Literature DB >> 28122597

Beyond the entomological inoculation rate: characterizing multiple blood feeding behavior and Plasmodium falciparum multiplicity of infection in Anopheles mosquitoes in northern Zambia.

Smita Das1, Mbanga Muleba2, Jennifer C Stevenson1,3, Julia C Pringle1, Douglas E Norris4.   

Abstract

BACKGROUND: A commonly used measure of malaria transmission intensity is the entomological inoculation rate (EIR), defined as the product of the human biting rate (HBR) and sporozoite infection rate (SIR). The EIR excludes molecular parameters that may influence vector control and surveillance strategies. The purpose of this study was to investigate Anopheles multiple blood feeding behavior (MBF) and Plasmodium falciparum multiplicity of infection (MOI) within the mosquito host in Nchelenge District, northern Zambia. Mosquitoes were collected from light traps and pyrethroid spray catch in Nchelenge in the 2013 wet season. All anophelines were tested for blood meal host, P. falciparum, and MOI using PCR. Circumsporozoite (CSP) ELISA and microsatellite analysis were performed to detect parasites in the mosquito and MBF, respectively. Statistical analyses used regression models to assess MBF and MOI and exact binomial test for human sex bias. Both MBF and MOI can enhance our understanding of malaria transmission dynamics beyond what is currently understood through conventional EIR estimates alone.
RESULTS: The dominant malaria vectors collected in Nchelenge were Anopheles funestus (sensu stricto) and An. gambiae (s.s.) The EIRs of An. funestus (s.s.) and An. gambiae (s.s.) were 39.6 infectious bites/person/6 months (ib/p/6mo) and 5.9 ib/p/6mo, respectively, and took multiple human blood meals at high rates, 23.2 and 25.7% respectively. There was no bias in human host sex preference in the blood meals. The SIR was further characterized for parasite genetic diversity. The overall P. falciparum MOI was 6.4 in infected vectors, exceeding previously reported average MOIs in humans in Africa.
CONCLUSIONS: Both Anopheles MBF rates and P. falciparum MOI in Nchelenge were among some of the highest reported in sub-Saharan Africa. The results suggest an underestimation of the EIR and large numbers of circulating parasite clones. Together, the results describe important molecular aspects of transmission excluded from the traditional EIR measurement. These elements may provide more sensitive measures with which to assess changes in transmission intensity and risk in vector and parasite surveillance programs.

Entities:  

Keywords:  Anopheles mosquitoes; Entomological inoculation rate; ICEMR; Malaria; Multiplicity of infection; Zambia

Mesh:

Substances:

Year:  2017        PMID: 28122597      PMCID: PMC5267472          DOI: 10.1186/s13071-017-1993-z

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Background

Affecting an estimated 214 million people worldwide, malaria is a major public health problem with the burden disproportionately higher in sub-Saharan Africa, where Anopheles funestus (sensu stricto) and An. gambiae (s.s.) are the most efficient vectors of Plasmodium falciparum malaria [1]. From 2000–2015, there was a 42% decrease in malaria incidence in Africa [1]. Access to ITNs also increased from 2 to 56% from 2000 to 2014, respectively [1]. Such positive progress has been attributed to increased coverage of vector control interventions such as long lasting insecticide-treated nets (LLINs) and indoor residual spraying (IRS), access to rapid diagnostic tests (RDTs), and artemisinin-based combination therapy (ACT) [1]. As vector control activities continue, it will be imperative to conduct surveillance programs that accurately characterize vector foraging behavior and circulating malaria parasites to determine human risk for infection, anopheline behavioral and insecticide resistances, and emergence of parasite drug resistance and increased virulence in endemic populations. The success of vector control strategies is frequently evaluated pre- and post-intervention by the entomological inoculation rate (EIR) measurement, which is defined as the number of infectious bites per person per time period. It is an indication of malaria transmission intensity by anopheline vectors, and is calculated as the product of the human biting rate (HBR) and the Plasmodium species sporozoite infection rate (SIR) [2, 3]. A basic assumption of the HBR component of the EIR is that a mosquito bites (or probes) once and takes a single blood meal per gonotrophic cycle [4, 5]. However, if mosquitoes exhibit multiple blood feeding (MBF) behavior, taking more than one blood meal per gonotrophic cycle, then the HBR increases and subsequently the unadjusted EIR is underestimated [4, 5]. Basic ecological modeling of arthropod disease vectors has demonstrated that an underestimation of the proportion of people bitten may lead to a 2–4-fold increase in the basic reproductive number (R0), the number of infected individuals resulting from a single infectious person [6, 7]. Without accounting for MBF, the R0 may be underestimated, resulting in an unrecognized and increased risk of malaria within an affected population [4, 5]. Field studies have also illustrated that MBF may be successfully impacted by vector control measures. In southern Zambia, the An. arabiensis MBF rate decreased from 18.9% pre-ITN distribution to 9.1% post-distribution, which was attributed to heterogeneity in biting behavior [4, 5]. Understanding the heterogeneity in mosquito feeding behavior may also determine the contribution of different subpopulation of people to pathogen transmission and thus identify risk groups based on sex and age. For example, in western Kenya, young adults were more likely to be bitten by anophelines than older adults and children [8]. Although MBF is not accounted for in the EIR measurement, its estimation is important to accurately define malaria transmission dynamics. The second component of the EIR calculation, the SIR, is an indicator of vector infectiousness. A metric that is not included in the EIR, but further characterizes infectious sporozoites within the vector is the multiplicity of infection (MOI). The MOI is defined as the number of genetically distinct malaria parasite clones in an infected host [9-11]. Novel parasite genetic diversity arises during meiotic recombination in the mosquito midgut between multiple distinct clones that may originate from a single individual or multiple individuals [12, 13]. Unique clone production has been correlated with the frequency of crossing of parasite clones and subsequent meiotic recombination [12, 13]. Although the implications of MOI on transmission remain understudied, it is possible that MOI shapes not only the efficiency of transmission, but also may contribute to human disease outcomes [14, 15]. Studies in Cameroon have revealed that in comparison to monoclonal infections, multiclonal infections in mosquitoes are found at lower parasitemias, more likely to evade the mosquito immune defenses, and perhaps more efficiently vectored to human hosts [14, 15]. Presence of multiple clones may also lead to competition among clones that have the potential to influence and perhaps enhance parasite transmissibility, parasite genetics, and drive parasite evolution such as drug resistance or increased virulence [13, 14, 16, 17]. The correlation between MOI and clinical severity remains elusive. While some studies have observed a higher MOI in severe cases [18-21], others have not found any such relationship [16, 22–27]. P. falciparum MOI may be influenced by anopheline MBF through contact with more than one individual carrying a distinct clone(s) and subsequent meiotic recombination. Conversely, an infected Anopheles mosquito exhibiting MBF behavior results in repeat inoculations of genetically diverse malaria parasites to multiple individuals. Furthermore, the P. falciparum MOI detected in the human host is often lower and has different distinct alleles when compared to infected anophelines, a finding that has been attributed to gametocytes of clones existing in blood circulation below PCR detection level thresholds and then becoming more abundant and infectious in mosquitoes [13]. Characterizing Plasmodium sporozoites within the mosquito, especially in the context of multiple blood feeding behavior, may improve current estimates of MOIs and identify high risk areas or individuals. Both MBF and MOI enhance EIR by describing the extent, efficiency, and dynamics of malaria transmission. Together, they can serve as potentially important tools for surveillance in malaria endemic areas. Located along Lake Mweru in northern Zambia and bordering the Democratic Republic of Congo (DRC), Nchelenge District experiences intense malaria transmission year-round [28]. Both LLIN distribution and IRS campaigns have been implemented in Nchelenge since 2006, but the area remains at high risk for malaria [29]. The major vectors of P. falciparum transmission in this area are An. funestus (s.s.) and An. gambiae (s.s.), both of which are highly anthropophilic [28, 30]. An. funestus (s.s.) is the dominant vector with a higher EIR year-round compared to An. gambiae (s.s.), which increases and then declines dramatically from the wet to dry seasons [30]. Recent findings indicated that An. funestus (s.s.) is the predominant vector in streamside areas, whereas An. gambiae (s.s.) is most abundant in lakeside areas during the wet season [30]. The aims of this study were to further characterize the fundamental components of the EIR measurement by determining the multiple blood feeding frequency and human host sex preference of An. funestus (s.s.) and An. gambiae (s.s.), and the P. falciparum MOI in infected mosquitoes.

