Literature DB >> 28123702

Palm dermatoglyphs and interleukin-4 receptor polymorphisms in asthma.

Lixin Sun1, Weilin Xue2, Jun Li3, Zhaoshan Zhou2, Wei Han3.   

Abstract

Single nucleotide polymorphisms (SNPs) in the interleukin-4 receptor (IL-4R) gene have been identified as having a close association with asthma severity in different populations. In our previous studies, a close association between asthma and a distinctive palm dermatoglyphic pattern was observed; however, the clinical implication and underlying genetic mechanisms of this particular palm pattern have not been clarified. Whether this particular palm pattern is associated with asthma severity and IL-4R SNPs was assessed in the present study. A case cohort study was conducted in 400 patients with allergic asthma and in 200 healthy controls. DNA was extracted from peripheral blood leukocytes for analysis of 11 IL-4R SNPs associated with asthma via polymerase chain reaction. There are two SNPs, rs1805012 and rs3024608, which are associated with asthma (rs1805012, dominant model; P=0.03 and rs3024608, codominant model; P=0.029), and two SNPs, rs1805010 and rs3024608, which are associated with the positive palm pattern (rs1805010, log-additive model; P=0.031 and rs3024608, codominant model; P=0.016). The SNP of rs3024608 is associated with asthma and the positive palm pattern. Thus, genetic variation in IL-4R may be associated with the development of asthma and the distinctive palm pattern; however, further investigations are required to identify the connection between asthma and palm dermatoglyphic patterns.

Entities:  

Keywords:  asthma; dermatoglyphics; interleukin; palm; polymorphisms

Year:  2016        PMID: 28123702      PMCID: PMC5244800          DOI: 10.3892/br.2016.803

Source DB:  PubMed          Journal:  Biomed Rep        ISSN: 2049-9434


Introduction

Since last century, the prevalence of asthma has increased worldwide, which has resulted in substantial morbidity and healthcare costs (1). Patients with different phenotypes have different outcomes and prognoses. The most effective treatment strategy to effectively control asthma, as suggested by the Global Initiative for Asthma (GINA), is to implement personalized treatment according to the different phenotypes of asthma. However, it is difficult to correctly and rapidly identify the phenotype using simple clinical features, without complicated or invasive examinations. Genetic susceptibility is critical in the development of asthma; therefore, it is often used to identify the phenotypes of asthma. Interleukin-4 receptor (IL-4R) is important in regulating T helper (Th)2 cell development and immunoglobulin E (IgE) production via its response to IL-4 or IL-13 (2). The loci of IL-4R, located on genomic region 16p12, are linked to asthma phenotypes with increased airway mast cells and IgE (+) cells. Numerous single nucleotide polymorphisms (SNPs) in IL-4R gene have been associated with a phenotype of severe asthma (3,4). However, sequencing the IL-4R gene for every patient is not considered a feasible method of differentiating the phenotypes of asthma. In the past two decades, the value of palm dermatoglyphic or fingerprint patterns has been described in the detection of bronchial asthma by different studies; however, the underlying mechanisms have not been clarified (5–8). In our previous study, a distinctive palm pattern was identified, which was characterized by deep grids in the thenar area that facilitated the diagnosis of asthma, with a close association to two a disintegrin and metalloprotein-33 (ADAM33) gene polymorphisms (9). The palm pattern appears to be a potential biomarker for endotypes of asthma, although the association between distinctive palm patterns and other SNPs associated with asthma have yet to be investigated. Thus, in the present study, 11 SNPs of the IL-4R gene were analyzed in a population of East Chinese Han adults to clarify the link between a particular palm pattern and IL-4R gene polymorphisms.

