopt for the quality control of S. baicalensis.[1219] Which reminding us that baicalein plays a crucial role in antioxidation.[20] Third, less aglucon and more glycoside present in cells of S. baicalensis, once the environmental stresses befall, the conversion of less active glycoside into more active aglucon immediately ensue. Moreover, the biosynthesis of aglucon precedes glycoside, it is necessary to keep aglucon high level under stress from Na2S2O4. In a natural state, more flavonoid glycosides and less aglycones exist in normal cell, even considered baicalin as a state baicalein stored.[21] Therefore, aglycones are the most major physiological parameters to assess the quality of radix scutellariae. With increased antioxidase activities and flavonoids, redundant ROS were gradually eliminated, followed by a surplus of flavonoids which, in turn, would make ROS keep too low and disrupt the cellular homeostasis in such a condition. Along with increased flavonoids, the activities of PPO also were gradually raised to eliminate redundant baicalein and wogonin [Figure 5], Therefore, the baicalein and wogonin begin to decline after the 1st day.

CONCLUSION

ROS are produced in plants under disadvantaged conditions. Na2S2O4 can act as an unfavorable factor to generate O2−, which is then converted into H2O2, •OH, and other ROS. Based on this theory, organisms treated with Na2S2O4 can be used as basic models for studying environment stress. Furthermore, Na2S2O4 has strong reducing ability, easily transforms into noxious NaHSO4, and it is widely applied as the dechlorination agents in tap water, beer bottle disinfectant, bleaching agent, and food leavening agent. The application of Na2S2O4 to S. baicalensis is also reasonable and practicable to enhance the quality of radix scutellariae.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.
  16 in total

Review 1.  GAP production of TCM herbs in China.

Authors:  Bengang Zhang; Yong Peng; Zhao Zhang; Haitao Liu; Yaodong Qi; Shuang Liu; Peigen Xiao
Journal:  Planta Med       Date:  2010-11-12       Impact factor: 3.352

2.  [Studies on the absorption kinetics of baicalin and baicalein in rats' stomachs and intestines].

Authors:  Tai-ming Liu; Xue-hua Jiang
Journal:  Zhongguo Zhong Yao Za Zhi       Date:  2006-06

3.  Flavone-catalyzed apoptosis in Scutellaria baicalensis.

Authors:  Motosuke Hirunuma; Yoshinari Shoyama; Kaori Sasaki; Seiichi Sakamoto; Futoshi Taura; Yukihiro Shoyama; Hiroyuki Tanaka; Satoshi Morimoto
Journal:  Phytochemistry       Date:  2011-03-04       Impact factor: 4.072

4.  Effects of stabilizing agents on the development of myricetin nanosuspension and its characterization: an in vitro and in vivo evaluation.

Authors:  Chao Hong; Yang Dang; Guobei Lin; Yashu Yao; Guowen Li; Guang Ji; Hongyi Shen; Yan Xie
Journal:  Int J Pharm       Date:  2014-10-18       Impact factor: 5.875

5.  Superoxide Dismutases: II. Purification and Quantitative Relationship with Water-soluble Protein in Seedlings.

Authors:  C N Giannopolitis; S K Ries
Journal:  Plant Physiol       Date:  1977-02       Impact factor: 8.340

Review 6.  Redox- and Reactive Oxygen Species-Dependent Signaling into and out of the Photosynthesizing Chloroplast.

Authors:  Karl-Josef Dietz; Ismail Turkan; Anja Krieger-Liszkay
Journal:  Plant Physiol       Date:  2016-06-02       Impact factor: 8.340

7.  [Effect of environmental factors on photosynthetic physiology and flavonoid constituent of Scutellaria baicalensis].

Authors:  Yong-Gang Zhang; Mei Han; Xue Jiang; Sheng-Nan Zhao; Li-Min Yang
Journal:  Zhongguo Zhong Yao Za Zhi       Date:  2014-05

8.  Solubility enhancement studies on lurasidone hydrochloride using mixed hydrotropy.

Authors:  Jyotsana R Madan; Kiran T Pawar; Kamal Dua
Journal:  Int J Pharm Investig       Date:  2015 Apr-Jun

9.  A specialized flavone biosynthetic pathway has evolved in the medicinal plant, Scutellaria baicalensis.

Authors:  Qing Zhao; Yang Zhang; Gang Wang; Lionel Hill; Jing-Ke Weng; Xiao-Ya Chen; Hongwei Xue; Cathie Martin
Journal:  Sci Adv       Date:  2016-04-08       Impact factor: 14.136

10.  H2O2 Improves Quality of Radix scutellariae Through Anti-oxidant Effect.

Authors:  Song Qi; Cao Wu-Lin; Jiang Hua; Zhang Ai-Hua; Meng Xiang-Cai
Journal:  Pharmacogn Mag       Date:  2016 Jan-Mar       Impact factor: 1.085

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.