Methods

Study area

This study was conducted in collaboration with the Johns Hopkins Southern Africa International Centers for Excellence in Malaria Research (ICEMR) project in Nchelenge District, Luapula Province, in northern Zambia (9°19.115'S, 28°45.070'E; Fig. 1). Mean elevation is approximately 807 m above sea level and habitat is of a marsh ecotype. Nchelenge lies along the eastern perimeter of Lake Mweru, which serves as a border between southeastern Democratic Republic of Congo (DRC) and northern Zambia. Kenani Stream is a major water body that flows from south to north through the study area in Nchelenge and into Lake Mweru (Fig. 2). The region experiences three seasons: a single rainy season from November to May, a cool dry season from May to August, and a hot dry season from August-November. Malaria prevalence in this region is high, 38% by microscopy and 56% by RDT in children under the age of 5, and is considered holoendemic [29, 31]. Mosquito sampling was performed at households enrolled in the ICEMR program located within two defined 1-km2 grids along both Lake Mweru and another two 1-km2 grids inland near Kenani Stream (Fig. 2). These villages are representative of the local demography and landscape, and frequent seasonal movement of local people from fishing to farming endeavors.
Fig. 1

Nchelenge District field site is in northern Zambia and represents an area with high malaria transmission

Fig. 2

Satellite image of the study area in Nchelenge District. The 1-km2 grids for study collections are highlighted in blue. Katuna, Yenga, and Malulu villages are located in grids r34c5 and r34c6, Kapande B village and Mutepuka is located in grids r29c10 and r26c11, respectively. The white area on the left side of the image represents Lake Mweru. The yellow arrows point to Kenani Stream that flows into Lake Mweru

Nchelenge District field site is in northern Zambia and represents an area with high malaria transmission Satellite image of the study area in Nchelenge District. The 1-km2 grids for study collections are highlighted in blue. Katuna, Yenga, and Malulu villages are located in grids r34c5 and r34c6, Kapande B village and Mutepuka is located in grids r29c10 and r26c11, respectively. The white area on the left side of the image represents Lake Mweru. The yellow arrows point to Kenani Stream that flows into Lake Mweru

Mosquito collection and handling

From March 5-April 25, 2013 (rainy season), mosquitoes were collected by Center for Disease Control light traps (CDC LTs) and pyrethroid spray catches (PSCs) in five villages: three lakeside villages in grids r34c5 and r34c6 (Katuna, Yenga, and Malulu) and two streamside villages in grids r26c11 and r29c10 (Mutepuka and Kapande B) (Fig. 2). These same rainy season study villages and their respective mosquito collection and handling have been previously characterized [30]. CDC LT and PSC collections were conducted as previously described [28]. Briefly, lakeside and streamside villages were intensely sampled on alternate days of each week. Sampling took place at 39 lakeside and 38 streamside households, totaling 77 CDC LT and 77 PSC collections. Traps were hung indoors next to sleeping persons under LLINs, approximately 1.5 m above the floor from 18:00 to 6:00 h. PSCs were performed in the morning between 6:00 and 10:00 h in selected households using a 100% synthetic aerosol pyrethroid applied to ceilings, eaves, and walls [30]. All field-caught mosquitoes were killed immediately by freezing. Female anophelines were separated and morphologically identified to species using a dissecting microscope and dichotomous key [32, 33]. Mosquitoes were stored on desiccant either at room temperature or frozen at -20 °C until laboratory processing, which took place at Johns Hopkins Bloomberg School of Public Health (JHBSPH) in Baltimore, Maryland.

Mosquito DNA preparation and PCR

The head and thorax of each collected anopheline were separated from the abdomen and a modified salt extraction method was used to extract DNA from the abdomen [34]. Morphological identifications were confirmed using a polymerase chain reaction (PCR) specific for members of the An. funestus or An. gambiae complexes [35, 36]. If neither assay could confirm species identity, then a PCR targeting the ITS2 gene that amplifies a range of African anopheline species-specific fragments was used [35]. All specimens, regardless of visually-determined fed or unfed status, were tested for blood meal host using the Kent et al. (2005) multiplex PCR, which targets the mitochondrial cytochrome b gene producing a range of mammalian host specific bands [34]. A modification to the Kent PCR enhanced detection of human hosts. The multiplexed method amplifying the human cytochrome b gene remained the same, except that a new set of human primers replaced the original human forward primer. The new forward primer was FOR16068: 5'-GAC TCA CCC ATC AAC AAC CG-3' and the reverse primer was REV16260: 5'-GGC TTT GGA GTT GCA GTT GA-3' to produce a 193 base pair (bp) amplicon [28, 30]. The more sensitive Fornadel et al. (2010) PCR, which amplifies a 98 bp region of the mammalian cytochrome b gene followed by a restriction fragment length polymorphism (RFLP) assay specific to host of interest, was performed on samples that did not amplify a band(s) for blood meal host by the modified Kent et al. PCR [37]. If mosquitoes were morphologically classified as “unfed”, but contained a blood meal either PCR method, then those mosquitoes were labeled as “unfed but fed” [28]. DNA from mosquito abdomens was also used to test for the presence of the P. falciparum parasite using a PCR described by Fornadel et al. (2010) that amplifies a small 183 bp portion of the P. falciparum cytochrome b gene and has been shown to be more sensitive and reliable than other commonly used PCR-based assays [38].