Materials and methods

Subjects

A total of 400 asthma patients were recruited from the pulmonary clinics of two teaching hospitals, Qingdao Municipal Hospital (Qingdao, China) and Qingdao Haici Hospital (Qingdao, China) from January 2011 to January 2012 successively. Asthma was diagnosed and evaluated based on symptoms and on spirometry assessments by the criteria of the Global Initiative for Asthma (version: 2010 update) (10). Two-hundred healthy adults were recruited successively from the Health check-up centers of Qingdao Municipal Hospital and Qingdao Haici Hospital to serve as healthy controls. All control subjects were asymptomatic for asthma and devoid of any atopic or pulmonary diseases. Pregnant or lactating female subjects were excluded. The age range for all of the study subjects was 18–70 years old. Smoking status and education history data were collected for all subjects. The study was performed in accordance with the Helsinki Declaration and approved by the Ethics Committee of Qingdao Municipal Hospital and Qingdao Haici Hospital. In addition, all subjects provided written informed consent prior to the study.

Dermatoglyphic palm patterns

The palms of each subject were observed, after washing clean with soap and water, by two researchers under natural light. The palm patterns were determined by the dermatoglyphic variables in the thenar area, including number and shape of the ridges, as described in our previous study (9). A positive palm pattern typically exhibited an increased ridge count (≥10) and deep grid patterns in the thenar area, while a negative palm pattern demonstrated normal ridge count (<10) and light grid patterns in the thenar area. All subjects were sub-categorized into two groups; a positive palm pattern group and a negative palm pattern group according to the above standard.

Polymorphism genotyping

Whole blood (10 ml) was taken in lithium heparin-coated test tubes from each subject and immediately centrifuged at 1,600 × g. Buffy coat (peripheral white cells) was separated and stored at −70°C on the day of enrollment by a nurse. Genomic DNA was isolated from the peripheral blood leukocytes using a DNA extraction kit (Tiangen Biotech Co., Ltd., Beijing, China). The DNA was genotyped for the SNPs of the IL-4R gene at the Center for Human Genetics Research, Shanghai Genesky Bio-Tech Co., Ltd. (Shangai, China). Three SNPs of the IL-4R gene, rs1805010, rs1805012 and rs1801275, were selected according to the published literatures regarding SNP associations with asthma (11,12). Eight tag SNPs, rs3024608, rs1110470, rs3024685, rs3024619, rs2057768, rs3024585, rs12925861, and rs3024613, were then selected according to the frequency information for Chinese populations from two public databases the International HapMap Project (http://www.hapmap.org/) and the NCBI database (http://www.ncbi.nlm.nih.gov/). The PCR primers were designed by the authors and are presented in Table I.
Table I.

Oligonucleotide primers used for resequencing interleukin-4 receptor.

Oligonucleotide primers

SNPForwardReverse
rs1805010CAGCCAGCCTACAGGTGACCACTGACCACGTCATCCATGAGCA
rs1805012GGAGAGGAGAATGGGGGCTTTTACTTGGCTCCAGGTGGAGAG
rs1801275AGATCCTCCGCCGAAATGTCCTACCCTGCTCCACCGCATGTA
rs3024608CAGCCAGGAAGTGGTAGTAGGGACTTCGTTAGCTGACCCCACCATGT
rs1110470AGCCTTCACTGGCTCCCCACTGGAGAAGGACTGGCTGGGATG
rs3024685ATGCCCTAACCTCCCAGGAATGTACCCCAGCTCCCTCTCCTTTG
rs3024619AGAACTACAGAGGAAACTAATTGTATTGAAATGTCCTGTCCCCAGCAAAACAAAA
rs2057768CCCTAGATGGGGGAACAGAGGTTGCATTGTTCTCGGGTGCAAGAG
rs3024585CCACCTTCAGAGTCCAAAGATATGTTATTTCATGAGGGAAGAGCCTGCCTAAA
rs12925861AAGCTGCCCACTGCTTAGAGGATCATGGGTCTTAAATCCAGCACTCA
rs3024613CAGACACTTCCCCTGGCTGAGTCAGGGAGGGAAACCACCTACAA

SNP, single nucleotide polymorphism.