Circumsporozoite enzyme-linked immunosorbent assay (CSP-ELISA) for Plasmodium falciparum detection in anophelines

The CSP-ELISA method adapted from Burkot et al. [39] and the Malaria Research and Reference Reagent Resource Center (MR4) was used to specifically detect P. falciparum circumsporozoite protein (CSP) in the mosquito head and thorax. Due to the large number of anophelines, a subsample of mosquitoes was selected for CSP-ELISA: 695/2417 (28.8%) An. funestus (s.s.) and 521/564 (92.4%) An. gambiae (s.s.) The minimum sample sizes for An. funestus (s.s.) and An. gambiae (s.s.) were calculated based on a 90% confidence interval using a hypothesized SIR of 0.02 and specified error of ± 0.01, which was n = 421. The hypothesized SIR for the vectors was based on previous preliminary 2012 wet and dry season collections. The specimens were randomized across all collection dates using Microsoft Excel (2011). Mosquito samples that had absorbance values greater than two-fold the negative control absorbance were considered CSP positive.

Human microsatellite analysis in anophelines

Multiple blood feeding behavior was determined by amplifying and sequencing human microsatellites in human-fed anophelines. A subsample of human-blooded An. funestus (s.s.) (n = 245), and An. gambiae (s.s.) (n = 140) were used for microsatellite analysis. Previous studies in Africa [8, 40] have recorded multiple blood feeding rates in both An. funestus (s.s.) and An. gambiae (s.s.) to range from approximately 10–20%. The sample size was calculated based on a 95% confidence interval, an assumed multiple blood feeding rate of 0.15 with a specified error of ± 0.05, which was n = 196. Due to the small number of total fed An. gambiae (s.s.) in the collection, the minimum sample size for this species was not attained. The specimens were randomized across all collection dates using Microsoft Excel (2011). Four loci were used to determine human allelic diversity and estimate the minimum number of contributors to a blood meal as previously described [4]. Primers fluorescently labeled with HEX and FAM were used to amplify the CSF1PO, THO1, Penta D STR (Penta D), and Silver-STR (D13S317) loci [41]. Minor primer modifications by Jiang et al. [42] were made to all primers (Table 1). The 20 μl PCR reaction for each microsatellite contained 10 mM Tris, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, 200 μM dNTPs, 2.0 U Taq polymerase, 20 pmol each forward and reverse primers, and 2 μl template DNA.
Table 1

Microsatellites and their corresponding label and primer sequences for multiple blood feeding assay and gender preference from engorged Anopheles mosquitoes

PrimerPrimer sequence (5’ to 3’)
CSF1PO A/HEX/ACTCCAGGGCAGTGTTCCA
CSF1PO BAGCCCATTCTCCAGCCTCC
D13S317 A/HEX/CATGGTATCACAGAAGTCT
D13S317 BCCAAAAAGACAGACAGAAAGATAG
PentaD A/HEX/AAGTAGGATCACTTGAGCCTG
PentaD BCAAGTCCTTTTTTAGATATGTGA
THO1 A/6-FAM/ATTCAAAGGGTATCTGGGCTCTG
THO1 BTGGGCTGAAAAGCTCCCGATTAT
Amelogenin A/6-FAM/CCCTGGGCTCTGTAAAGAATAGT
Amelogenin BATCAGAGCTTAAACTGGGAAGCTG
Microsatellites and their corresponding label and primer sequences for multiple blood feeding assay and gender preference from engorged Anopheles mosquitoes To determine the sex of the human host in fed mosquitoes, the Amelogenin locus was amplified using 6-FAM-labeled primers as previously described (Table 1) [4]. The 50 μl PCR reaction for Amelogenin contained 10 mM Tris, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, 400 μM dNTPs, 2.0 U Taq polymerase, 25 pmol each forward and reverse primers, and 2 μl template DNA. One microliter each from CSF1PO, THO1, Penta D, and D13S317 PCR reactions and 2 μl Amelogenin PCR reaction were multiplexed together with 15 μl formamide and 0.5 μl GeneScan-500 Rox size standard (Applied Biosystems Inc., Foster City, California) and incubated for 5 min at 95 °C. The samples were then prepared for shipment and subsequent fragment analysis to the DNA Analysis Facility on Science Hill (Yale University, New Haven, Connecticut). Sequencing results were analyzed using Peak Scanner 2 DNA fragment analysis software (Applied Biosystems Inc., Foster City, California) at the Johns Hopkins Bloomberg School of Public Health (JHBSPH). The software separated, profiled, and calculated sizes of DNA fragments based on the sequencing data. A blood meal was considered to be from multiple human hosts if there were three or more alleles at any microsatellite locus.

Plasmodium falciparum multiplicity of infection (MOI)

Anophelines that were positive for P. falciparum infection by the cytb PCR or CSP-ELISA were genotyped to determine the parasite MOI. The repetitive regions block 2 and 3 of merozoite surface protein 1 and 2 (msp-1 and msp-2), respectively, were amplified by a nested PCR, and the RII repeat region of glutamate receptor protein (glurp) of P. falciparum was amplified by a semi-nested PCR [16]. The second nested reaction in the overall PCR protocol detects allelic variants including K1, MAD20, and RO33 families of msp-1 block 2, the FC27 and 3D7/IC families of msp-2 block 3, and the RII (GLURP) block of glurp [16]. Following gel electrophoresis, amplicon sizes were characterized using FluorChem Image Analyzer (Protein Simple) to determine distinct alleles. For each isolate, the msp-1, msp-2, and glurp allelic families were described. If a single PCR amplicon was detected at only one locus (msp1, msp2, or glurp), the parasite was considered to be monoclonal. If more than one PCR amplicon was detected at any locus, then the infection was considered to contain multiple P. falciparum genotypes. The number of bands for msp-1 and msp-2 were determined by adding the bands observed for K1, MAD20, RO33 families, and the FC27 and 3D7/IC families, respectively [16, 43]. The largest number of bands at any of the loci (msp-1, msp-2, glurp) was considered the overall MOI in the infected mosquito vector [16, 43]. The alleles for each family were placed into bins with a 40 bp width to determine the number of distinct alleles [44-46]. The mean MOI was calculated by dividing the sum of each sample’s overall MOI by the number of positive samples.