Polymerase chain reaction (PCR) amplification of the corresponding genomic region surrounding each SNP locus was performed in a Takara PCR thermal cycler (Takara TP600; Takara Biotechnology Co., Ltd., Dalian, China). The reaction was performed in a final volume of 10 µl, including 3.0 mM Mg2+, 0.3 mM dNTP, 1 unit HotStarTaq polymerase (Qiagen Inc., Valencia, CA, USA), 1 µl of each primer, and 1 µl (10 ng) of genomic DNA. The cycling conditions were as follows: 1 Cycle at 95°C for 2 min, 11 cycles at 94°C for 20 sec, 65–0.5°C for 40 sec and 72°C for 1.5 min, and 24 cycles at 94°C for 20 sec, 59°C for 30 sec and 72°C for 1.5 min, and a final extension at 72°C for 2 min. The PCR products were purified using a PCR purification kit containing 1unit Shrimp Alkaline Phosphatase (SAP) and 1 unit Exonuclease I (Qiagen GmbH, Hilden, Germany) and were used as DNA templates for the cycle sequencing. Direct DNA sequencing was performed using 5 µl SNaPshot Multiplex kit (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in 10-µl volumes containing 2 µl primer and 2 µl DNA template, and were subjected to 1 cycle at 96°C for 1 min, 28 cycles of denaturation at 96°C for 10 sec, annealing at 52°C for 5 sec, and extension at 60°C for 30 sec. Sequencing products were purified using 1 unit SAP at 37°C for 1 h and annealing at 75°C for 15 min. All SNPs were detected with an ABI 3130xl, and the data were analyzed with GeneMapper 4.0 (Applied Biosystems; Thermo Fisher Scientific, Inc.). The association analysis between a single SNP and phenotype were conducted under five different genetic models (inheritance patterns) as follows: Codominant, dominant, recessive, overdominant and log-additive.

Statistical analysis

The differences in age, gender, body mass index (BMI), smoking status and education history between patients and control subjects were compared using the χ2 test or a t-test accordingly. The correlation between palm patterns and asthma severity was evaluated by Spearman analysis. The odds ratios (ORs) and 95% confidence interval (CI) of asthma risk of individuals with various genetic polymorphisms were calculated using logistic regression analysis adjusting for differences in gender. Hardy-Weinberg equilibrium and linkage disequilibrium was estimated using SNPAnalyzer version 2.0 (Istech Corp., Korea; http://istech21.com/). Statistical analyses were conducted using the SPSS for Windows version 17.5, statistical package (SPSS, Inc, Chicago, IL, USA) and P<0.05 was considered to indicate a statistically significant difference.

Results

Demographics

The demographics of the asthma group and the control group are presented in Table II. No significant differences were identified between the age, gender, BMI, smoking status, and education history of the asthma and control groups (all P>0.05).
Table II.

Demographics of asthma patients and healthy control subjects (presented as means ± standard deviation).

VariableAsthma (n=400)Control (n=200)tχ2P-value
Age, years  40.11±14.54  45.42±16.280.35>0.05
Body mass index, kg/m224.78±3.2224.51±3.400.09>0.05
Gender1.98>0.05
  Male172  74
  Female228126
Smoking0.50>0.05
  Smoker[a]115  52
  Non-smoker285148
Education, years15.24±8.1315.89±8.810.08>0.05

Current and previous smokers.

Polymorphisms with asthma

All genotype frequencies were consistent with Hardy-Weinberg equilibrium (P>0.05). The genotype distributions of all 11 IL-4R SNPs in the asthma and control groups are listed in Table III. There are two SNPs, rs1805012 and rs3024608, which are associated with asthma in different models as follows: rs1805012, dominant model (P=0.03) and rs3024608, codominant model (P=0.029).
Table III.

Genotype of interleukin-4 receptor SNPs in the asthma and control groups (adjusted for gender and age).