Statistical analysis

A logistic regression model with random effects to account for repeated sampling at two geographically distinct areas, Lake Mweru and Kenani Stream (lake versus stream), and clustering of traps was used to compare An. funestus (s.s.) and An. gambiae (s.s.) multiple blood feeding behavior and overall detection rates of parasite clones among loci and allelic families in anopheline vectors. Bias in sex preference of anopheline blood meals was identified by exact binomial test where the hypothesized probability of males was 0.50. A negative binomial regression with random effects for repeated collections between lake and stream, and clustering of traps was used to investigate the overall P. falciparum MOI among antigenic markers, as well as between and within infected An. funestus (s.s.) and An. gambiae (s.s.). Statistical significance was defined as a P-value less than or equal to 0.05. All statistical analyses were performed using STATA version 11 software.

Results

Species identification

Two thousand nine hundred and eighty-nine Anopheles mosquitoes were caught from 77 households, most of which were An. funestus (s.s.) (80.9%, n = 2,417), followed by An. gambiae (s.s.) (18.9%, n = 564) and An. leesoni (0.2%, n = 8). An. leesoni was not included in this study due to its small sample size. As described previously [30], of the 2,981 An. funestus (s.s.) and An. gambiae (s.s.), 2,024 (67.9%) and 957 (32.1%) were collected by CDC LTs and PSCs, respectively. The lakeside collections (n = 134) showed smaller numbers of malaria vectors collected by PSCs (11.9%, n = 16) compared to CDC LTs (88.1%, n = 118). Similarly, PSCs collected fewer anophelines compared to CDC LTs in the streamside collections (n = 2,847), 941 (33.1%) and 1,906 (66.9%), respectively.

Blood feeding behavior

All Anopheles mosquitoes regardless of morphological abdominal status were tested for blood meal host due to the possibility that there may be mosquitoes that appear “unfed”, but contain blood (“unfed but fed”) as determined by molecular assays [28]. A total of 18.4% (444/2417) An. funestus (s.s.) and 17.7% (100/564) An. gambiae (s.s.) were visually fed, of which 430 (96.8%) and 90 (90%) were human-fed, respectively. There were 24 An. funestus (s.s.) and 6 An. gambiae (s.s.) that had mixed human and goat blood meals. Of the anophelines that were morphologically classified as “unfed”, 415 were positive for a human host: 344 An. funestus (s.s.), 68 An. gambiae (s.s.), and 3 An. leesoni. Mixed human and goat blood meals were detected in 7 An. funestus (s.s.) and 3 An. gambiae (s.s.). The resulting average human blood indices (HBIs), defined as the proportion of human blood meals, for An. funestus (s.s.) and An. gambiae (s.s.) were 0.96 and 0.95, respectively.

Plasmodium falciparum detection

By CSP-ELISA, overall P. falciparum positivity rates using both CDC LT and PSC collections were 2.7% (19/695) for An. funestus (s.s.) and 3.1% (16/521) for An. gambiae (s.s.). By PCR, 1% (24/2434) of An. funestus (s.s.) and 1.8% of An. gambiae (s.s.) (10/564) were P. falciparum positive. Of the malaria vectors that were tested by both CSP-ELISA and PCR, 1% (7/695) of An. funestus (s.s.) and 0% (0/521) of An. gambiae (s.s.) were malaria-positive.

Multiple blood feeding

Of the 385 human-fed anophelines tested for MBF by human microsatellite analysis, 280 (72.7%) were successfully genotyped at more than one locus. This subset was composed of 179 An. funestus (s.s.) and 101 An. gambiae (s.s.). Mosquitoes determined to be “fed” by the Fornadel et al. PCR made up 75.2% of the failed microsatellite samples (79/105), suggesting that the quantity of host DNA may have been too limited or highly degraded for the microsatellite assay. Of the four loci, CSP1PO had the lowest failure rate (40.3%, 155/385) and THO1 had the highest failure rate (57.4%, 221/385). In total, 27.5% (106/385) of genotyped anophelines failed at all loci. The overall multiple blood feeding frequencies for An. funestus (s.s.) and An. gambiae (s.s.) were 24% (43/179) and 27.7% (28/101), respectively, and no evidence of a difference was found between these rates (OR = 1.1, 95% CI: -0.62–1.8, P = 0.83). Of the 280 human-fed anophelines detected by microsatellite analysis, 97 were “unfed but fed”: 55 An. funestus (s.s.) and 42 An. gambiae (s.s.). The MBF rate was 16.4% (9/55) and 40.5% (17/42) for An. funestus (s.s.) and An. gambiae (s.s.), respectively.

Human sex preference

The sex of detected human hosts in fed Anopheles mosquitoes was successfully amplified at the Amelogenin locus in 80.5% samples (310/385). The proportion of human blood meals detected in both Anopheles vectors belonging to males was not significantly different to that of females: 53.2% (n = 165) for males and 46.8% (n = 145) for females (P = 0.20). When compared to the Nchelenge District-wide ratio of human males to females as determined by the Zambia 2010 census [47], 48.5 to 51.5%, the mosquito feeding remained unbiased (P = 0.20).

Multiplicity of infection (MOI)

Both P. falciparum PCR and ELISA positive anophelines (n = 62) were used to investigate the MOI. The overall rate of successful amplification was 80.6% (50/62). At the msp-1, msp-2, and glurp loci in 50 P. falciparum infected mosquitoes 86% (n = 43), 94% (n = 47), and 48% (n = 24) were successfully amplified (Table 2). In the successfully amplified samples, multiple and single clones were detected in 47 (94%) and 3 (6%) infected mosquitoes, respectively. The mean P. falciparum MOIs for successfully amplified loci were 5.3 (Standard Deviation, SD = 3.7), 5.8 (SD = 3.8), and 1.6 (SD = 1.0) for msp-1, msp-2, and glurp, respectively, and the overall mean MOI was 6.4 (SD = 4.1) (Table 3). The MOIs of msp-1 and msp-2 were 3.5 and 3.8 times greater that of glurp (msp-1: RR = 3.3, 95% CI: 2.3–5.1, P < 0.001; msp-2: RR = 3.78, 95% CI: 2.6–5.6, P < 0.001), and no evidence of a difference between the msp-1 and msp-2 MOIs (RR = 1.1, 95% CI: 0.87–1.38, P = 0.44). The odds of detecting P. falciparum clones at msp-1 and msp-2 loci were 6.9 and 11 times greater, respectively, compared to glurp (msp-1: OR = 6.9, 95% CI: 2.56–18.8, P < 0.001; msp-2: OR = 11, 95% CI: 3.83–31.6, P < 0.001). The odds of detecting parasite clones between msp-1 and msp-2 (OR = 1.7, 95% CI: 0.61–4.7, P = 0.31) did not support a difference.
Table 2