SNPGenotypeControl, n (%)Asthma, n (%)Odds ratio (95% CI)P-value
rs2057768T/T63 (31.50115 (28.97)10.96
C/T93 (46.50)195 (49.11)1.06 (0.68–1.65)
C/C44 (22.00)  87 (21.91)1.07 (0.62–1.84)
rs1110470G/G85 (42.50)161 (40.25)10.59
G/A93 (46.50)183 (45.75)0.97 (0.65–1.47)
A/A22 (11.00)  56 (14.00)1.34 (0.71–2.50)
rs12925861A/A58 (29.00)111 (27.80)10.94
A/T95 (47.50)201 (50.20)1.03 (0.66–1.62)
T/T47 (23.50)  88 (22,00)0.95 (0.55–1.62)
rs1805010G/G54 (27.14)112 (28.14)10.75
G/A99 (49.75)201 (50.50)0.88 (0.56–1.38)
A/A46 (23.12)  85 (21.36)0.82 (0.48–1.41)
rs3024585A/A88 (44.22)173 (43.57)10.78
G/A89 (44.72)182 (45.84)0.91 (0.60–1.36)
G/G23 (11.56)  42 (10.57)0.81 (0.43–1.53)

SNPGenotypeControl, n (%)+Asthma, n (%)Odds ratio (95% CI)P-value

rs3024608C/C161 (80.50)340 (85.56)10.03
C/G39 (19.50)53 (13.35)0.56 (0.33–0.94)
G/G0 (0)4 (1.01)NA (0.00-NA)
rs3024613C/C56 (28.28)99 (25.00)10.39
C/T95 (47.98)208 (52.53)1.37 (0.86–2.18)
T/T47 (23.73)89 (22.47)1.15 (0.67–1.99)
rs3024619G/G68 (34.00)122 (30.73)10.51
G/A95 (47.50)205 (51.64)1.26 (0.82–1.95)
A/A37 (18.50)70 (17.63)1.02 (0.58–1.79)
rs1805012T/T169 (84.50)361 (90.93)10.03
C/T31 (15.50)35 (8.82)0.50 (0.27–0.90)
C/C0 (0)1 (0.25)NA (0.00-NA)
rs1801275A/A141 (70.50)281 (70.78)10.47
G/A51 (25.50)108 (27.20)0.97 (0.62–1.51)
G/G8 (4.00)8 (2.05)0.48 (0.15–1.53)
rs3024685C/C67 (33.50)133 (33.25)10.87
C/T97 (48.50)194 (48.50)0.90 (0.59–1.38)
T/T36 (18.00)73 (18.25)0.90 (0.51–1.58)

SNP, single nucleotide polymorphism; CI, confidence interval.

Polymorphisms with palm patterns

The genotype distribution of all 11 IL-4R SNPs in the negative and positive palm groups are presented in Table IV. Two SNPs, rs1805010 and rs3024608, were associated with the positive palm pattern in different models as follows: rs1805010, log-additive model (P=0.031) and rs3024608, codominant model (P=0.016). Notably, rs3024608 is associated with asthma and the positive palm pattern. The rs1805010, rs1805012 and rs3024608 with different genotypes are presented in Fig. 1.
Table IV.

Genotype of interleukin-4 receptor SNPs in the negative and positive palm pattern groups (adjusted for gender and age).

SNPGenotypeNegative palm, n (%)Positive palm, n (%)Odds ratio (95% CI)P-value
rs1805010G/G81 (25.55)85 (30.4)10.031
G/A157 (49.53)143 (51.1)0.79 (0.52–1.19)
A/A79 (24.92)52 (18.6)0.58 (0.35–0.95)
rs1805012T/T282 (88.68)248 (88.9)10.47
C/T36 (11.32)30 (10.8)1.10 (0.62–1.94)
C/C0 (0)1 (0.4)NA (0.00-NA)
rs1801275A/A228 (71.69)194 (69.53)10.42
G/A83 (26.10)76 (27.24)1.04 (0.70–1.55)
G/G7 (2.21)9 (3.23)2.15 (0.67–6.84)
rs3024608C/C264 (83.02)237 (84.95)10.02
C/G54 (16.93)38 (13.62)0.73 (0.44–1.19)
G/G0 (0)4 (1.43)NA (0.00-NA)
rs1110470G/G121 (37.93)125 (44.48)10.2
G/A155 (48.58)121 (43.06)0.71 (0.49–1.04)
A/A43 (13.48)35 (12.45)0.79 (0.46–1.38)
rs3024685C/C106 (33.22)94 (33.45)10.96
C/T154 (48.27)137 (48.75)0.97 (0.66–1.44)
T/T59 (18.50)50 (17.79)0.93 (0.56–1.54)
rs3024619G/G105 (33.02)85 (30.46)10.49
G/A161 (50.63)139 (49.82)1.10 (0.74–1.64)
A/A52 (16.45)55 (19.71)1.36 (0.82–2.28)
rs2057768T/T89 (27.99)89 (31.90)10.44
C/T153 (48.11)135 (48.38)0.85 (0.57–1.28)
C/C76 (23.90)55 (19.71)0.73 (0.44–1.19)
rs3024585A/A131 (41.19)130 (46.59)10.19
G/A150 (47.17)121 (43.37)0.74 (0.51–1.08)
G/G37 (11.64)28 (10.04)0.66 (0.37–1.19)
rs12925861A/A84 (26.33)85 (30.25)10.14
A/T153 (47.96)143 (50.89)0.88 (0.58–1.33)
T/T82 (25.71)53 (18.86)0.62 (0.37–1.01)
rs3024613C/C78 (24.68)77 (27.70)10.65
C/T163 (51.58)140 (50.36)0.86 (0.56–1.31)
T/T75 (23.73)61 (21.44)0.80 (0.48–1.32)