Summary of msp-1, msp-2, and glurp positive detection rates in successfully amplified P. falciparum-infected Anopheles mosquitoes (n = 50) from March-April 2013 in Nchelenge District, northern Zambia

GeneNo. positive (%)
msp-1 43 (86)
K140 (80)
MAD2024 (48)
RO3326 (52)
msp-2 47 (94)
FC2744 (88)
IC/3D738 (76)
glurp 24 (48)
Table 3

Overview of P. falciparum infection complexity in successfully amplified Anopheles mosquitoes (n = 50) from March-April 2013 in Nchelenge District, northern Zambia

GeneMean MOI ± SDNo. of distinct genotypes
msp-1 5.3 ± 3.731
K12.2 ± 1.511
MAD202.8 ± 1.88
RO332.7 ± 1.812
msp-2 5.8 ± 3.837
FC273.7 ± 2.521
IC/3D72.3 ± 1.316
glurp 1.6 ± 1.012
Overall MOI6.4 ± 4.1

Abbreviation: MOI multiplicity of infection; SD standard deviation

Summary of msp-1, msp-2, and glurp positive detection rates in successfully amplified P. falciparum-infected Anopheles mosquitoes (n = 50) from March-April 2013 in Nchelenge District, northern Zambia Overview of P. falciparum infection complexity in successfully amplified Anopheles mosquitoes (n = 50) from March-April 2013 in Nchelenge District, northern Zambia Abbreviation: MOI multiplicity of infection; SD standard deviation The successfully genotyped infected mosquitoes comprised of 34 (68%) An. funestus (s.s.) and 16 (32%) An. gambiae (s.s.). The ranges in numbers of parasite clones for An. funestus (s.s.) and An. gambiae (s.s.) were similar: 1–12 and 1–14 clones, respectively (Fig. 3). The mean MOIs of An. funestus (s.s.) and An. gambiae (s.s.) were comparable, 5.9 and 7.5, respectively (RR = 1.2, 95% CI: 0.70–2.13, P = 0.48). There was no evidence of a difference in MOI between An. funestus (s.s.) and An. gambiae (s.s.) at msp-1, msp-2, and glurp (msp-1: RR = 0.86, 95% CI: 0.44–1.67, P = 0.66; msp-2: RR = 1.53, 95% CI: 0.84–2.80, P = 0.16; glurp: RR = 0.84, 95% CI: 0.35–2.02, P = 0.70). There was also no evidence of differences in the detection success of msp-1, msp-2, and glurp between both Anopheles mosquitoes (msp-1: OR = 0.56, 95% CI: 0.09–3.49, P = 0.53; msp-2: OR = 1.33, 95% CI: 0.25–7.04, P = 0.74; glurp: OR = 0.74, 95% CI: 0.21–2.53, P = 0.63). The MOIs of the three loci were also compared within vector species. For An. funestus (s.s.), the MOIs of msp-1 and msp-2 were both approximately 3.6 times higher than glurp (msp-1: RR = 3.58, 95% CI: 2.29–5.62, P < 0.001; msp-2: RR = 3.62, 95% CI: 2.31–5.68, P < 0.001). In An. funestus (s.s.), the MOI of msp-1 compared to msp-2 loci was identical (RR = 1, 95% CI: 0.8–1.3, P = 0.96) and the detection success of the three loci showed that msp-1 and msp-2 amplified better than glurp (msp-1: OR = 16.5, 95% CI: 4.0–68.5, P < 0.001; msp-2: OR = 9.1, 95% CI: 2.46–33.6, P = 0.001). The odds of amplification between msp-1 and msp-2 did not suggest a difference (OR = 0.52, 95% CI: 0.14–1.95, P = 0.33). For An. gambiae (s.s.), the msp-1 and msp-2 MOIs were 3.5 and 4.3 times greater, respectively, compared to glurp (msp-1: RR = 3.47, 95% CI: 1.75–6.87, P < 0.001; msp-2: RR = 4.26, 95% CI: 2.19–8.29, P < 0.001), and msp-2 MOI was 1.2 times that of msp-1 (RR = 1.25, 95% CI: 0.86–1.82, P = 0.25). The odds of detecting msp-1 compared to glurp and msp-2 to msp-1 in An. gambiae (s.s.) were greater, but not significant (msp-1: OR = 6.74, 95% CI: 0.92–49.1, P = 0.06; msp-2: OR = 8.02, 95% CI: 0.72–89.2, P = 0.09). Msp-2 had greater odds of detection compared to glurp (OR = 29.4, 95% CI: 2.92–296.2, P = 0.004).
Fig. 3

Frequency distribution of P. falciparum multiplicity of infection (MOI) in infected Anopheles funestus (s.s.) and An. gambiae (s.s.) in Nchelenge District

Frequency distribution of P. falciparum multiplicity of infection (MOI) in infected Anopheles funestus (s.s.) and An. gambiae (s.s.) in Nchelenge District For each P. falciparum gene locus with more than one allelic family, successfully genotyped parasites in anophelines were characterized (Table 2). For the msp-1 locus, the detection odds of MAD20 and RO33 families were lower compared to K1 (MAD20: OR = 0.22, 95% CI: 0.09–0.55, P = 0.001; RO33: OR = 0.27 95% CI: 0.11–0.66, P = 0.004). The odds of detection of RO33 compared to MAD20 (OR = 1.2, 95% CI: 0.53–2.60, P = 0.69) supported no difference between markers. The odds of malaria parasite detection in infected mosquitoes at msp-2 FC27 and IC/3D7 families suggested no evidence of a difference (OR = 1.96, 95% CI: 0.76–5.05, P = 0.16). Within each allelic family of the msp-1 (K1, MAD20, RO33), msp-2 (FC27, IC/3D7), and glurp (GLURP) genes, distinct alleles were enumerated. At the msp-1 and msp-2 loci, 31 and 37 distinct alleles were observed, respectively (Table 3). For glurp, 12 unique alleles were identified (Table 3). K1, RO33, and FC27 showed greater parasite diversity (Table 3), suggesting that parasite clones containing polymorphisms in these allelic families were predominant.