SNP, single nucleotide polymorphism; CI, confidence interval.

Figure 1.

Different genotypes of rs1805010, rs1805012 and rs3024608. (A) AA, GG and AG genotypes of rs1805010; (B) CC, TT and TC genotypes of rs1805012; (C) CC, GG and GC genotypes of rs3024608.

Discussion

In the present study, gene segments of 11 SNPs of the IL-4R gene were amplified to identify the genetic basis of the association between a distinctive palm dermatoglyphic pattern and asthma in a Chinese population. As the results of SNP studies are not always consistent in different populations, the present study evaluated the role of SNPs of IL-4R in asthma development in the Chinese population. Although three SNPs, rs1801275 (−1902G/A), rs1805012 (1291T/C) and rs1805010 (−223G/A) demonstrated associations with asthma in previous studies (11–13), only rs1805012 exhibited an association with asthma (dominant model; P=0.03) in the current study. To further investigate the effect of IL-4R SNPs in asthma, eight tag SNPs of the IL-4R region were investigated for an association with asthma, to the best of our knowledge, for the first time. Of these SNPs, two were associated with asthma in a different model: rs1805010, log-additive model (P=0.031) and rs3024608, codominant model (P=0.016). Thus, polymorphisms of the IL-4R gene may be the genetic basis of asthma in this particular population. Dermatoglyphs are formed in the 10th to 17th weeks of the embryological phase, when the neurologic and immunity systems are developing. Generally dermatoglyphs remain unchanged throughout an individual's life, except in cases of serious injuries that scar the dermis. Thus, a series of studies have identified the association of dermatoglyphic patterns with certain congenital defects or gene-associated diseases, such as Down's syndrome (14–17). However, few practical associations have been recognized in humans. Palm patterns are affected by many complex factors, for example age-associated changes, gender and ethnic differences. A distinctive palm pattern was identified in asthma patients using theories of Chinese Traditional Medicine (5). However, it is difficult to confirm the clinical significance of these dermatoglyph changes in clinical practice. As asthma is a disorder associated with multiple genetic factors, establishing the gene polymorphisms associated with asthma is considered to be a convictive method to elucidate the implications of the association between a distinctive palm pattern and asthma. In our previous study, two SNPs of ADAM33, rs44707 and rs2787094, were identified to be associated with a positive palm pattern (6). In the current study, of 11 analyzed SNPs of IL-4R, two SNPs were found to be associated with the distinctive palm pattern in different models (rs1805010: Log-additive model, P=0.031; rs3024608: Codominant model, P=0.016). Notably, rs3024608 was associated with the positive palm pattern and asthma in the same population; thus, IL-4R polymorphisms may be the genetic basis of the association of the distinctive palm pattern and asthma. Recently Chavarri-Guerra and Soto-Perez-de-Celis (14) described a 65-year-old woman with stage IV breast cancer, who lost her fingerprints following chemotherapy with capecitabine and bevacizumab (18). This indicated that dermatoglyphs may change as a condition of the disease (19,20). The clinical significance of dermatoglyphs requires further clarification using well-designed studies. In conclusion, the genetic variation in IL-4R may be the basis of the association between asthma and a distinctive palm pattern. Considering the genetic variant, further studies with a prospective design in an unselected population are required to validate the association between a distinctive palm pattern and asthma, in order that a distinctive palm pattern may be considered as a biomarker for asthma development or phenotypes (21).
  18 in total

Review 1.  T helper 2 (Th2) cell differentiation, type 2 innate lymphoid cell (ILC2) development and regulation of interleukin-4 (IL-4) and IL-13 production.

Authors:  Jinfang Zhu
Journal:  Cytokine       Date:  2015-06-01       Impact factor: 3.861

2.  Images in clinical medicine. Loss of fingerprints.

Authors:  Yanin Chavarri-Guerra; Enrique Soto-Perez-de-Celis
Journal:  N Engl J Med       Date:  2015-04-16       Impact factor: 91.245

3.  Attempted replication of 50 reported asthma risk genes identifies a SNP in RAD50 as associated with childhood atopic asthma.

Authors:  William Murk; Kyle Walsh; Ling-I Hsu; Linlu Zhao; Michael B Bracken; Andrew T Dewan
Journal:  Hum Hered       Date:  2011-07-06       Impact factor: 0.444

4.  Polymorphisms in the interleukin 4, interleukin 4 receptor and interleukin 13 genes and allergic phenotype: A case control study.

Authors:  Beata Narożna; Aleksandra Hoffmann; Paulina Sobkowiak; Natalia Schoneich; Anna Bręborowicz; Aleksandra Szczepankiewicz
Journal:  Adv Med Sci       Date:  2015-08-08       Impact factor: 3.287

5.  Do biometric parameters of the hand differentiate schizophrenia from other psychiatric disorders? A comparative evaluation using three mental health modules.

Authors:  Eyal Zvi Shamir; Anat Levy; Stanley Morris Cassan; Tova Lifshitz; Gaby Shefler; Ricardo Tarrasch
Journal:  Psychiatry Res       Date:  2015-06-27       Impact factor: 3.222

6.  Study of the fingertip pattern as a tool for the identification of the dermatoglyphic trait in bronchial asthma.

Authors:  Sandeep V Pakhale; Bharat S Borole; Megha A Doshi; Vijay P More
Journal:  J Clin Diagn Res       Date:  2012-10

7.  Dermatoglyphic patterns in cystic fibrosis children.

Authors:  Atefeh Ezzati; Fereshteh Batoei; Seyed-Ali Jafari; Mohammad-Ali Kiyani; Naser Mahdavi-Shahri; Hamid Ahanchian; Shahrzad Tehranian; Hamid-Reza Kianifar
Journal:  Iran J Pediatr       Date:  2014-09-12       Impact factor: 0.364

8.  The interaction of genetic variants and DNA methylation of the interleukin-4 receptor gene increase the risk of asthma at age 18 years.

Authors:  Nelís Soto-Ramírez; Syed Hasan Arshad; John W Holloway; Hongmei Zhang; Eric Schauberger; Susan Ewart; Veeresh Patil; Wilfried Karmaus
Journal:  Clin Epigenetics       Date:  2013-01-03       Impact factor: 6.551

9.  ADAM33 polymorphisms are associated with asthma and a distinctive palm dermatoglyphic pattern.

Authors:  Weilin Xue; Wei Han; Zhao-Shan Zhou
Journal:  Mol Med Rep       Date:  2013-10-14       Impact factor: 2.952

10.  Study of fingerprint patterns to evaluate the role of dermatoglyphics in early detection of bronchial asthma.

Authors:  Shiva Singh; Alkesh Kumar Khurana; Hemant Ashish Harode; Apoorva Tripathi; Abhijit Pakhare; Prashant Chaware
Journal:  J Nat Sci Biol Med       Date:  2016 Jan-Jun
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.