Discussion

Despite their influence on malaria epidemiology, anopheline MBF and P. falciparum MOI are traditionally not considered when assessing the EIR. Here, these parameters were evaluated in parallel with HBR and SIR to more accurately investigate the foraging behavior of malaria vectors in Nchelenge District. Collections of mosquitoes in this district revealed An. funestus (s.s.) and An. gambiae (s.s.) as the main malaria vectors both of which were highly anthropophilic. As reported previously from the same 2013 collection presented in this study, a large proportion of total anophelines in this collection, especially An. funestus (s.s.), were trapped in the streamside households compared to the lakeside households, illustrating heterogeneity in malaria vector species [30]. This may be attributable in part to differences in breeding sites, vegetation for resting, human population density, and application of vector control, among others, between the lake and stream areas. The trapping methods used in this study, CDC LT and PSC, target indoor mosquitoes only, but the possibility remains that these same vectors are also feeding intensely on humans or other mammals and additionally resting outdoors. As a result, it will be important to perform additional further studies that include outdoor foraging and resting collections. An. funestus (s.s.) and An. gambiae (s.s.) exhibited MBF behavior at rates of 24% and 27.7%. Observed differences in MBF frequencies between vectors were not observed, suggesting that An. funestus (s.s.) and An. gambiae (s.s.) feed on multiple people in a single gonotrophic cycle at similar rates. These rates are much higher than the 11–14% multiple blood feeding rates reported for An. funestus (s.s.) and An. gambiae (s.s.) in western Kenya [8], 10% rate for An. gambiae (s.s.) in Nigeria [44], 9% rate for An. funestus (s.l.) in Tanzania [40], and even the high rate of 18.9% reported for An. arabiensis prior to the introduction of LLINs in southern Zambia [4]. Multiple blood meals were detected in morphologically unfed mosquitoes that were PCR confirmed as fed, suggesting that the microsatellite assay is highly sensitive in identifying multiple meals even in incomplete or partially digested blood meals. Furthermore, our findings on multiple blood feeding behavior in these Anopheles species reveal that the process of taking a blood meal is disrupted more frequently than our previous estimates indicated [28]. Factors that may influence multiple blood feeding include host defensive behavior, response to vector control, and parasite modulation of vector feeding behavior [4, 5, 8, 40, 48–58]. The epidemiologic impact of multiple blood feeding behavior is that it increases the human biting rate, leading to an increase in the reproductive number R0. For example, when a 20% daily multiple blood feeding rate is accounted for in the vectorial capacity equation, the predicted result is a 44% increase in the number of new infectious bites [59, 60]. This highlights the sensitivity of vectorial capacity to even small changes in the HBR. A simpler, more practical parameter that directly corresponds to malaria risk is the EIR, defined as the number of infective bites per individual per time period. In Nchelenge District, EIRs during the 2013 wet season for An. funestus (s.s.) and An. gambiae (s.s.) were 39.6 ib/p/6mo and 5.9 ib/p/6mo, respectively [30]. If multiple blood feeding is considered, the resulting EIRs would increase to 48.8 ib/p/6mo for An. funestus (s.s.) and 7.4 ib/p/6mo for An. gambiae (s.s.). An increased biting rate decreases the vector population size needed to sustain malaria parasite transmission and smaller populations may be more difficult to control and eliminate [61]. Accordingly, vector control programs that aim to reduce human infection by decreasing the Anopheles population may have to be more efficient for the same impact if a single mosquito could contribute to multiple human infections during a single gonotrophic cycle. The identification of human male or female blood in fed Anopheles vectors can reveal heterogeneities in risk and potentially target control strategies. In Nchelenge District, there was no bias in sex preference for blood feeding by An. funestus (s.s.) and An. gambiae (s.s.) considering the proportion or males to females according to district census data, suggesting that males and females are bitten, equally, and both contribute and are exposed to local transmission. Similar research in southern Zambia also found no significant difference in the biting preference of An. arabiensis [5], whereas other studies of An. funestus (s.s.) and An. gambiae (s.s.) in Kenya and Tanzania observed a feeding bias towards young children and males, respectively [40, 46]. DNA profiling of household inhabitants would have provided additional details about the human age groups of blood meals [40]. Further studies are warranted to better understand sex or age preference of mosquitoes, and how human behavior, ITN use, and human malaria epidemiology may affect blood feeding preferences. The second component of the EIR, the SIR, does not traditionally include a characterization of the parasite genetic diversity found within an infected vector and human host, and its implications for transmission in a malaria endemic population. Although P. falciparum MOI does not affect the EIR per se, it does describe an important aspect of vector- host transmission that is not included in the calculation. To the authors’ knowledge, there have been no other reports of P. falciparum MOI in field-caught mosquitoes. Collections in this study revealed multiple clones in over 90% of infected anophelines ranging from 1–12 and 1–14 clones in An. funestus (s.s.) and An. gambiae (s.s.), respectively. The overall MOI was 6.4, indicative of a high transmission setting [11, 43, 62], and is among some of the highest MOIs reported when compared to that of infected humans in Africa: 3.7 in Tanzania, 3.4 in Cote d’Ivoire, 3.2 in Mauritania, 3.0 in Uganda, 2.0 in western Kenya, 1.9 in eastern Sudan, and 1.5 in Nigeria and the Gambia [13, 16, 26, 43, 63–66]. The overall MOI was comparable between the two vector species, with 5.9 and 7.5 clones in An. funestus (s.s.) and An. gambiae (s.s.), respectively, and the numbers and frequency of clones harbored by both vectors were also similar. Furthermore, it is interesting that, although the proportion of An. gambiae (s.s.) is smaller within the P. falciparum-positive anopheline population, this vector has a higher average MOI than that of An. funestus (s.s.). This may be due to the small sample size and warrants additional studies to confirm and understand interspecies variation in MOI. Eighty unique P. falciparum alleles were identified in the vectors and were most diverse at the msp-1 and msp-2 loci, with the K1 and FC27 alleles being predominant, respectively. The successful PCR amplification of msp-1 and msp-2 compared to glurp has been reported previously and suggests the importance of including multiple loci to better estimate the MOI [16, 67–69]. The study results indicate that glurp may simply not be as polymorphic as the msp loci or is weakly amplified, and therefore is a poor marker for genetic diversity [16]. The number of unique clones within an infected anopheline is indicative of transmission success, highlighting the crucial role the mosquito has in sustaining parasite diversity [15]. In the context of Anopheles MBF behavior, P. falciparum genetic diversity may be positively influenced by the acquisition and transmission of multiple distinct clones by feeding on several individuals in a single gonotrophic cycle. Further studies will need to be performed to better define the potential interaction between foraging behavior and parasite population structure, especially in the context of parasite evolution and emergence of drug resistance or increased virulence. Preliminary analysis of MOI in 25 infected human DBS collected in Nchelenge as part of a separate ICEMR survey in April 2013 showed a much smaller range of multiple clones (1–9), mean MOI (3.1), and a lower number of distinct clones (21) compared to our findings in anophelines (Das et al. unpublished). The initial human MOI results are consistent with MOIs reported across Africa [13, 16, 26, 43, 63–66], and therefore suggests that there may be clones that are undetectable in humans, but equally transmitted and potentially more abundant in mosquitoes. More extensive studies that coordinate both mosquito and human blood specimen collections longitudinally will be required to evaluate inoculation rates of genetically diverse parasite clones by mosquitoes, vector biting heterogeneities, and the subsequent effect in the human population. Additionally, there have been reports of both P. falciparum and P. ovale co-infections in Nchelenge District (personal communication, Mbanga Muleba). The detection and influence of mixed infections of non-conspecific strains, if any, on P. falciparum MOI would certainly add to the body of knowledge regarding the complex interaction of multiple infections, clone development in both mosquito vectors and humans, and possible clinical outcomes. The observed MOI in the mosquito abdomen, which was used for genotyping in this study, may be overestimated due meiotic recombination giving rise to numerous distinct clones, of which some may be selected against during ookinete crossing of the midgut. Accordingly, the lower MOI in the sporozoite stage supports the similarity in MOI between gametocytes in the human host and sporozoites in the anopheline vector as described by Morlais et al. [15]. However, Morlais et al. also reported that there were some oocyst and sporozoite allelic polymorphisms that were not detected in gametocytes, and this was attributed to imperfect detectability of minor clones in asymptomatic carriers and mosquitoes [15]. Moreover, when comparing vector and human MOI, a study in the Gambia found multiple oocyst clones in infected mosquitoes that were undetected in infected human blood samples, and the rate of distinct parasite alleles in the vector was much higher than would be expected by P. falciparum meiotic recombination patterns [13, 15]. Thus, these parasite clones may exist below the limit of detection in the human host, but thrive inside the mosquito where genetic diversity is maintained or expanded and novel clones are produced [13]. Together, the modeling and Gambia studies suggest that the parasite MOI observed in the mosquito midgut most likely reflects the clones that can evade both the human and mosquito immune systems and circulate within an endemic area such as Nchelenge. Future studies comparing the MOI of malaria oocyst and sporozoite stages in mosquitoes and their relationships with mono- or multiclonal gametocytes in both the vector and human hosts should be performed to better understand parasite transmission dynamics. There were three main limitations in this study. First, for detection of multiple blood meals in anophelines, the method used to identify different hosts in a blooded mosquito was based on the three-allele method previously described by Norris et al. [4]. Previous studies in Kenya and Tanzania have used 6-locus and 8-locus fingerprints because several loci increase detection of numerous alleles that can be matched to fingerprints of clinical human blood specimens [40, 46]. The simulation model from which the three-allele method is based upon, indicated that a missed detection rate of 30–32% results in only a 3–5% bias [4]. In this study, the missed detection rate was smaller, 27.5%, suggesting a bias lower than that predicted by the Norris et al. model. It should be noted that a large proportion of the failed samples were from anophelines that were visually scored as unfed but found to be blooded by PCR; genotyping failure was likely due to low human DNA concentration in these mosquitoes. For the purposes of this study, the three-allele method was likely sufficient to identify the presence or absence of multiple blood meals, although a future study that includes more loci and matches mosquito blood meals to human genetic fingerprints would be informative. Secondly, for the MOI studies, the number of distinct alleles may have been underestimated by choosing the conservative 40 bp bin width used in this study to discern bands on multiple gels with varying electrophoretic migration of DNA fragments [44]. A more sensitive method like microsatellite analysis would help quantify the bias in PCR-based allele counts. Finally, the targeted PCR method used in this study for P. falciparum clones is not the most accurate method of measuring MOI; recently, microsatellite analysis has shown increased sensitivity in clone detection [15]. However, this method is expensive, requires special equipment and personnel training, and is not practical for field use. In this study, it was observed that the glurp locus was a poor marker for MOI detection by PCR, which by itself would have provided limited information. The addition of two more loci, msp-1 and msp-2, was critical in identifying P. falciparum clones, indicating that when multiple loci are included, PCR can be a sufficient technique for measuring MOI. Accordingly, PCR can provide an adequate estimation of clonal parasite populations to observe epidemiological changes in field settings. However, if possible, microsatellite studies and other novel genetic or genomic methods should be used to complement PCR methods for more in-depth characterization of parasite clones in Nchelenge.

Conclusions

Although multiple blood feeding behavior of mosquitoes and parasite multiplicity of infection are not part of the traditional malaria EIR measurement, molecular assessment of these parameters reveals additional complexity, which in this case increased existing EIR estimates. The investigation of MBF and MOI also provides additional insight into vector foraging behavior and parasite genetic diversity in a high transmission setting. The anopheline MBF rates and P. falciparum MOI in Nchelenge during the 2013 wet season were some of the highest recorded compared to that of humans in Africa. MBF behavior may also sustain already circulating clones and contribute to the generation of distinct parasites in the mosquito through repeated and potentially heterogeneous feedings on multiple individuals. Future studies should further define these parameters to inform how foraging behavior may influence the generation and evolution of parasites in holoendemic settings. These data suggest that anopheline MBF and MOI studies may serve as helpful tools in surveillance and research programs; the detection of changes in feeding behavior and malaria parasite genetic diversity may identify heterogeneities in malaria risk and changes in parasite population structure that will contribute to our understanding and development of effective malaria control strategies.
  62 in total

Review 1.  Feeding strategies of anthropophilic mosquitoes result in increased risk of pathogen transmission.

Authors:  Thomas W Scott; Willem Takken
Journal:  Trends Parasitol       Date:  2012-01-31

2.  Heterogeneities in the transmission of infectious agents: implications for the design of control programs.

Authors:  M E Woolhouse; C Dye; J F Etard; T Smith; J D Charlwood; G P Garnett; P Hagan; J L Hii; P D Ndhlovu; R J Quinnell; C H Watts; S K Chandiwana; R M Anderson
Journal:  Proc Natl Acad Sci U S A       Date:  1997-01-07       Impact factor: 11.205

3.  Frequency of multiple blood meals taken in a single gonotrophic cycle by Anopheles arabiensis mosquitoes in Macha, Zambia.

Authors:  Laura C Norris; Christen M Fornadel; Wei-Chien Hung; Fernando J Pineda; Douglas E Norris
Journal:  Am J Trop Med Hyg       Date:  2010-07       Impact factor: 2.345

4.  The value of vector-based estimates of malaria transmission.

Authors:  T R Burkot; P M Graves
Journal:  Ann Trop Med Parasitol       Date:  1995-04

5.  Effect of defensive host behavior on the blood meal size and feeding success of natural populations of mosquitoes (Diptera: Culicidae).

Authors:  M J Klowden; A O Lea
Journal:  J Med Entomol       Date:  1979-09-04       Impact factor: 2.278

6.  Biased distribution of msp1 and msp2 allelic variants in Plasmodium falciparum populations in Thailand.

Authors:  G Snounou; X Zhu; N Siripoon; W Jarra; S Thaithong; K N Brown; S Viriyakosol
Journal:  Trans R Soc Trop Med Hyg       Date:  1999 Jul-Aug       Impact factor: 2.184

7.  Heterogeneity and changes in inequality of malaria risk after introduction of insecticide-treated bed nets in Macha, Zambia.

Authors:  Laura C Norris; Douglas E Norris
Journal:  Am J Trop Med Hyg       Date:  2013-02-04       Impact factor: 2.345

8.  Polymorphism of the merozoite surface protein-1 block 2 region in Plasmodium falciparum isolates from Mauritania.

Authors:  Mohamed Salem O Ahmedou Salem; Magatte Ndiaye; Mohamed OuldAbdallahi; Khadijetou M Lekweiry; Hervé Bogreau; Lassana Konaté; Babacar Faye; Oumar Gaye; Ousmane Faye; Ali O Mohamed Salem O Boukhary
Journal:  Malar J       Date:  2014-01-23       Impact factor: 2.979

9.  Plasmodium falciparum mating patterns and mosquito infectivity of natural isolates of gametocytes.

Authors:  Isabelle Morlais; Sandrine E Nsango; Wilson Toussile; Luc Abate; Zeinab Annan; Majoline T Tchioffo; Anna Cohuet; Parfait H Awono-Ambene; Didier Fontenille; François Rousset; Antoine Berry
Journal:  PLoS One       Date:  2015-04-14       Impact factor: 3.240

10.  Plasmodium falciparum genotypes diversity in symptomatic malaria of children living in an urban and a rural setting in Burkina Faso.

Authors:  Issiaka Soulama; Issa Nébié; Alphonse Ouédraogo; Adama Gansane; Amidou Diarra; Alfred B Tiono; Edith C Bougouma; Amadou T Konaté; Gustave B Kabré; Walter Rj Taylor; Sodiomon B Sirima
Journal:  Malar J       Date:  2009-06-20       Impact factor: 2.979

View more
  12 in total

1.  Determination of human identity from Anopheles stephensi mosquito blood meals using direct amplification and massively parallel sequencing.

Authors:  Shayna L Gray; Teresa M Tiedge; Joann M Butkus; Tyler J Earp; Scott E Lindner; Reena Roy
Journal:  Forensic Sci Int Genet       Date:  2020-07-11       Impact factor: 4.882

2.  Expanded geographic distribution and host preference of Anopheles gibbinsi (Anopheles species 6) in northern Zambia.

Authors:  Mary E Gebhardt; Rachel S Krizek; Maureen Coetzee; Lizette L Koekemoer; Yael Dahan-Moss; David Mbewe; James Sichivula Lupiya; Mbanga Muleba; Jennifer C Stevenson; William J Moss; Douglas E Norris
Journal:  Malar J       Date:  2022-07-03       Impact factor: 3.469

3.  Seasonal variations in Plasmodium falciparum genetic diversity and multiplicity of infection in asymptomatic children living in southern Ghana.

Authors:  Joshua Adjah; Bless Fiadzoe; Ruth Ayanful-Torgby; Linda E Amoah
Journal:  BMC Infect Dis       Date:  2018-08-29       Impact factor: 3.090

4.  The Diversity, Multiplicity of Infection and Population Structure of P. falciparum Parasites Circulating in Asymptomatic Carriers Living in High and Low Malaria Transmission Settings of Ghana.

Authors:  Zakaria Abukari; Ruth Okonu; Samuel B Nyarko; Aminata C Lo; Cheikh C Dieng; Samson P Salifu; Ben A Gyan; Eugenia Lo; Linda E Amoah
Journal:  Genes (Basel)       Date:  2019-06-07       Impact factor: 4.096

5.  High malaria parasitemia among outpatient febrile children in low endemic area, East-Central Tanzania in 2013.

Authors:  Beatrice Chipwaza; Robert D Sumaye
Journal:  BMC Res Notes       Date:  2020-05-24

6.  Blood-feeding patterns of Anopheles vectors of human malaria in Malawi: implications for malaria transmission and effectiveness of LLIN interventions.

Authors:  Rex B Mbewe; John B Keven; Themba Mzilahowa; Don Mathanga; Mark Wilson; Lauren Cohee; Miriam K Laufer; Edward D Walker
Journal:  Malar J       Date:  2022-03-03       Impact factor: 2.979

7.  Examining the human infectious reservoir for Plasmodium falciparum malaria in areas of differing transmission intensity.

Authors:  Bronner P Gonçalves; Melissa C Kapulu; Patrick Sawa; Wamdaogo M Guelbéogo; Alfred B Tiono; Lynn Grignard; Will Stone; Joel Hellewell; Kjerstin Lanke; Guido J H Bastiaens; John Bradley; Issa Nébié; Joyce M Ngoi; Robin Oriango; Dora Mkabili; Maureen Nyaurah; Janet Midega; Dyann F Wirth; Kevin Marsh; Thomas S Churcher; Philip Bejon; Sodiomon B Sirima; Chris Drakeley; Teun Bousema
Journal:  Nat Commun       Date:  2017-10-26       Impact factor: 14.919

8.  Genetic diversity and genotype multiplicity of Plasmodium falciparum infection in patients with uncomplicated malaria in Chewaka district, Ethiopia.

Authors:  Abdulhakim Abamecha; Hassan El-Abid; Daniel Yilma; Wondimagegn Addisu; Achim Ibenthal; Abebe Genetu Bayih; Harald Noedl; Delenasaw Yewhalaw; Mohieddine Moumni; Alemseged Abdissa
Journal:  Malar J       Date:  2020-06-08       Impact factor: 2.979

9.  Sequential blood meals promote Leishmania replication and reverse metacyclogenesis augmenting vector infectivity.

Authors:  Tiago D Serafim; Iliano V Coutinho-Abreu; Fabiano Oliveira; Claudio Meneses; Shaden Kamhawi; Jesus G Valenzuela
Journal:  Nat Microbiol       Date:  2018-03-19       Impact factor: 17.745

10.  Improved Detectability of Plasmodium falciparum Clones with Repeated Sampling in Incident and Chronic Infections in Burkina Faso.

Authors:  Aissata Barry; Shehu S Awandu; Alfred B Tiono; Lynn Grignard; Teun Bousema; Katharine A Collins
Journal:  Am J Trop Med Hyg       Date:  2021-11-01       Impact factor: 2.345

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.